Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Cancer Research

En omfattende Procedure at evaluere In Vitro ydeevne af den formodede Hemangioblastoma Neovascularization ved hjælp af den sfæroide, spiring Assay

doi: 10.3791/57183 Published: April 12, 2018

Summary

Dette paper præsenterer en omfattende procedure for at evaluere in vitro- om klassiske tumor angiogenese findes i hemangioblastomas (HBs) og dens rolle i HBs. Resultaterne fremhæve kompleksiteten af HB-neovascularization og foreslå, at denne fælles form for angiogenese er kun en supplerende mekanisme i HB-neovascularization.

Abstract

Inaktivering af von Hippel-Lindau (VHL) tumor suppressor genet spiller en afgørende rolle i udviklingen af hemangioblastomas (HBs) inden for det menneskelige centralnervesystemet (CNS). Men både cytologiske oprindelse og den evolutionære proces af HBs (herunder neovascularization) er fortsat kontroversielt, og anti-angiogenese for VHL-HBs, baseret på klassisk HB angiogenese, har givet skuffende resultater i kliniske forsøg. En væsentlig hindring for succesfulde kliniske oversættelse af anti-vaskulære behandling er manglen på en grundig forståelse af neovascularization i denne vaskulær tumor. I denne artikel præsenterer vi en omfattende procedure for at evaluere in vitro- om klassiske tumor angiogenese findes i HBs, såvel som dens rolle i HBs. Med denne procedure, kan forskere præcist forstå kompleksiteten i HB neovascularization og identificere funktionen af denne almindelige form for angiogenese i HBs. Disse protokoller kan bruges til at evaluere den mest lovende anti-vaskulære terapi for tumorer, som har høj translationel potentiale for tumorer behandling eller til medvirken i optimering af den anti-angiogene behandling for HBs fremover oversættelser. Resultaterne fremhæve kompleksiteten af HB neovascularization og foreslå, at denne fælles form angiogenese er kun en supplerende mekanisme i HB neovascularization.

Introduction

Hemangioblastomas (HBs) er godartede vaskulære tumorer, der findes udelukkende i menneskers centralnervesystemet (CNS). De udvikler hos patienter med enten von Hippel-Lindau (VHL) sygdom eller sporadisk læsioner. VHL-HBs er vanskelige at helbrede gennem kirurgisk behandling på grund af den hyppige gentagelse og flere læsioner, der skyldes denne genetiske lidelse1. Selv om inaktivering af VHL tumor suppressor genet har været betragtet som den egentlige årsag til tumordannelse af VHL-HBs, fortsat cytologiske oprindelse (herunder neovascularization) og evolutionær proces af HBs i høj grad kontroversiel2. Derfor, en bedre forståelse af HB-neovaskulær biologiske mekanismer kan give nyttig indsigt i de mest lovende anti-vaskulære strategier for VHL-HBs.

Nyere forskning har antydet, at HB-neovascularization er magen til embryologic vasculogenesis3,4,5. Klassiske vaskulær endotel vækstfaktor (VEGF)-medieret angiogenese, stammede fra det vaskulære endotel og der er drevet af VHL tab af funktion resulterede i spredning og neovaskulær dannelse, som er blevet udfordret6. I 1965, Cancilla og Zimmerman fundet, ved hjælp af elektronmikroskopi, der HBs stammer fra endotel7. Senere konstateredes det, at stromale celler er afledt af vasoformative element8. I 1982 fandt Jurco et al. , stromale celler i endothelial oprindelse9. Derfor, vi hypotese at vaskulære endotel menneskeceller er de oprindelige celler af HB-neovascularization10. Selv om det er bedre at bruge de primære kulturer fra HB celler, der stammer fra VHL patient operationer, viste vores tidligere forskning, at primære kulturer fra HB er ikke stabile og cellelinjer kunne ikke blive etableret3. Desuden, de primære kulturer i 3D-miljø kunne ikke identificere HB-neovascularization cytologiske oprindelse, fordi de omfatter stamfaderen til HB-kar ingredienser10,11. Derfor, som en primitiv og klassiske model i endothelial celler, kunne humane vascular endothelial celler (HUVEC) tjene som en alternativ cellulære model for HBs.

Klumpformet spirende assay er en ny model i tissue engineering12,13. I dette papir, en 3D kollagen-baserede coculture system in vitro- ved hjælp af den sfæroide, spiring assay blev udviklet, med et overordnet mål at vurdere, om klassiske tumor angiogenese findes i HBs, såvel som dens rolle i HBs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Denne metode blev udført i overensstemmelse med godkendte retningslinjer og forordninger om den forskning etiske udvalg af Huashan Hospital, Fudan University. Tilsvarende standard sikkerhedsforanstaltninger blev fulgt i hvert trin. Se figur 1for en skematisk præsentation.

1. celle kultur og Plasmid konstruktion

  1. Rutinemæssigt opretholde den menneskelige umbilical vene endotel celle (HUVEC) i Dulbecco ændrede Eagle's medium (DMEM) suppleret med 10% føtal bovint serum (FBS), 100 enhed/mL af penicillin og 100 µg/mL af streptomycin i en fugtig 5% CO2 inkubator ved 37 ° C.
  2. Fordøje PLKO.1 plasmid med ApaI og EcoRI for syntese af shRNA fragment. Sikre, at oligonukleotid sekvensen af VHL shRNA vektor CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14.
  3. Derefter blandes 20 µΜ system med fremad 5 µL af oligo, 5 µL af reverse oligo, 5 µL af 10 x NEB buffer og 35 µL af Hedeselskabet2O sammen (det samlede volumen er 50 µL). Opvarm blandingen på 98 ° C i 4 min, og langsomt køle ned til stuetemperatur i et par timer.
  4. Ligate udglødet oligos og PLKO.1 plasmid sammen med T4 ligase ved 4 ° C for natten. 16 h senere, tilsæt 5 µL af ligatur mix i 25 µL kompetente DH5α celler. Derefter skærmen med held sammenskrevne plasmider, og kontrollere den indsatte fragment af sekventering.

2. lentivirus pakke og infektion

  1. I alt, Bland 10 µg af vektoren, der PLKO.1-shVHL eller PLKO.1-shScramble, 7,5 µg pakning plasmidet psPAX2 og 2,5 µg af kuvert plasmidet pMD2.G i 500 µL af DMEM media uden føtal bovint serum (FBS) i 25 min.
  2. Tilføje 7 mLDMEM uden FBS til en opløsning fremstillet ovenfor.
  3. Kultur 293FT celler i DMEM uden FBS i en 10-cm diameter vævskultur retter. Sikre, at antallet af celler, 293FT 1 x 107 ved hjælp af en celle counter.
  4. Der tilsættes 1 mL af opløsning fremstillet ovenfor til medium af 293FT celler for Transfektion.
    Bemærk: 293FT cellelinie er afledt af 293F cellelinje og express stabilt SV40 store T antigen. Derfor er det en passende vært for lentiviral produktion.
  5. Erstatte næringssubstratet med den DMEM, som indeholder 10% FBS efter 6 h.
  6. Indsamle medierne ved hjælp af en pipette på 48 timer efter Transfektion.
    Bemærk: Virus findes i den DMEM, som indeholder 10% FBS. De døde celler flyde på mediet. Bruge 0,45 µm sterile membran til at filtrere de døde celler og urenheder. Generelt, er der ingen grund til at tjekke mangfoldighed af infektion (MOI). Dette er for at etablere en stabil celler linje. På det sidste trin, vil alle levende celler uden vellykket infektion dø af puromycin. Den shScramble gruppe og HUVEC celler er kontrolgruppen. Sikre, at alle HUVEC cellerne dør med brugte puromycin koncentration af 72 h. Hver brønd har det samme antal celler.
  7. Kultur HUVEC celler i de lentiviral medier i 72 timer. Tilføj derefter puromycin til medierne af HUVEC cellerne i en koncentration på 2 µg/mL for 24 h. Brug HUVEC celler uden nogen form for behandling som kontrolgruppen. Sikre, at alle styre celler dør ved denne tid.
    Bemærk: Levende celler udgør en stabil cellelinie af VHL knockdown celler og shSramble celler. Plating tæthed er 5.000/brønd i 96-brønd plader.

3. generation i Endothelial celle Spheroids

  1. Trypsinize HUVECs celler og resuspend på DMEM medium med 10% FBS. Med et moderat antal celler i et 10-cm kultur parabol, der tilsættes 1 mL af typsin-EDTA.
  2. Seed celler i en 3D runde-96-brønd bundplade, med en celle tæthed på 1 × 103 celler/brønd. Bruge en brønd, der kan rumme en klumpformet af 0,50 µL til at suspendere sfæroide. Tælle celler ved hjælp af en celle counter system efter fabrikantens anvisninger.
  3. Inkuber cellerne ved 37 ° C og 5% CO2 konstant i 72 timer. Disse betingelser sikre, at de suspenderede celler danner celle spheroids automatisk. Erstat halvdelen af substratet efter 36 timer.

4. in vitro angiogenese Assay

  1. Tø gelopløsning ved 4 ° C og fortynd det med nedsat serum medium ved et fortyndingsforhold på 1:5.
  2. Sutte spheroids fra DMEM næringssubstratet med en mikropipette. Efter vask spheroids med 5 mL af den reducerede serum medium, suspendere spheroids blidt og forsigtigt i den fortyndede gel. Sikre, at der er ingen luftbobler.
  3. Integrere 300 µL af blandet væske i en 15-godt plade. Efter inkubation ved 37 ° C og 5% CO2 for 1 h, tilføje 400 µL nedsat serum medium til hver brønd. Fylde sterile vand omkring wells til at generere en fugtig miljø for at hindre fordampning.
  4. Derefter kultur plade ved 37 ° C i 5% CO2 på 100% fugtighed for 1 h.
  5. Omhyggeligt Opsug den gamle medium og erstatte det med 600 µL af reducerede serum medium med 1% endotel celle vækst kosttilskud i hver brønd.
  6. Efter 12 timer eller 24 h, tage billeder under en inverteret lysmikroskop (40 *).

5. dataanalyse

  1. Upload billeder til en online billede analyse platform til at opnå spire længde data (Tabel af materialer).
  2. På websiden, skal du oprette en konto via e-mail.
  3. Derefter uploade billederne ved at klikke på knappen upload.
  4. Download resultatet ved at klikke på knappen Hent.
    Bemærk: Softwaren vil generere det forarbejdede billedet og data. Dataene indeholder fem dele: kumulativ spire længde, gennemsnitlige spire længde, standardafvigelsen af spire længde, spire område og klumpformet område. I forarbejdede billedet hver parameter er skitseret i en anden farve for at lette identifikation i forarbejdede billedet: rød repræsenterer spirer skelet, gul antallet af spirer, blå spire struktur, hvide spire end og orange klumpformet.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Originale billeder er taget af inverteret lysmikroskop. De typiske billeder af kontrol og VHL-gruppen er vist i figur 2-A1 og figur 2-A2. Den spirende længde af kontrolgruppen er kortere end den VHL gruppe.

Efter at uploade billeder, giver online platform analyseresultater direkte. Output består af to dele: det forarbejdede billedet og de tilhørende analyseresultater. De behandlede billeder af VHL genet stilhed gruppen og kontrolgruppen er markeret med forskellige farver (figur 2-A3 og figur 2-A4). Den gennemsnitlige spire længde er 65 µm og 125 µm i kontrolgruppen og gruppen VHL stilhed henholdsvis, og gennemsnitlige kumulative spire længde er 680 µm og 1250 µm i kontrolgruppen og gruppen VHL stilhed henholdsvis, der angiver, at spire længde øges med cirka to folder i gruppen VHL stilhed, sammenlignet med kontrolgruppen (figur 2B). Disse resultater viser, at VHL mangel fremmer fartøjets-dannende evnen i endothelial menneskeceller.

Figure 1
Figur 1 . Skemaet for den sfæroide spiring assay. Trin 1 viser HUVEC celler dyrkes en parabol. I trin 2 flyttes HUVEC celler til 3D runde-bunden 96-brønd plader til 72 h. trin 3 viser HUVEC celler form endotel celle spheroids automatisk i 3D plade. I trin 4, skal du tilføje celle klumpformet til fortyndede gel. I trin 5, tilsæt blandingen tilberedt over til en 15-godt plade. Trin 6 viser klumpformet spiring i 15-godt plade. Trin 7 viser, den spirende billede taget under en inverteret lysmikroskop. Trin 8 viser den uploadede billede og trin 9 er udskriftsbillede fra platformen (bar = 100 µm). Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 . Effekten af VHL genhæmning angiogene evne af HUVEC celler i klumpformet spiring assay. (A) repræsentative billeder af tuden udvækst efter 12 h i kontrol (A1) og VHL-tavshed HUVEC spheroids (A2) (bar = 100 µm). Tal A3 og A4 vise billederne analyseret af platformen for tal A1 og A2, henholdsvis. Rød repræsenterer spirer skelet, gul antallet af spirer, blå spire struktur, hvide spire end og orange klumpformet. (B) længde af spirer. Statistiske analyser blev udført ved hjælp af uparret Student's t-test. * repræsenterer P < 0,05. CON, kontrol; HUVEC, menneskelige umbilical vene endotel celle. Venligst klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

For nylig, flere felter af vaskulære biologi forskning blev stimuleret af studiet af angiogene endotelet15. I denne artikel, vi udviklet en endotel klumpformet spiring teknik som en eksperimentel model til at studere fartoej formation, som stammer fra VHL-genet tab af funktion i manipulerede endotelceller at identificere nye kandidat molekyler af den angiogene cascade. Til bedste af vores viden er dette den første betænkning at undersøge angiogene virkninger af endogen modificerede endotelceller.

Væv (herunder tumor væv) neovascularization er en kompleks proces, der opstår via angiogene og vasculogenic mekanismer under udvikling, samt i både fysiologiske og patologiske betingelser12,15 , 16. den sfæroide spiring assay er karakteriseret ved en kompleks kaskade af begivenheder17,18, herunder selvstændig sammenlægningen i endothelial celler, der er indlejret i en 3D celle matrix kultur system, hvilket resulterer i spiring og reproduktion af den 3D netværk af kapillærer19. Denne 3D gel-embedded klumpformet model er blevet et udbredt system i vævsmanipulering for at studere den vaskulære dannelse og dens mekanismer på grund af dens evne til at yde en bedre efterligner miljø i en egnet matrix. Men det mest afgørende skridt i denne biologiske proces er aktivering af inaktiv endotelceller17,20,21,22. I denne procedure, blev i endothelial celler aktiveret af endogen hæmning af VHL genet, en regulator vækst gen neovessels23,24. Forskellig fra den klassiske endotel indledning via eksogene induktion af matricen og den tilsvarende ekstracellulære miljø (herunder eksogene vaskulære vækstfaktorer), denne ændrede metode kan udvides til mange programmer til at optrævle endogen genetiske mekanismer. Næste, for at mindske virkningerne af de eksogene matrix, protokollen blev optimeret ved at fortynde gel, som var en simpel skridt i eksperimentet. Derudover tog det kun minutter at uploade billeder til platformen og opnå analyseresultater. Platformen giver en analyse service at tillader eksperimentatoren at gøre en objektive, sammenlignelige og automatiseret billedanalyse af spiring assay billeder online. Protokollen overvinder derfor, måling og beregning fejl skyldes menneskeskabte faktorer.

Den mekanistiske forståelse af de enkelte trin af neovascularization kaskade forudsat et rationelt grundlag for udviklingen af den anti-vaskulære behandling, der er i øjeblikket at blive godkendt til kliniske anvendelse i onkologi. Dette papir etableret en enkel og robust klumpformet-baseret analyse model for at studere fartoej formation, som stammer fra manipulerede endotelceller med tab af funktion af VHL -genet til at identificere nye kandidat molekyler til neovascularization kaskade, som kan udnyttes til talrige angiogenese - og vasculogenesis-relaterede applikationer. Forfatterne spekulerer, at denne i vitro model kan give yderligere oplysninger for at hjælpe med at vurdere rollen af angiogenese i nogle solide tumorer (fx tumor vasculogenic mimicry) og undersøge de potentielle roller af andre mulige stamceller at generere tumor neovessels i vivo, især hos patienter med tumorer, der som en gruppe, der ikke reagerer på behandling med anti-angiogene agenter kun.

Klumpformet spirende assay er blevet en meget anvendt metode til at studere angiogenese og relaterede mekanismer. Analysen har en vigtig fordel ved at tilvejebringe en bedre efterligne miljø end de klassiske 2D kulturer. For nylig, 3D Co kultur modeller er blevet udviklet for at studere tumor angiogenese, der efterligner den heterogenitet og kompleksiteten af angiogenese inden for tumor mikromiljø25. I denne model, er endotelceller kulturperler direkte med kræftceller, samt en stromale komponent i et 3D-miljø. Derudover har 3D i vitro kultur systemer vist sig at afspejle mere præcist i vivo svar til terapeutiske agenter end konventionel celle kultur systemer. Desuden, bruges denne metode til differentiering af embryonale stamceller, væv vækst, sårheling, iskæmi og betændelse. Sammenlignet med den klassiske metode, er vores tilgang effektiv og let at gennemføre. Vi mener det er et nyttigt værktøj til studiet af angiogenese in vitro-, og det åbner en ny måde at forstå denne proces bedre.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Dette arbejde blev støttet af tilskud fra Shanghai Udvalget for videnskab og teknologi (15411951800, 15410723200). Forfatterne vil gerne takke Prof. YuMei Wen og Prof. Chao Zhao af patogene mikroorganisme afdeling af Fudan universitetet for deres tekniske bistand.

Materials

Name Company Catalog Number Comments
human umbilical vein endothelial cell Fudan IBS Cell Center FDCC-HXN180
dulbecco’s modified eagle’s medium  Gibco 11995040
fetal bovine serum Gibco  26400044
PLKO.1-puro vector Addgene #8453
packing plasmid psPAX2  Addgene #12260
envelope plasmid pMD2.G Addgene #12259
3D round-bottom 96-well plates S-Bio MS-9096M
matrigel BD Biosciences 354234
Opti-MEM medium Gibco 31985-070 reduced serum medium 
15-well plate Ibidi 81501 Air bubbles in the gel can be reduced by equilibrating the μ–Slide angiogenesis before usage inside the incubator overnight
endothelial cell growth supplements Sciencell #1052
10-cm culture dish Corning Scipu000813
Puromycin Gibco A1113802
typsin-EDTA Gibco 25200056
Automated Cell Counter System   BioTech
Image Analysis software  Winmasis http://mywim.wimasis.com 

DOWNLOAD MATERIALS LIST

References

  1. Lonser, R. R., et al. von Hippel-Lindau disease. Lancet. 361, (9374), 2059-2067 (2003).
  2. Hussein, M. R. Central nervous system capillary haemangioblastoma: the pathologist's viewpoint. Int J Exp Pathol. 88, (5), 311-324 (2007).
  3. Ma, D., et al. Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche. Carcinogenesis. 32, (1), 102-109 (2011).
  4. Zhuang, Z., et al. Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors. Sci Rep. 4, 4102 (2014).
  5. Glasker, S., et al. VHL-deficient vasculogenesis in hemangioblastoma. Exp Mol Pathol. 96, (2), 162-167 (2014).
  6. Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas. Cancer Res. 55, (6), 1358-1364 (1995).
  7. Cancilla, P. A., Zimmerman, H. M. The fine structure of a cerebellar hemangioblastoma. J Neuropathol Exp Neurol. 24, (4), 621-628 (1965).
  8. Kawamura, J., Garcia, J. H., Kamijyo, Y. Cerebellar hemangioblastoma: histogenesis of stroma cells. Cancer. 31, (6), 1528-1540 (1973).
  9. Jurco, S., et al. Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry. Hum Pathol. 13, (1), 13-18 (1982).
  10. Ma, D., et al. Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas. Cancer Biol Ther. 12, (8), 727-736 (2011).
  11. Ma, D., et al. CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma. Tumour Biol. 37, (3), 3765-3774 (2016).
  12. Sharifpanah, F., Sauer, H. Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis. Methods Mol Biol. 1430, 179-189 (2016).
  13. Cai, H., et al. Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma. Oncogene. 36, (3), 318-331 (2017).
  14. Xu, J., et al. Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP. Appl Biochem Biotechnol. 181, (2), 699-709 (2017).
  15. Laib, A. M., et al. Spheroid-based human endothelial cell microvessel formation in vivo. Nat Protoc. 4, (8), 1202-1215 (2009).
  16. D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. Angiogenesis and Vasculogenesis in Health and Disease. Biomed Res Int. 2015, 126582 (2015).
  17. Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model. Cell Prolif. 42, (4), 498-505 (2009).
  18. Morin, K. T., Tranquillo, R. T. In vitro models of angiogenesis and vasculogenesis in fibrin gel. Exp Cell Res. 319, (16), 2409-2417 (2013).
  19. Blacher, S., et al. Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour. PLoS One. 9, (5), 97019 (2014).
  20. Straume, O., et al. Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer. Proc Natl Acad Sci U S A. 109, (22), 8699-8704 (2012).
  21. Naumov, G. N., Akslen, L. A., Folkman, J. Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch. Cell Cycle. 5, (16), 1779-1787 (2006).
  22. Naumov, G. N., Folkman, J., Straume, O. Tumor dormancy due to failure of angiogenesis: role of the microenvironment. Clin Exp Metastasis. 26, (1), 51-60 (2009).
  23. Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice. Mol Carcinog. 56, (10), 2342-2351 (2017).
  24. Stratmann, R., Krieg, M., Haas, R., Plate, K. H. Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene. J Neuropathol Exp Neurol. 56, (11), 1242-1252 (1997).
  25. Correa de Sampaio, P., et al. A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis. PLoS One. 7, (2), 30753 (2012).
En omfattende Procedure at evaluere <em>In Vitro</em> ydeevne af den formodede Hemangioblastoma Neovascularization ved hjælp af den sfæroide, spiring Assay
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).More

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter