Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Promotor Capture Hi-C: High-resolution, genoom-brede profilering van promotor interacties

doi: 10.3791/57320 Published: June 28, 2018
* These authors contributed equally

Summary

DNA regelgevende elementen, zoals versterkers, kwaliteitsbeheersing genexpressie door fysiek contact met target gene initiatiefnemers, vaak door middel van lange-afstands chromosomale interacties verspreid over grote genomic afstanden. Promotor vangen Hi-C (PCHi-C) identificeert belangrijke interacties tussen initiatiefnemers en distale regio's, waardoor de toewijzing van potentiële regulerende sequenties aan hun doelgenen.

Abstract

De driedimensionale organisatie van het genoom is gekoppeld aan de functie. Bijvoorbeeld, controle regelgevende elementen zoals de versterkers van de transcriptionele de spatio-temporele uitdrukking van hun doelgenen door middel van fysiek contact, vaak aanzienlijke (in sommige gevallen honderden van kilobases) genomic afstanden te overbruggen en omzeilen nabijgelegen genen. Het menselijk genoom herbergt een geschatte één miljoen enhancers, waarvan de overgrote meerderheid hebben onbekende gene doelen. Distale regelgevende gebieden toe te wijzen aan hun doelgenen is dus van cruciaal belang te begrijpen gen expressie controle. We ontwikkeld promotor vangen Hi-C (PCHi-C) de genoom-brede detectie van distale promotor-interactie regio's (PIRs), inschakelen voor alle initiatiefnemers in een enkele experiment. In PCHi-C, zijn zeer complexe Hi-C bibliotheken speciaal verrijkt voor promotor sequenties via in-oplossing hybride selectie met duizenden biotinyleerd RNA lokaas complementair aan de uiteinden van alle promotor-bevattende beperkingsfragmenten. Het doel is om vervolgens pull-down promotor sequenties en hun frequente interactie partners zoals smaakversterkers en andere potentiële regelgevende elementen. Na hoge gegevensdoorvoer gekoppeld-einde sequencing, wordt een statistische toets toegepast op elke promotor-afgebonden beperking fragment te identificeren aanzienlijk PIRs op het beperkingsniveau fragment. PCHi-C hebben we gebruikt voor het genereren van een atlas van lange-afstands promotor interacties in tientallen mens en muis celtypes. Deze promotor interactome kaarten hebben bijgedragen tot een beter begrip van bij zoogdiercellen expressie controle door het toewijzen van vermeende regelgevende gebieden aan hun doelgenen en onthullend preferentiële ruimtelijke promotor-promotor interactienetwerken. Deze informatie is ook groot belang aan het begrip van genetische ziekten bij de mens en de identificatie van potentiële ziekte genen, door het koppelen van niet-coderende ziekte-geassocieerde volgorde van varianten in of nabij besturingsprocessen aan hun doelgenen.

Introduction

Vergaren van bewijs suggereert dat de driedimensionale organisatie van het genoom een belangrijke functionele rol in een bereik van nucleaire processen speelt, waaronder gene activering1,2,3, repressie4 ,5,,6,,7,8, recombinatie9,10, DNA reparatie11, DNA replicatie12,13, en cellulaire senescentie14. De versterkers van de verre zijn te vinden in de ruimtelijke nabijheid aan de initiatiefnemers dat zij regelen15,16,17, die is essentieel voor goede spatio-temporele gen expressie controle. Versterker verwijderingen Toon dat de versterkers van de distale essentieel voor doel gene transcriptie18,19,20,21,22, en 'gedwongen chromatine looping zijn' toont aan dat gemanipuleerde tethering tussen een versterker en haar doel promotor in de Hbb locus is voldoende om te rijden transcriptionele activering23. Verder, genoom herschikkingen die genen te onder de controle van ectopische versterkers brengen kunnen leiden tot ongepaste gene activering en ziekte24,25,26. Samen, illustreren deze voorbeelden dat de promotor-enhancer interacties essentieel voor gene controle zijn en strakke regelgeving om passende genexpressie vereisen. De mens en muis genomen zijn elk geschat op haven rond één miljoen versterkers. Voor de overgrote meerderheid van deze versterkers, doelgenen zijn onbekend, en de "rules of engagement" tussen initiatiefnemers en versterkers zijn slecht begrepen. De versterkers van de transcriptionele toewijzen aan hun doelgenen blijft dus een grote uitdaging in het ontcijferen van bij zoogdiercellen expressie controle.

Ons begrip van drie-dimensionale genoom het platform heeft een revolutie teweeggebracht door de invoering van 3C27 (chromosoom conformatie vangen) en haar varianten28,29,30,31 . De meest machtige van deze technieken, Hi-C (hoge doorvoer chromosoom conformatie vangen) is ontworpen om te identificeren van het hele ensemble van chromosomale interacties binnen een celpopulatie. Hi-C bibliotheken, meestal gegenereerd op basis van miljoenen cellen, zijn zeer complex met een geschatte 1011 onafhankelijke afbinding producten tussen ~ 4 kb fragmenten in het menselijk genoom32. Als een gevolg, betrouwbare en reproduceerbare identificatie van interacties tussen individuele beperking (zoals die met een promotor of versterker fragmenten) van is Hi-C gegevens niet haalbaar, tenzij Hi-C bibliotheken zijn onderworpen aan de ultra-diep sequencing, die is niet een economisch levensvatbare oplossing voor laboratoria routinematig voorbereiding van Hi-C bibliotheken. Om te omzeilen deze tekortkoming, ontwikkelden we promotor vangen Hi-C om specifiek verrijken promotor-bevattende afbinding producten van Hi-C bibliotheken. We gericht op de initiatiefnemers om twee redenen. Eerst, promotor-enhancer contacten is gebleken dat cruciaal is voor goede gen expressie niveaus in tal van studies (Zie de verwijzingen hierboven), en anderzijds als initiatiefnemers grotendeels invariant tussen celtypes zijn, hetzelfde vangen aas systeem kan worden gebruikt om te ondervragen de regelgevende circuits op meerdere celtypen en voorwaarden. Onze aanpak is gebaseerd op-oplossing kruising van Hi-C bibliotheken met tienduizenden biotinyleerd RNA 120mers complementair aan promotor-bevattende Hi-C afbinding producten en latere vangen op daar beklede magnetische kralen. Dit resulteert in PCHi-C bibliotheken met verminderd veel complexiteit in vergelijking met de originele Hi-C-bibliotheek, alleen op de identificatie van fragmenten die aan initiatiefnemers bij aanzienlijk hoge frequenties als ligatuur zijn verbonden.

We hebben gebruikt PCHi-C in een aantal menselijke en muis celtypes om bij te dragen tot een beter begrip van gen expressie controle door blootleggen lange-afstands distale promotor interagerende regio's met vermeende regulerende functie, evenals niet-random promotor-promotor contacten in de driedimensionale ruimte van de kern. De studies van honderdduizenden promotor-enhancer contactpersonen hebt toegewezen over talrijke cel typen33,34,35,,36,,37,38, 39, ruimtelijke genoom Polycomb repressieve complexe-gemedieerde organisatie van muis embryonale stamcellen7geïdentificeerd, aangetoond grootschalige herbedradingsproces van promotor interactomes tijdens celdifferentiatie37, 38 , 39en gekoppelde niet-coderende ziekte-geassocieerde volgnummer varianten aan gene initiatiefnemers35.

PCHi-C is een ideaal methode om de kaart van het genoom-brede ensemble van DNA-sequenties interactie met initiatiefnemers. De methode van keuze te verkrijgen met een hoge resolutie interactie profielen voor geselecteerde regio genomic's zijn verwante benaderingen, zoals Capture Hi-C van continue genomic regio's (Zie discussie). PCHi- en Hi-C vangen zijn zeer vergelijkbaar vanuit een experimentele oogpunt (het enige verschil is de keuze van de opname systeem), zodat de adviezen en richtsnoeren die wij leveren zijn van toepassing op beide benaderingen. Hier presenteren we een gedetailleerde beschrijving van PCHi-C. Wij schetsen de grondgedachte en het ontwerp van een PCHi-C-experiment, bieden een stapsgewijze PCHi-C bibliotheek generatie protocol en illustreren hoe de kwaliteit van de PCHi-C-bibliotheken op verschillende stappen in het protocol bij het opleveren van hoogwaardige gegevens kan worden gecontroleerd.

Protocol

1. formaldehyde fixatie

  1. Cel voorbereiding: Start met een minimum van 2 x 107 cellen per experiment.
    1. Resuspendeer de cellen in een kweekvloeistof voor cellen gekweekt in cultuur. Resuspendeer voor ex vivo cellen, in 1 x Dulbecco van bewerkt Eagle Medium (DMEM), aangevuld met 10% (vol/vol) foetale runderserum (FBS).
    2. Voor Adherente cellen verwijderen kweekmedium en Voeg 30.625 mL verse medium met 10% (vol/vol) FBS bij kamertemperatuur (RT; 20 – 25 ° C).
    3. Voor schorsing cellen, verzamelen en centrifugeer cellen bij 400 x g en 20 ° C gedurende 3 min. verwijderen supernatant en resuspendeer de pellet cel in 30.625 mL medium met 10% (vol/vol) FBS op RT.
    4. Gebruik voor stevige weefsels, trypsine (0.05% tot 2,5% eindconcentratie, afhankelijk van het celtype) of dounce om te verkrijgen van een enkele celsuspensie homogenisatie. Na deze stap extra cellen net als Luchtvering cellen te behandelen.
  2. Voeg 4.375 mL 16% methanol-vrije paraformaldehyde (open ampul net vóór gebruik) tot een uiteindelijke concentratie van 2% (vol/vol). Fix voor 10 min op RT met zacht mengen op een rocker.
    Let op: Paraformaldehyde is een gevaarlijke chemische stof. Volg de verordeningen op het gebied van gezondheid en veiligheid.
  3. Reactie door toevoeging van 5 mL vers bereide 1 M ijskoude glycine doven. Meng gedurende 5 min met zachte rockende op RT, en vervolgens uit te broeden op het ijs gedurende 15 minuten met af en toe omkeren.
  4. Wassen en vaste cellen te verzamelen.
    1. Voor Adherente cellen, bovendrijvende vloeistof verwijderen, toevoegen van 10 mL ijskoud 1 x PBS pH 7.4 op de plaat muur en verwijder deze. Voeg 1 mL ijskoud 1 x PBS pH 7.4, verzamelen van cellen met behulp van een cel schraper en overdracht in een tube van 50 mL. Herhaal dit twee keer om te verzamelen net zoveel cellen als mogelijk. Ijskoude PBS optellen tot 50 mL eindvolume.
    2. Voor schorsing cellen, centrifuge cellen op 760 x g en 4 ° C gedurende 5 minuten, verwijder supernatant en resuspendeer de pellet cel in 50 mL ijskoud PBS pH 7.4.
  5. Centrifugeer cellen bij 400 x g - en 4 ° C gedurende 10 minuten en verwijder voorzichtig de bovendrijvende substantie. De cel pellet kunnen module in vloeibare stikstof bevroren en vervolgens opgeslagen bij-80 ° C voor enkele maanden.

2. de cellysis

  1. Resuspendeer cel pellet in 50 mL vers bereide ijskoude lysisbuffermengsel (10 mM Tris-HCl pH 8, 0,2% (vol/vol) Igepal CA-630, 10 mM NaCl, en een tablet proteaseinhibitor cocktail) en meng. Incubeer op ijs voor 30 min, meng af en toe door het omkeren. Centrifugeer de kernen op 760 x g - en 4 ° C gedurende 5 minuten en verwijder de bovendrijvende vloeistof.

3. hinterugmatch spijsvertering

  1. Wassen celkernen met 1.25 x beperking buffer 2. Resuspendeer cel pellet in 1 mL ijskoud 1.25 x beperking buffer 2 en overdracht in een 1,5 mL-buis. Draai de kernen op 760 x g- en 4 ° C gedurende 5 minuten en bovendrijvende vloeistof verwijderen.
  2. Resuspendeer de pellet cel in 1790 µL van 1.25 x beperking buffer 2. Maak 5 aliquots, elk met 5-10 miljoen cellen in 358 µL van 1,25 x beperking buffer 2.
  3. Voeg 11 µL van 10 procent (wt/vol) SDS aliquot hermetisch en schud 950 omwentelingen per min (rpm) gedurende 30 minuten bij 37 ° C in een thermomixer. Als cel bosjes verschijnen, distantiëren door pipetteren, vermijden van bubbels.
  4. Voeg 75 µL van 10% Triton X-100 (vol/vol) per aliquot hermetisch en schud bij 950 rpm en 37 ° C gedurende 15 min. in een thermomixer. Als cel bosjes verschijnen, distantiëren door pipetteren, vermijden van bubbels.
  5. Voeg 12 µL van 100 U/µL Hinterugmatch 100 (1.200 eenheden in totaal) per hoeveelheid en Incubeer bij 37 ° C's nachts (O/N) tijdens het schudden bij 950 rpm in een thermomixer.
    1. Breng 25 µL van monster (5 µL van elk aliquot) in een nieuwe buis alvorens toe te voegen het enzym (onverteerd control) voor het besturingselement van de spijsvertering, en herhaal dezelfde procedure na toevoeging van het enzym (verteerd control). Incubeer beide buizen op dezelfde wijze als de Hi-C bibliotheek.
  6. Voeg 5 µL van 100 U/µL Hinterugmatch (500 stuks in totaal) per hoeveelheid oplossing op de volgende ochtend en Incubeer bij 37 ° C gedurende 2 uur terwijl het schudden bij 950 rpm in een thermomixer.
  7. Controle van de spijsvertering: voor het verteerd en onverteerd besturingselementen (zie 3.5.1), uitvoeren van dwarslijn omkering (stap 6), fenol: Chloroform extractie en DNA neerslag (stap 7).
    1. Een paar inleidingen die zich uitstrekken over een Hinterugmatch site ontwerpen. In dezelfde regio, door een ander paar inleidingen die niet beslaan een Hinterugmatch site te ontwerpen. Inleidingen voor kwantitatieve PCR (Q-PCR) ontwerpen met behulp van Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/) en de volgende parameters:
      Primer grootte: optimale 20 (Min.: 18, Max.: 27); Primer Tm: Optimale 60 (Min.: 57, Max.: 63); Primer CG % inhoud: Min.: 20, Max.: 80; Amplicon grootte: RT-PCR ~ 100 bp (voor conventionele PCR ~ 300 bp); Mispriming bibliotheek: mens (mens inleidingen) of knaagdier en eenvoudig (muis inleidingen).
    2. Uitvoeren van Q-PCR te verkrijgen 4 gemiddelde Cts (drempel cyclus): Ct [D; H], verkregen uit het verteerd monster [D] met de paar inleidingen die zich uitstrekken over een Hinterugmatch site [H]; CT [D;-], verkregen uit het verteerd monster [D] met de paar inleidingen die niet beslaan een Hinterugmatch site [-]; CT [U; H], verkregen uit de onverteerd monster [U] met de paar inleidingen die zich uitstrekken over een Hinterugmatch site; CT [U;-], verkregen uit de onverteerd monster [U] met de paar inleidingen die niet beslaan een Hinterugmatch site [-]. Bereken het percentage van de spijsvertering als: % spijsvertering = 100-100/2(Ct[D,H]-Ct[D,-]) - (Ct[U,H]-Ct[U,-]).

4. Biotinylation van beperking Fragment overhangen

  1. Bereiden van biotinylation master mix: 30.6 µL van 10 x beperking buffer 2, 10.2 µL van H2O (moleculaire biologie grade), 7.65 µL van 10 mM dCTP 7,65 µL van 10 mM dGTP, 7.65 µL van 10 mM-dTTP, 191.25 µL van 0,4 mM Biotine-14-dATP en 51 µL van 5.000 U/mL van DNA Taq ik grote () Fragment van de Klenow).
  2. Voeg 60 µL van biotinylation master mix per aliquoot, mix, en Incubeer bij 37 ° C gedurende 1 uur schudden bij 700 rpm (thermomixer) voor 5 s, elke 30 s. Na 1 h, plaats u aliquots op ijs.

5. in-nucleus afbinding

  1. Bereiden van afbinding master mix: 510 µL van 10 x T4 DNA ligase buffer, 51 µL van 10 mg/mL bovien serumalbumine (100 x BSA), 1754.4 µL van water (de rang van de moleculaire biologie) en 127,5 µL van 1 U/µL T4 DNA ligase (Zie Tabel van materialen).
  2. Voeg 479 µL van afbinding master mix per aliquoot mix en Incubeer bij 16 ° C gedurende 4 uur schudden bij 700 rpm voor 5 s iedere 2 minuten in een thermomixer.
  3. Incubeer 30 min op RT.

6. dwarslijn omkering

  1. Combineer alle aliquots in een centrifugebuis 50 mL (geschikt voor snelle centrifugeren).
  2. Voeg 62,5 µL van 10 mg/mL RNase A, mix, en incubeer gedurende 30 minuten bij 37 ° C.
  3. Voeg 300 µL van 10 mg/mL proteïnase K, mix, en incubeer gedurende 30 minuten bij 37 ° C.
  4. Incubeer reactie O/N (of ten minste 4 uur) bij 65 ° C. Voeg 300 µL van 10 mg/mL proteïnase K, mix, op de volgende ochtend en incubeer gedurende 1 uur bij 65 ° C.

7. DNA zuivering

  1. Voeg 4337.5 µL TLE buffer (10 mM Tris-HCl pH 8.0; 0.1 mM EDTA pH 8,0) en meng.
  2. 1 volume (10 mL) fenol pH 8.0, vortex voor 10 s, en centrifuge op RT en 20.000 x g voor 3 min. Transfer 9 mL van de bovenste (waterfase) toevoegen om een nieuwe tube van 50 mL.
    Let op: Fenol is een gevaarlijke chemische stof. Volg de verordeningen op het gebied van gezondheid en veiligheid.
  3. Voeg toe 2 mL TLE buffer om de resterende waterfase, vortex want 10 s en centrifuge op RT en 20.000 x g voor 3 min. Breng 2,5 mL van de waterfase in de nieuwe buis uit stap 7.2, waardoor het eindvolume 11,5 mL. Gooi buis met de lagere (organische) fase.
  4. 1 deel (11,5 mL) van fenol: chloroform: Isoamylalcohol (25:24:1), vortex voor 10 s, en centrifuge op RT en 20.000 x g voor 3 min. Transfer 11 mL van de bovenste (waterfase) toevoegen om een nieuwe tube van 50 mL. Herhaal stap 7.3. Het totale monstervolume zullen nu 13,5 mL.
  5. Toevoegen van 1,35 mL 3 M natrium acetaat pH 5.2 en 33,75 mL ijskoud 100% ethanol, mix, en Incubeer bij-80 ° C voor 45 min, of als alternatief overnachting bij-20 ° C.
  6. Centrifugeer bij 4 ° C en 20.000 x g gedurende 10 minuten, verwijder de bovendrijvende vloeistof resuspendeer de pellet in 1 mL ethanol vers bereid met de (vol/vol) met 70% en overbrengen naar een nieuwe buis.
  7. Centrifugeer bij 4 ° C en op volle snelheid gedurende 3 minuten in een benchtop centrifuge en deze vervolgens verwijdert van de bovendrijvende substantie.
  8. Resuspendeer de pellet in 1 mL ijs koud 70% (vol/vol) ethanol en herhaalt u stap 7.7. Droog de pellet bij 37 ° C gedurende 10 minuten en resuspendeer in 650 µL van TLE buffer. De opbrengst van de DNA bepalen met behulp van een fluorescentie gebaseerde bepaling te kwantificeren double-stranded DNA.
    Opmerking: Het protocol kan hier onderbroken worden door breuk, invriezen en opslag van het monster bij-80 ° C gedurende enkele maanden of bij-20 ° C voor een kortere periode.

8. kwaliteitscontroles

  1. Monitor bibliotheek integriteit en Afbinding van DNA elektroforese. Run 200 ng van bibliotheek op een 0,8% agarose/1 x TBE gel. Het DNA moet worden uitgevoerd als een band meer dan 10 kb.
  2. Bekende celtype-invariant korte - en lange - afstand interacties door conventionele PCR worden gedetecteerd. Gebruik 100 ng van sjabloon DNA per PCR-reactie. Ontwerp de PCR inleidingen sluiten en naar de beperkingsplaatsen die volgens de instructies hierboven (zie 3.7.1). Primer sequenties voor kwaliteitscontrole van muis en mens Hi-C bibliotheken zijn vermeld in tabel 1.
  3. Invullen en Afbinding controle: de gel banden met de waarbij van uitgesneden beheersen 8.2, gel-extract DNA en DNA gebruiken als sjabloon voor 4 individuele PCR reacties met identieke primer combinaties.
    1. Zuiveren waarbij met behulp van een PCR zuivering kit en kwantificeren van de DNA-concentratie.
    2. Vier reacties van de spijsvertering (Hinterugmatch [a], NheI [b], Hinterugmatch + NheI [c] en geen enzym [d]) voorbereiden op elke amplicon in een eindvolume van 15 µL: 500 ng van amplicon, 1,5 µL van 10 x beperking buffer 2.1, 0,15 µL van 10 mg/mL bovien serumalbumine (100 x BSA) , en 0.1 µL (10 eenheden) van enzym (Hinterugmatch [a], NheI [b], Hinterugmatch + NheI [c] of water [d]).
    3. Verteren gedurende 1 uur bij 37 ° C, vervolgens stormloop spijsvertering reacties op een 1,5% (wt/vol) agarose/1 x TBE gel.

9. DNA fragmentatie

  1. Breng 50,5 µg voor sample in een nieuwe buis en TLE buffer toevoegen aan een eindvolume van 655 µL. Split monster in 5 ultrasoonapparaat flesjes (Zie Tabel van materialen) door 130 µL van bibliotheek (10 µg) aan elke flacon. Schuintrekken tot een grootte van ~ 400 bp in een ultra-ultrasoonapparaat (Zie Tabel van materialen) met de volgende parameters: plicht factor: 10%; piekvermogen incident (w): 140; cycli per burst: 200; tijd: 55 s.
  2. Sonicated monster in een vers 2 mL-buis verzameld.

10. ' double-sided SPRI-kraal maat keuze

  1. Mix SPRI (vaste fase omkeerbare immobilisatie) kraal oplossing goed door omkeren, 1.85 milliliters kraal oplossing overbrengen in een nieuwe buis en RT brengen gedurende 15 minuten.
  2. 350 µL van water (moleculaire biologie grade) Voeg aan het monster (eindvolume 1 mL).
  3. 600 µL van SPRI kraal oplossing Voeg aan het monster (total volume 1.6 mL; verhouding van SPRI oplossing aan DNA: 0,6 tot 1), Incubeer gedurende 5 min op RT en spin monster in een benchtop centrifuge voor 2 – 3 s tot monster verzameld.
  4. Open het deksel, plaats het monster op de stand van de magnetische scheiding voor 5 min, overdracht duidelijk supernatant in een nieuwe buis en negeren kralen.
  5. SPRI kralen voor de tweede grootte selectie stap concentreren: Transfer 930 µL van SPRI kralen in een nieuwe buis, plaats op de stand van de magnetische scheiding voor 5 min en negeren duidelijk bezinken. Resuspendeer de kralen in 310 µL van SPRI kraal oplossing.
  6. 300 µL van geconcentreerde SPRI parels (stap 10.5) Voeg aan het monster (total volume 1.9 mL; verhouding SPRI oplossing voor DNA is nu 0.9-1), Incubeer bij RT gedurende 5 min en spin proeven in een benchtop centrifuge voor 2 – 3 s. zorgvuldig open het deksel , plaatst u de buis op de magnetische scheiding staan voor 5 min en weggeworpen.
  7. Voeg 1 mL vers bereide 70% ethanol (vol/vol) tot het monsterbuisje op de stand van de magnetische scheiding, Incubeer gedurende 30 s, en negeren supernatant. Herhaal dit twee keer.
  8. Droge kralen bij 37 ° C in een thermomixer (buis deksel open) voor niet meer dan 5 min. Voeg 300 µL van TLE buffer aan het monster, meng en incubeer gedurende 10 minuten bij kamertemperatuur.
  9. Spin monster in een benchtop centrifuge voor 2 – 3 s, open het deksel en de buis op de magnetische scheiding staan voor 5 min. overdracht plaats duidelijk bovendrijvende substantie in een nieuwe buis en negeren kralen.

11. het biotine/daar Pull-down van afbinding producten

  1. Bereiden van buffers: 1 x TB buffer (5mM Tris-HCl pH 8,0 EDTA 0.5mM 1 M NaCl; 0,05% Tween 20); 2 x NTB buffer (10 mM Tris-HCl pH 8,0; 1 mM EDTA; 2 M NaCl); 1 x NTB buffer (EDTA 0.5 mM, 5 mM Tris-HCl pH 8.0; 1 M NaCl).
  2. Voeg 200 µL van magnetische streptavidine-coupled parels (Zie Tabel van materialen) in een nieuwe buis, plaats het op de magnetische scheiding staan voor 1 min en bovendrijvende vloeistof verwijderen.
  3. Wassen kralen tweemaal met 500 µL van 1 x TB buffer.
    1. Voor elke wassen stap tijdens de Biotine pull-down, einde reparatie en verwijdering van biotine aan niet-afgebonden DNA uiteinden, dATP tailing, en adapter afbinding stappen, resuspendeer de kralen in de overeenkomstige buffer, draaien op RT en 15 rpm voor 3 min, draai de buis in een centrifuge benchtop voor 2 – 3 s, plaatst u de buis op de stand van de magnetische scheiding voor 3 min en bovendrijvende vloeistof verwijderen.
  4. Resuspendeer kralen in 300 µL van 2 x NTB buffer. Meng kralen en monster (600 µL totale volume) en Incubeer bij RT gedurende 15 minuten op een draaiende wiel van 3 toeren per minuut.
  5. Terugvorderen van de kralen op de stand van de magnetische scheiding gedurende 3 minuten en verwijder het supernatant helder. Wassen kralen tweemaal in 500 µL van 1 x NTB buffer eerste en vervolgens in 200 µL van 1 x afbinding buffer. Resuspendeer de kralen in 50 µL van 10 x afbinding buffer.

12. Beëindig reparatie en verwijdering van biotine aan niet-afgebonden DNA uiteinden

  1. Combineren van het monster (50 µL in totaal) met 50 µL van 2.5 mM dNTP mix (12,5 µL van 10 mM van elke dNTP), 18.1 µL van 3.000 U/mL T4 Polymerase van DNA, 18.1 µL van 10.000 U/mL T4 PNK, 3.7 µL van 5.000 U/mL van DNA Taq fragment ik grote (Klenow) , en 360.1 µL van H2O.
  2. Meng en Incubeer bij 20 ° C gedurende 1 uur, schudden 5 s bij 700 rpm iedere 2 minuten in een thermomixer.
  3. Terugvorderen van de kralen op de stand van de magnetische scheiding, verwijderen van het supernatans dat duidelijk en wassen kralen tweemaal in 500 µL 1 x TB buffer.
  4. Wassen van kralen in 500 µL van 1 x NTB buffer, gevolgd door een wassen in 500 µL van 1 x TLE.
  5. Terugvorderen van de kralen op de stand van de magnetische scheiding, verwijderen van het duidelijke supernatant en resuspendeer kralen in 415 µL van 1 x TLE buffer.

13. dATP staart

  1. Monster (415 µL) combineren met 50 µL van 10 x beperking buffer 2, 5 µL van 10 mM dATP en 30 µL van 5 U/µL Klenow exo-minus.
  2. Meng en Incubeer bij 37 ° C gedurende 30 minuten, schudden 5 s bij 700 rpm iedere 2 minuten in een thermomixer.
  3. Terugvorderen van de kralen op de stand van de magnetische scheiding, verwijderen van het supernatans dat duidelijk en wassen kralen tweemaal in 500 µL 1 x TB buffer.
  4. Kralen in 500 µL van 1 x NTB buffer wassen.

14. adapter afbinding

  1. Wassen van kralen in 200 µL 1 x afbinding reactie buffer (Zie Tabel van materialen).
  2. Resuspendeer kralen in 200 µL van 1 x afbinding reactie buffer. Voeg 4 µL van DNA ligase (Zie Tabel van materialen) en 16 µL van 15 µM vooraf gegloeid PE adapters (vooraf het ontharden van de PE-adapters door het mengen van gelijke hoeveelheid PE adapter 1 en PE adapter 2 (zowel op 30 µM) en incubatie gedurende een paar minuten bij RT). Incubeer bij RT gedurende 15 minuten.
  3. Terugvorderen van de kralen op de stand van de magnetische scheiding, verwijderen van het supernatans dat duidelijk en wassen kralen tweemaal in 500 µL 1 x TB buffer.
  4. Kralen in 500 µL van 1 x NTB buffer wassen. Vervolgens, wassen kralen in 100 µL van 1 x beperking buffer 2, resuspendeer kralen in 50 µL van 1 x beperking buffer 2 en breng kwantitatief over in een nieuwe buis.

15. hi-C bibliotheek versterking

  1. Bereiden van PCR master mix: 100 µL van 5 x Phusion buffer; 6 µL van 25 µM PE PCR Inleiding 1.0; 6 µL van 25 µM PE PCR Inleiding 2.0; 14 µL van dNTP mix (10 mM elke); 6 µL van Phusion polymerase; 318 µL van H2O.
  2. Mix-PCR master mix met de kralen (500 µL in totaal), verdelen in 10 porties van 50 µL, en versterken door PCR met behulp van de volgende voorwaarden:
    30s bij 98 ° C
    7 cycli van: 10 s bij 98 ° C; 30 s bij 65 ° C; 30 bij 72 ° C s
    7 min bij 72 ° C
  3. PCR reacties te verzamelen in een nieuwe buis, terugvorderen parels op de magnetische scheiding stand, en de overdracht supernatant (500 µL) in een nieuwe buis.
  4. Het zuiveren van het DNA van de bibliotheek met behulp van SPRI kralen.
    1. Mix SPRI kralen, breng 460 µL van kralen in een nieuwe buis, en breng aan RT gedurende 15 min. toevoegen 450 µL van SPRI kralen met de PCR reacties (eindvolume 950 µL), Incubeer gedurende 5 min op RT en spin monster in een benchtop centrifuge voor 2 – 3 s tot monster verzameld.
    2. Open het deksel, leg het monster met op de stand van de magnetische scheiding voor 5 min en bovendrijvende vloeistof verwijderen.
    3. 1 mL van 70% ethanol (vol/vol) aan buis proeven over een gebied duidelijk van kralen, verlaten voor 30 s, en negeren supernatant houden de kralen op de stand van de magnetische scheiding, toevoegen.
    4. Herhaal stap 15.4.3 tweemaal meer.
    5. Droog kralen bij 37 ° C in een thermomixer (buis deksel open) voor niet meer dan 5 min.
    6. 51 µL van TLE buffer Voeg aan het monster, mix, en incubeer gedurende 10 minuten bij 37 ° C, schudden bij 950 rpm in een thermomixer.
    7. Spin monster in een benchtop centrifuge voor 2 – 3 s, open het deksel en de buis op de magnetische scheiding staan voor 5 min. overdracht plaats duidelijk bovendrijvende substantie in een nieuwe buis en negeren kralen.
    8. Kwantificeren van de concentratie van de Hi-C bibliotheek. Na 7 rondes van PCR versterking bekomen we routinematig 500 – 1500 ng van Hi-C bibliotheek.

16. hybride In-oplossing Capture

Opmerking: Blocker en buffer (SHS1-4) oplossingen die hieronder zijn van de SureSelect kit (Zie Tabel van materialen).

  1. Overdracht 500 ng 1 µg Hi-C bibliotheek in een nieuwe buis en monster op een vacuüm Concentrator verdampen (Zie Tabel van materialen, 45 ° C; vacuüm druk: 30,0 niveau, helling 5) tot droog.
  2. Resuspendeer verdampte Hi-C bibliotheek door de toevoeging van 3.6 µL van H2O (de rang van de moleculaire biologie), 2,5 µL van blocker 1, 2.5 µL van blocker 2 en 0.6 µL van aangepaste blocker.
  3. Pipetteer monster in een putje van een nieuwe PCR buis strip, sluit met een PCR GLB strip en plaatsen op het ijs. Label als "D" (voor Hi-C DNA).
  4. Voorbereiden van de kruising buffer: 12,5 µL van SHS1 buffer; 0,5 µL van SHS2 buffer; 5 µL van SHS3 buffer; 6.5 µL van SHS4 buffer.
  5. Incubeer bij 65 ° C gedurende 5 minuten in een thermomixer. Pipetteer in een putje van een nieuwe PCR buis strip, sluit met een PCR GLB strip en houd bij RT. Label als "H" (voor hybridisatie buffer).
  6. In een goed van een nieuwe PCR buis strip, Meng 5 µL van 100 ng/µL biotinyleerd sondes van RNA (winkel bij-80 ° C en dooi op ijs vlak voor gebruik); 0,5 µL van SRNase B (RNase remmer) en 1,5 µL van H2O (moleculaire biologie grade).
  7. Sluit de PCR buis strip met een PCR GLB strip en plaats op het ijs. Label als "R" (voor RNA).
  8. PCR machine met behulp van de volgende parameters instellen:
    5 min bij 95 ° C; 25 h bij 65 ° C; deksel verwarmd; 29 µL PCR reactie volume.
    Opmerking: Ga zo snel mogelijk tijdens alle procedures terwijl de PCR-machine wordt uitgevoerd om te voorkomen dat monster verdamping.
  9. Plaats van de "D" PCR buis strip in de PCR-machine, sluit het deksel van de machine PCR, en beginnen met de PCR-reactie. Wanneer de PCR-programma 65 ° C bereikt, open het deksel van de machine PCR en plaats van de "H" PCR buis strip in de PCR-machine. Sluit het deksel van de machine PCR en incubeer gedurende 3 min. Open de PCR machine deksel, plaats de "R" PCR buis strippen op de machine van PCR, en sluit de PCR-machine.
  10. Na 2 min, open het deksel van de machine PCR en alle PCR buis stroken. Pipetteer 13 µL van goed "H" in goed "R", vervolgens al volume van goed "D" in goed "R". Pipetteer boven en beneden 3 keer te mengen de reactie, sluit de PCR buis strip, verwijderen de "H" en "D" PCR tube strips, en PCR machine deksel dicht doet. Incubeer de reactie bij 65 ° C gedurende 24 uur.

17. isolatie van promotor Fragment-bevattende afbinding producten

Opmerking: De volgende stappen worden aanbevolen worden gedaan met SureSelect adapter kit en bibliotheek (Zie Tabel van materialen).

  1. Vooraf warm 1,5 mL was buffer 2 per monster bij 65 ° C op voorhand.
  2. Voeg 60 µL van daar-coupled magnetische kralen (Zie Tabel van materialen) in een nieuwe buis, plaats op de magnetische scheiding staan voor 1 min en bovendrijvende vloeistof verwijderen.
  3. Wassen kralen driemaal met 200 µL 1 x bindende buffer.
    Opmerking: Voor elke stap wassen tijdens het isolement na opname van promotor-bevattende afbinding producten resuspendeer kralen in de overeenkomstige buffer, draaien voor 3 min op RT en 15 rpm op het draaiende wiel, zachtjes draaien de buis in een benchtop centrifuge voor 2 – 3 s om te verzamelen monster, plaats de buis op de magnetische scheiding staan voor 3 min, en verwijderen supernatant.
  4. Resuspendeer kralen in 200 µL 1 x bindende buffer. Open de PCR-machine en de PCR buis strip (terwijl het PCR-programma nog steeds loopt) en breng de kruising reactie in de buis met de magnetische kralen. Incubeer bij RT gedurende 30 minuten op een draaiende wiel van 3 toeren per minuut.
  5. Kralen op de magnetische scheiding stand heroveren en verwijderen van het supernatans dat duidelijk. Resuspendeer kralen in 500 µL van was buffer 1, mix, en incubeer gedurende 15 minuten bij 20 ° C terwijl het schudden bij 950 rpm in een thermomixer.
  6. Terugvorderen van de kralen op de stand van de magnetische scheiding gedurende 3 minuten en verwijder het supernatant helder. Resuspendeer kralen in 500 µL van was buffer 2, meng en incubeer 10 minuten bij 65 ° C terwijl het schudden bij 950 rpm in een thermomixer. Herhaal stap 17,5 tweemaal meer.
  7. Terugvorderen van de kralen op de stand van de magnetische scheiding, verwijderen van het duidelijke supernatant en resuspendeer kralen in 200 µL 1 x beperking buffer 2. Terugvorderen van de kralen op de stand van de magnetische scheiding, verwijderen van supernatant en resuspendeer kralen in 30 µL 1 x beperking buffer 2.

18. PCHi-C bibliotheek versterking

  1. Bereiden van PCR master mix: 60 µL van 5 x PCR buffer (Phusion buffer), 3.6 µL van 25 µM PE PCR Inleiding 1.0, 3.6 µL van 25 µM PE PCR Inleiding 2.0, 8.4 µL van dNTP mix (elke 10 mM), 3.6 µL van Phusion polymerase en 190.8 µL van H2O.
  2. Mix-PCR master mix met de kralen (300 µL in totaal), verdelen in 6 porties van 50 µL, en PCR-versterken met behulp van de volgende voorwaarden:
    30 bij 98 ° C s
    4 cycli van: 10 bij 98 ° C, 30 s bij 65 ° C, 30 s s bij 72 ° C
    7 min bij 72 ° C
  3. Verzamelen van alle PCR reacties in een nieuwe buis, terugvorderen van de parels aan de magneet en overdracht van supernatant (300 µL; bevat PCHi-C bibliotheek) in om een nieuwe buis.
  4. De PCHi-C-bibliotheek met behulp van SPRI kralen, de stappen hierboven onder 15,4 zuiveren.
  5. Kwantificeren van de concentratie van de PCHi-C bibliotheek.

Representative Results

Promotor vangen Hi-C is gebruikt om te verrijken muis7,34,36,,39 en menselijke33,35,,37,38 Hi-C bibliotheken voor promotor interacties. Een vergelijkbaar protocol (genaamd HiCap) is beschreven door de Sandberg groep40. Figuur 1A blijkt de schematische workflow voor promotor vangen Hi-C. In het protocol beschreven hier, worden Hi-C bibliotheken gegenereerd met behulp van in-nucleus afbinding41, die in een aanzienlijk lagere aantal valse afbinding producten42 resulteert. Voor PCHi-C, zeer complexe muis of menselijke Hi-C bibliotheken zijn onderworpen aan-oplossing hybridisatie en vangen met 39,021 biotinyleerd RNAs aanvulling op 22,225 muis promotor-bevattende HindIII beperkingsfragmenten of 37,608 biotinyleerd RNAs gericht op 22,076 menselijke promotor-bevattende HindIII beperkingsfragmenten, respectievelijk. Promotor met beperkingsfragmenten kan worden gericht aan een of beide uiteinden door individuele biotinyleerd RNAs (figuur 1B). We vonden dat de opname van beide verbeterde dekking van individuele initiatiefnemers (Figuur 1 c; rauwe volgorde leest) bijna twee-voudige, eindigt zoals verwacht. Dus, wanneer mogelijk (dat wil zeggen, niet-repeterende regio), adviseren wij met biotinyleerd RNAs complementair is aan beide uiteinden van het fragment van een beperking te worden vastgelegd.

Om te beoordelen PCHi-C bibliotheek kwaliteit in een vroeg stadium tijdens de voorbereiding van de bibliotheek, voeren we twee besturingselementen na Afbinding van DNA en reiniging, als eerder beschreven31. De eerste is het gebruik van specifieke primerparen om afbinding producten zoals in 3 C27te versterken. We gebruiken primerparen (tabel 1) te versterken-celtype invariant lange-afstands afbinding producten, zoals tussen het Myc -gen en de bekende smaakversterkers ligt ongeveer 2 Mb weg (figuur 2A) of tussen genen van het Hist1 locus ( gescheiden door 1.5 Mb), en tussen de twee regio's gelegen in directe nabijheid van de lineaire ('korte afstand control').

De tweede kwaliteitscontrole wordt uitgevoerd om te bepalen van de efficiëntie van biotine opneming tijdens Klenow-gemedieerde fill-in van beperking site overhangen met biotine-dATP. Succesvolle Klenow invullen en latere blunt-end afbinding resultaten bij de verdwijning van de oorspronkelijke site van de beperking tussen de DNA-moleculen van een afbinding product, en in het geval van HindIII in de vorming van een nieuwe NheI erkenning site (figuur 2B ). De verhouding van de HindIII op NheI verteerd afbinding product is een directe uitlezing van biotine opneming efficiëntie. Een slechte kwaliteit Hi-C bibliotheek zal het tonen van een hoog niveau van HindIII de spijsvertering, overwegende dat kwalitatief hoogwaardige bibliotheken in de buurt van-volledige NheI vertering van afbinding producten (figuur 2B hebben).

Na Hi-C bibliotheek voorbereiding (dat wil zeggen, nadat biotine-daar pull-down van grootte geselecteerde Hi-C afbinding producten, adapter afbinding en pre vangen PCR), wordt de integriteit en de omvang verdeling van de Hi-C bibliotheek beoordeeld door de Bioanalyzer (figuur 2 C). de hetzelfde besturingselement wordt uitgevoerd aan het einde van PCHi-C bibliotheek voorbereiding (dat wil zeggen, na inname van de kruising van de promotor-bevattende afbinding producten en na opname PCR). Vergelijking van de Hi-C en PCHi-C Bioanalyzer profielen toont aan dat zoals verwacht, Hi-C bibliotheken veel meer geconcentreerd dan de overeenkomstige PCHi-C-bibliotheken zijn, maar de grootteverdeling van de bibliotheken zeer vergelijkbaar is, hetgeen aangeeft dat de vangst stap in PCHi-C geen grootte bias (figuur 2C, D) worden geïntroduceerd.

Na gekoppeld-einde sequencing, de PCHi-C leest zijn toegewezen, kwaliteit gecontroleerd en gefilterd met behulp van de HiCUP pijpleiding43. Kwalitatief hoogwaardige PCHi-C bibliotheken bevatten tussen 70-90% 'geldig paren' (dat wil zeggen, gekoppeld-einde reeks leest tussen twee beperkingsfragmenten die niet zijn naburige op de lineaire genomic kaart; Figuur 3A, B). Met behulp van de in-nucleus afbinding protocol41,42, lezen het percentage trans paren (dat wil zeggen, gekoppeld-einde reeks leest tussen twee beperkingsfragmenten die op verschillende chromosomen bevinden zich) zijn meestal lage, tussen 5 en 25%, als gevolg van het bestaan van chromosoom gebieden, en met vermelding van de bibliotheek van goede kwaliteit. Directe vergelijking van het percentage van 'geldig paren' tussen Hi-C bibliotheken en hun overeenkomstige PCHi-C bibliotheken35, toont aan dat in alle gevallen het percentage van geldige paren is hoger in de bibliotheken van de PCHi-C (figuur 3B). Dit gaat gepaard met een vermindering van het percentage van niet-geldige 'hetzelfde fragment interne' luidt in PCHi-C (Figuur 3 c). Dit is te verwachten, zoals de capture-stap voor promotor-bevattende afbinding producten verrijkt, maar ook voor beperking fragment doeleinden, als gevolg van de positie van de vangst oligos betreffende beperking fragmenten (Zie figuur 1B).

Na HiCUP filteren, bepalen we de efficiëntie van de opname. PCHi-C bibliotheken bevatten drie typen van geldige reeks luidt na HiCUP filteren:
1.) promotor: genoom leest (dat wil zeggen, leest tussen een fragment van de vastgelegde promotor en een niet-promotor HindIII beperking fragment overal in het genoom)
2.) promotor: promotor leest (leest tussen twee gevangen promotor fragmenten)
3.) genoom: genoom leest (achtergrond Hi-C afbinding producten waar geen van de afbinding Productpartners aan een vastgelegde promotor toegewezen). Deze worden verwijderd vóór de stroomafwaartse analyses.

Kwalitatief hoogwaardige PCHi-C bibliotheken moeten vastleggen efficiëntie (som van de categorieën 1 en 2 hierboven) tussen 65-90% (figuur 3D). Een directe vergelijking naar Hi-C bibliotheken toont aan dat PCHi-C resulteert in een ~ 15-fold verrijking voor promotor-bevattende afbinding producten (figuur 3D), in sommige gevallen 17-fold. Dit is dicht bij het hypothetische maximum (19.6-fold) verrijking voor PCHi-C, die afhankelijk van het percentage van het genoom beperkingsfragmenten is gedekt door het systeem vastleggen. Grotere verrijking kan worden bereikt door het ontwerpen van opname systemen gericht op minder beperking fragmenten44,45,46.

Analyse van de promotor interactomes blijkt cel type en lineage-specificiteit33,34,35, met uitgesproken wijzigingen tijdens celdifferentiatie37,38,39 . Figuren 4 en 5 voorbeelden van lineage specificiteit en differentiatie dynamiek op specifieke initiatiefnemers. Bijvoorbeeld, ALAD constitutively wordt uitgedrukt in alle cellen maar haar expressie is upregulated in de erytroblasten47. De promotor ALAD contact op verschillende distale fragmenten in alle hematopoietische cellen en houdt zich bezig met extra interacties specifiek in de erytroblasten (Figuur 4). IL-8 toont geen statistisch significante interacties in de B-cellen, zeer weinig interacties in T-cellen, maar tientallen interacties in cellen van de myeloïde afkomst, met inbegrip van celtype specifieke interacties in monocyten, neutrofielen en megakaryocytes) Figuur 5). Deze voorbeelden laten zien hoe PCHi-C kan worden gebruikt om te ontrafelen celtype specifieke interactomes en promotor-interactie regio's identificeren met regelgevende potentieel.

Figure 1
Figuur 1 : Promotor vangen Hi-C grondgedachte en vangen aas ontwerp. (A) schematische workflow van PCHi-C. In-nucleus afbinding Hi-C41,42 (I) wordt gevolgd door-oplossing kruising met biotinyleerd RNA lokaas (II) de beperkingsfragmenten van alle menselijke gericht op (hier afgebeeld) of muis gene initiatiefnemers (III). (B) aas ontwerp voor PCHi-C. Biotinyleerd RNA vangen lokaas (rode gebogen lijnen) zijn ontworpen tegen de uiteinden van de beperkingsfragmenten promotor-bevattende (grijs; opmerking dat de promotor sequenties zelf (rood) alleen door de RNA vangen lokaas zijn gericht, als ze zich op beperking bevinden fragment eindigt). Afbinding producten bestaande uit promotor-bevattende beperkingsfragmenten (grijs) en hun interactie beperkingsfragmenten (geel en groen) zijn geïsoleerd door middel van sequentie-complementariteit hybridisatie tussen aas van RNA en DNA doelstelling, en daaropvolgende biotine-daar pulldown, zoals in A. (C) vergelijking voor PCHi-C vangen efficiëntie voor beperkingsfragmenten promotor-bevattende doelwit van een RNA aas vangen sonde vs twee RNA aas vangen sondes (zie schema in B). Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2 : PCHi-C pre sequencing kwaliteitscontroles. (A) verliet schematische van ruimtelijke nevenschikking tussen promotor en PIR, resulterend in een Hi-C afbinding product bestaande uit een fragment beperking promotor-bevattende (grijs; promotor sequentie in het rood) en een PIR beperking fragment (geel). Recht, DNA gel elektroforese waarin voorbeelden van Hi-C afbinding producten versterkt met behulp van specifieke primerparen (zoals afgebeeld in schema aan de linkerkant). (B) verliet representatieve voorbeelden van HindIII, NheI en HindIII/NheI beperking digests van Hi-C afbinding producten (PCR producten getoond in A). Rechts, de volgorde van de schematische voorstelling van DNA na Hi-C afbinding na mislukte (boven) of succesvolle (onder) dNTP Klenow fill-in van beperking kruispunten en latere afbinding. (C) vertegenwoordiger Hi-C bibliotheek bioanalyzer Profiel (1/5 verdunning). (D) vertegenwoordiger PCHi-C bibliotheek bioanalyzer Profiel (geen verwatering). Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3 : PCHi-C na sequencing kwaliteitscontroles. (A) vergelijking van percentage geldige volgorde lezen paren na HiCUP43 verwerking in vs van de PCHi-C Hi-C bibliotheken (gegevens uit Javierre et al., 201635) overeenkomt. (B) vertegenwoordiger HiCUP PCHi-C resultaat tonen geldig Lees paren, en andere volgorde categorieën die worden genegeerd voordat downstream analyses (gegevens uit Javierre et al., 201635). (C) vergelijking van percentage 'dezelfde interne fragment' leest na HiCUP verwerken in versus van de PCHi-C Hi-C bibliotheken (gegevens uit Javierre et al., 201635) overeenkomt. (D) vergelijking van percentage volgorde leest waarbij aas promotor fragmenten (efficiencyeffect vastleggen) in de vs van de PCHi-C Hi-C bibliotheken (gegevens uit Javierre et al., 201635) overeenkomt. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4: ALAD PCHi-C profiel in menselijke hematopoietische cellen. Promotor interacties van soorten myeloïde cellen worden weergegeven als blauwe bogen, en promotor interacties van lymfoïde celtypes worden weergegeven als paars bogen. Erytroblast-specifieke interacties worden aangegeven door rode pijlen (gegevens uit Javierre et al., 201635). Klik hier voor een grotere versie van dit cijfer.

Figure 5
Figuur 5 : IL8 PCHi-C profiel in menselijke hematopoietische cellen. Promotor interacties van soorten myeloïde cellen worden weergegeven als blauwe bogen, en promotor interacties van lymfoïde celtypes worden weergegeven als paars bogen. Monocyt-specifieke interacties worden aangegeven met groene pijlen, neutrofiele-specifieke interacties worden aangegeven door rode pijlen en een Megakaryocyt-specifieke interactie wordt aangegeven door een bruine pijl (gegevens uit Javierre et al., 201635). Klik hier voor een grotere versie van dit cijfer.

Menselijke
Naam Volgorde Chromosoom Strand Start GRCh38/hg38 Einde GRCh38/hg38 Primer combinaties om 3C interacties en biotine opneming te testen
HS AHF64 Dekker GCATGCATTAGCCTCTGCTGTTCTCTGAAATC 11 + 116803960 116803991 gebruiken in combinatie met hs AHF66 Dekker
HS AHF66 Dekker CTGTCCAAGTACATTCCTGTTCACAAACCC 11 + 116810219 116810248 gebruiken in combinatie met hs AHF64 Dekker
HS MYC locus GGAGAACCGGTAATGGCAAA 8 - 127733814 127733833 gebruiken in combinatie met hs MYC +1820 of hs MYC-538
HS MYC +1820 AAAATGCCCATTTCCTTCTCC 8 + 129554527 129554547 gebruiken in combinatie met hs MYC locus
HS MYC-538 TGCCTGATGGATAGTGCTTTC 8 - 127195696 127195716 gebruiken in combinatie met hs MYC locus
HS HIST1 F AAGCAGGAAAAGGCATAGCA 6 + 26207174 26207193 gebruiken in combinatie met hs HIST1 R
HS HIST1 R TCTTGGGTTGTGGGACTTTC 6 + 27771575 27771594 gebruiken in combinatie met hs HIST1 F
Muis
Volgorde Chromosoom Strand Start GRCm38/mm10 Einde GRCm38/mm10 Primer combinaties om 3C interacties en biotine opneming te testen
TCATGAGTTCCCCACATCTTTG 8 + 84841090 84841111 gebruiken in combinatie met mm Calr2
CTGTGGGCACCAGATGTGTAAAT 8 + 84848519 84848541 gebruiken in combinatie met mm Calr1
TATCAAGGGTGCCCGTCACCTTCAGC 6 + 125163098 125163123 gebruiken in combinatie met Gapdh4 Dekker
GGGCTTTTATAGCACGGTTATAAAGT 6 + 125163774 125163799 gebruiken in combinatie met Gapdh3 Dekker
GGAGGAGGGAAAAGGAGTGATT 6 + 52212829 52212850 gebruiken in combinatie met mm Hoxa13
CAGGCATTATTTGCTGAGAACG 6 - 52253490 52253511 gebruiken in combinatie met mm Hoxa7
GGGTAATGGTGTCACTAACTGG 13 + 23571284 23571305 gebruiken in combinatie met Hist1h3e of mm Hist1h4i
GGGTTTGATGAGTTGGTGAAG 13 + 23566541 23566561 gebruiken in combinatie met mm Hist1h2ae
TTGGGCCAAAGCCTATATGA 13 + 22043085 22043104 gebruiken in combinatie met mm Hist1h2ae

Tabel 1: Primer sequenties voor kwaliteitscontrole van mens en muis Hi-C bibliotheken.

Discussion

Modulair ontwerp voor promotor vangen Hi-C

Promotor vangen Hi-C is ontworpen om specifiek verrijken Hi-C bibliotheken voor interacties voor initiatiefnemers. Deze interacties vormen slechts een subset van afbinding producten aanwezig in de bibliotheek van een Hi-C.

Capture Hi-C kan eenvoudig worden aangepast om te verrijken van Hi-C bibliotheken voor genomic regio of regio's van belang door het veranderen van het systeem vastleggen. Capture regio's kunnen continu genomic segmenten44,45,46,48, versterkers die zijn omschreven in de PCHi-C ('Reverse vangen Hi-C'35) of DNase I overgevoelig sites49 . De omvang van de opname-systeem kan worden aangepast afhankelijk van de experimentele reikwijdte. Bijvoorbeeld Dryden et al. target 519 aas fragmenten in drie gene woestijnen borst kanker44is gekoppeld. Het systeem vastleggen door Martin et al. richt zich op zowel continu genomic segmenten ('Regio Capture': 211 genomic regio's in totaal, 2,131 beperkingsfragmenten) en initiatiefnemers (3,857 gene initiatiefnemers)45geselecteerd.

SureSelect-bibliotheken zijn beschikbaar in verschillende grootte varieert: 1 kb tot 499 kb (5.190 – 4,806), 500 kb tot 2,9 Mb (5.190 – 4,816), en 3 Mb tot 5,9 Mb (5.190 – 4,831). Zoals elke afzonderlijke opname Biotine-RNA 120 nucleotiden lang is, deze vangen systemen geschikt voor maximaal 4,158, 24,166 en 49,166 individuele vangen sondes, respectievelijk. Dit komt overeen met 2,079, 12,083 en 24,583 gerichte beperkingsfragmenten, respectievelijk (merk op dat de aantallen voor beperkingsfragmenten ondergrenzen gebaseerd op de veronderstelling dat de twee afzonderlijke opname sondes kunnen worden ontworpen voor iedere restrictie fragment — in werkelijkheid als gevolg van repetitieve sequenties zal dit niet gebeuren voor iedere restrictie fragment (Zie ook figuur 1B, C), wat resulteert in een hoger aantal targetable beperkingsfragmenten voor een constant aantal beschikbare vangst sondes ).

Het protocol hier beschreven is gebaseerd op het gebruik van een restrictie-enzym met een 6 bp erkenning site om te ontdekken van lange-afstands interacties. Met behulp van een restrictie-enzym met een 4 bp erkenning site voor grotere resolutie van meer proximale interacties is ook mogelijk40,49.

Beperkingen van PCHi-C

Een inherente beperking van alle chromosoom conformatie vangen tests is dat hun resolutie wordt bepaald door de restrictie-enzym gebruikt voor de generatie van de bibliotheek. Interacties die tussen DNA-elementen gelegen op de dezelfde beperking fragment plaatsvinden zijn onzichtbaar voor 'C-type' testen. Verder, in PCHi-C, in sommige gevallen meer dan één transcriptie start website kan zich bevinden op de dezelfde promotor-bevattende beperking fragment en PIRs in sommige gevallen haven zowel actieve en repressieve Histon merken, waardoor het moeilijk te lokaliseren die regelgevende elementen bemiddelen de interacties, en om te voorspellen de regelgevende output van interacties van de promotor. Met behulp van restrictie-enzymen met 4 bp erkenning sites vermindert dit probleem maar gaat ten koste van enorm toegenomen Hi-C bibliotheek complexiteit (Hi-C bibliotheken die zijn gegenereerd met 4 bp erkenning site restrictie-enzymen zijn ten minste 100 keer complexer dan Hi-C bibliotheken die zijn gegenereerd met 6 bp erkenning site restrictie-enzymen), en de bijkomende kosten voor het volgende generatie rangschikken.

Een andere beperking is dat het huidige PCHi-C-protocol vereist dat miljoenen cellen als grondstof, uitschakeling van de analyse van de promotor interacties in zeldzame celtypes. Een gemodificeerde versie van PCHi-C om de ondervraging van promotor contacten in cel populaties met 10.000 tot 100.000 cellen (bijvoorbeeld cellen tijdens de vroege embryonale ontwikkeling of hematopoietische stamcellen) zou dus een waardevolle toevoeging aan het vangen Hi-C de werkset.

Ten slotte, zoals alle methoden die afhankelijk zijn van formaldehyde fixatie, PCHi-C registreert alleen interacties die 'bevroren worden' op het tijdstip van fixatie. Dus, om te studeren de kinetiek en de dynamiek van de promotor interacties, methoden zoals Super resolutie levende cel microscopie nodig zijn naast PCHi-C.

Methoden om te ontleden ruimtelijke chromosoom organisatie met hoge resolutie

De enorme complexiteit van chromosomale interactie bibliotheken verbiedt een betrouwbare identificatie van producten van de interactie tussen twee specifieke beperkingsfragmenten met statistische significantie. Om dit probleem te omzeilen, is volgorde vastleggen gebruikt of Hi-C33,34,40,44 of 3 C50,51 bibliotheken voor specifieke interacties te verrijken. Het grote voordeel van het gebruik van Hi-C bibliotheken meer dan 3C bibliotheken voor de verrijking stap is dat de Hi-C, in tegenstelling tot de 3C, een verrijking stap voor echte afbinding producten bevat. Als gevolg daarvan, is het percentage van geldige luidt in PCHi-C bibliotheken ongeveer 10-fold hoger dan in Capture-C bibliotheken50, die ongeveer 5-8% geldig na HiCUP filteren leest. Sahlen et al. hebben rechtstreeks Capture-C tot HiCap, die net als PCHi-C Hi-C bibliotheken gebruikt voor verrijking van de opname, in tegenstelling tot de Capture-C die gebruik maakt van 3 C bibliotheken vergeleken. In overeenstemming met onze bevindingen, vonden ze dat Capture-C bibliotheken zijn voornamelijk samengesteld uit un-ligaturen fragmenten40. Bovendien had HiCap bibliotheken een hogere complexiteit dan Capture-C bibliotheken40.

Een variant op Capture-C, genaamd volgende-generatie Capture-C52 NG Capture-C maakt gebruik van een oligo per beperking fragment einde, als eerder gevestigd in PCHi-C33,34, in plaats van overlappende sondes gebruikt in de oorspronkelijke In Capture-C protocol50. Dit verhoogt het percentage van geldige luidt in vergelijking met Capture-C bescheiden, maar NG Capture-C maakt gebruik van twee opeenvolgende rondes van capture verrijking, en een relatief hoog aantal PCR cycli (20 tot en met 24 cycli in totaal, vergeleken met 11 cycli meestal voor PCHi-C), die leidt onvermijdelijk tot hogere aantallen reeks duplicaten en lagere complexiteit van de bibliotheek. In proef experimenten tijdens de optimalisatie van PCHi-C, vonden we dat het percentage van de unieke (dat wil zeggen, niet gedupliceerd) paren was slechts ongeveer 15 leest % toen gebruikten we 19 cycli van PCR (13 cycli vooraf vastleggen + 6 cycli post vangen; gegevens niet worden weergegeven), maar optimalisatie voor een lager aantal cycli van PCR, levert meestal 75-90% unieke Lees paren. Dus, het verminderen van het aantal cycli van PCR aanzienlijk verhoogt de hoeveelheid informatieve sequencedata.

Een recente methode combineert ChIP met Hi-C te richten op chromosomale interacties gemedieerd door een specifieke proteïne van belang (HiChIP53). In vergelijking met ChIA-PET54, die is gebaseerd op een soortgelijke reden, bevat HiChIP gegevens een hoger aantal informatieve volgorde leest, zodat voor hogere-vertrouwen interactie aanroepen van53. Het zal zeer interessant zijn om te vergelijken direct de bijbehorende HiChIP en vangen Hi-C datasets zodra ze beschikbaar komen (bijvoorbeeld met behulp van een antilichaam tegen de cohesin eenheid Smc1a HiChIP53 met Capture Hi-C voor alle Smc1a gebonden beperking fragmenten) naast elkaar. Een inherente verschil tussen deze twee benaderingen is dat vangen Hi-C niet afhankelijk is van de chromatine immunoprecipitation, en daarom kunnen ondervragen chromosomale interacties ongeacht eiwit bezetting. Hierdoor vergelijking van 3D genoom organisatie in de aan- of afwezigheid van specifieke factor bindende, als is gebruikt voor het identificeren van PRC1 als een zeer belangrijke regelgever van muis ESC ruimtelijke genoom het platform7.

PCHi-C en GWAS

Genoom-brede vereniging studies (GWAS) is gebleken dat meer dan 95% van ziekte-geassocieerde varianten van de reeks in niet-codeert gebieden van het genoom, vaak op grote afstanden naar eiwit-codeert genen55bevinden. GWAS varianten zijn vaak gevonden in nabijheid van DNase ik overgevoelig sites, dat is een kenmerk van sequenties met potentiële regelgeving. PCHi-C en vangen Hi-C hebben is gebruikt uitgebreid initiatiefnemers koppelen aan GWAS risico loci betrokken bij borst kanker44, colorectal kanker48en auto-immune ziekte35,45,46. Een PCHi-C studie over 17 verschillende menselijke hematopoietische cel typen gevonden SNPs geassocieerd met auto-immune ziekte werden verrijkt in de PIRs in lymfoïde cellen, overwegende dat varianten van de reeks die is gekoppeld aan de bloedplaatjes en rode bloedcellen specifieke kenmerken werden voornamelijk gevonden in de macrofagen en erytroblasten, respectievelijk35,56. Dus, specifieke promotor weefseltype interactomes aan het licht gebracht door PCHi-C kan helpen om de functie van niet-coderende ziekte-geassocieerde begrijpen volgnummer varianten en identificeren van nieuwe potentiële ziekte genen voor therapeutische interventie.

Kenmerken van regio's promotor-interactie

Meerdere lijnen van bewijsmateriaal link promotor interactomes naar gen expressie controle. Ten eerste, verschillende PCHi-C studies hebben aangetoond dat genomische regio's interactie met initiatiefnemers van (zeer) uitgedrukte genen zijn verrijkt met merken die zijn gekoppeld aan enhancer activiteit, zoals het H3K27 acetylation en p300 bindende33,34 , 37. Wij vonden een positieve correlatie tussen gen expressie niveau en het aantal interacterende enhancers, suggereren dat additieve effecten van versterkers resulteren in verhoogde genexpressie niveaus34,35. Ten tweede, natuurlijke expressie kwantitatieve trait loci (eQTLs) zijn verrijkt met PIRs die zijn aangesloten op de dezelfde genen waarvan de expressie wordt beïnvloed door de eQTLs35. Ten derde, door reis57 en PCHi-C gegevens te integreren, Cairns et al. vond dat reis reporter genen toewijzen aan PIRs in muis SER's sterker verslaggever genexpressie dan reporter genen op integratie sites in niet-promotor-interactie regio's weergeven 58, die aangeeft dat de PIRs transcriptionele regelgevende activiteit bezitten. Deze bevindingen stellen samen voor promotor interactomes ontdekt door PCHi-C in verschillende muis en soorten menselijke cellen bevatten belangrijke regelgevende modules voor gen expressie controle.

Het is vermeldenswaard dat versterkers vertegenwoordigen slechts een klein deel (~ 20%) van alle PIRs ontdekt door PCHi-C33,34. Andere PIRs kon hebben structurele of topologische rollen in plaats van directe transcriptionele regelgevende taken. Echter, er is ook bewijs dat PCHi-C DNA-elementen met regelgevende functie die niet klassieke enhancer merken haven doen kan ontdekken. In een menselijke lymfoïde cellijn, werd de promotor van de BRD7 gevonden om te communiceren met een regio verstoken enhancer merken dat bleek te bezitten enhancer activiteit in reporter gene assays33. Regelgevende elementen met vergelijkbare kenmerken kunnen meer overvloedig dan op dit moment gewaardeerd worden. Bijvoorbeeld markeert een CRISPR gebaseerde scherm voor regelgevende DNA elementen geïdentificeerde ongemarkeerd regelgevende elementen (maatregelen) die controle van genexpressie maar zijn verstoken van enhancer59.

In andere gevallen PIRs gebleken haven chromatine merken transcriptionele repressie is gekoppeld. PIRs en interactie initiatiefnemers gebonden door PRC1 in muis SER's waren betrokken bij een uitgebreid ruimtelijke netwerk van onderdrukte genen, rekening houdend met dat de repressieve mark H3K27me37. In menselijke lymphoblastoid cellen, een verre element interactie met de projectontwikkelaar BCL6 onderdrukt transgenic verslaggever gen expressie33, suggereren dat het functioneren kan om te onderdrukken BCL6 transcriptie in zijn oorspronkelijke context.

PIRs verrijkt voor de bezetting van de chromatine isolator proteïne CTCF in menselijke SER's en NEC37 kan nog een andere klasse van PIRs vertegenwoordigen. Collectief, suggereren deze resultaten dat PIRs haven een collectie van regelgevende activiteiten in gen nog moet functioneel worden gekenmerkt.

Disclosures

Auteurs hebben niets te onthullen.

Acknowledgments

Wij danken Valeriya Malysheva voor kritische lezing van het manuscript en deskundige hulp met cijfer 1. Dit werk werd gesteund door de Medical Research Council, UK (heer/L007150/1) en de UK biotechnologie en biologische Sciences Research Council, UK (BB/J004480/1).

Materials

Name Company Catalog Number Comments
16% (vol/vol) paraformaldehyde solution Agar Scientific R1026
Dulbecco's Modified Eagle Medium (DMEM) 1x Life Technologies 41965-039
Fetal bovine serum (FBS) sterile filtered Sigma  F9665
Low-retention filter tips  Starlab S1180-3810, S1180-1810, S1180-8810 and S1182-1830
10x PBS pH 7.4 Life Technologies 70011-036
Molecular biology grade water Sigma-Aldrich W4502
1 M Tris-HCl pH 8.0 Life Technologies 15568-025
IGEPAL CA-630  Sigma-Aldrich I8896
5 M NaCl  Life Technologies 24740-011
Protease inhibitor cocktail (EDTA-free)  Roche Diagnostics 11873580001
Restriction buffer 2 (10x NEBuffer 2) New England Biolabs B7002
DNA LoBind tube, 1.5 mL  Eppendorf 0030 108.051
DNA LoBind tube, 2 mL Eppendorf 30108078
20% (wt/vol) SDS   Bio-Rad Laboratories 161-0418
20% (vol/vol) Triton X-100  Sigma-Aldrich T8787
HindIII, 100 U/uL New England Biolabs R0104
10 mM dCTP  Life Technologies 18253-013
10 mM dGTP Life Technologies 18254-011
10 mM dTTP  Life Technologies 18255-018
0.4 mM Biotin-14-dATP Life Technologies 19524-016
DNA polymerase I large (Klenow) fragment 5000 units/mL New England Biolabs M0210
10x T4 DNA ligase reaction buffer  New England Biolabs B0202
100x 10mg/ml Bovine Serum Albumin  New England Biolabs B9001
T4 DNA ligase, 1 U/μL  Invitrogen 15224-025
RNase A  Roche 10109142001
Proteinase K, recombinant, PCR grade  Roche 3115836001
20 000×g 50 ml centrifuge tube VWR 525-0156
0.5 M EDTA pH 8.0  Life Technologies 15575-020
Phenol pH 8.0  Sigma P4557
Phenol: Chloroform: Isoamyl Alcohol 25:24:1  Sigma P3803
Sodium acetate pH 5.2  Sigma S7899
Quant-iT PicoGreen  Invitrogen P7589
QIAquick Gel Extraction Kit Qiagen 28704
QIAquick PCR Purification Kit Qiagen 28104
Restriction buffer 2.1 (10x NEBuffer 2.1) New England Biolabs B7202
NheI, 100U/uL New England Biolabs R0131
Micro TUBE AFA Fiber Pre-slit snap cap 6x16mm vials  Covaris 520045 For sonication
SPRI beads (Agencourt AMPure XP)  Beckman Coulter A63881
Dynabeads MyOne Streptavidin C1 beads  Invitrogen 65001
Tween 20  Sigma P9416
10 mM dATP  Life Technologies 18252-015
T4 DNA polymerase 3000 units/mL New England Biolabs M0203
T4 PNK 10000 units/mL New England Biolabs M0201
Klenow exo minus 5000 units/mL  New England Biolabs M0212
Quick ligation reaction buffer  New England Biolabs B6058
NEB DNA Quick ligase  New England Biolabs M2200
PE adapter 1.0 (5'-P-GATCGGAAGAGCGGTTCAGC
AGGAATGCCGAG-3')
Illumina
PE adapter 2.0 (5'-ACACTCTTTCCCTACACGACGCT
CTTCCGATCT-3')
Illumina
NEB Phusion PCR kit  New England Biolabs M0530
PE PCR primer 1.0 (5'-AATGATACGGCGACCACCGA
GATCTACACTCTTTCCCTAC
ACGACGCTCTTCCGATCT-3')
Illumina
PE PCR primer 2.0 (5'-CAAGCAGAAGACGGCATACGA
GATCGGTCTCGGCATTCCT
GCTGAACCGCTCTTCCGATCT-3') 
Illumina
PCR strips  Agilent Technologies 410022 and 401425
SureSelect SSEL TE Reagent ILM PE full adaptor kit  Agilent Technologies 931108
SureSelect custom 3-5.9 Mb library  Agilent Technologies 5190-4831 custom design mouse or human PCHi-C system
Dynabeads MyOne Streptavidin T1 beads  Invitrogen 65601
E220  high-performance focused ultra-sonicator Corvaris E220

DOWNLOAD MATERIALS LIST

References

  1. Osborne, C. S., et al. Active genes dynamically colocalize to shared sites of ongoing transcription. Nature Genetics. 36, 1065-1071 (2004).
  2. Schoenfelder, S., et al. Preferential associations between co-regulated genes reveal a transcriptional interactome in erythroid cells. Nature Genetics. 42, 53-61 (2010).
  3. de Wit, E., et al. The pluripotent genome in three dimensions is shaped around pluripotency factors. Nature. 501, 227-231 (2013).
  4. Bantignies, F., et al. Polycomb-dependent regulatory contacts between distant Hox loci in Drosophila. Cell. 144, 214-226 (2011).
  5. Engreitz, J. M., et al. The Xist lncRNA exploits three-dimensional genome architecture to spread across the X chromosome. Science. 341, 1237973 (2013).
  6. Denholtz, M., et al. Long-range chromatin contacts in embryonic stem cells reveal a role for pluripotency factors and polycomb proteins in genome organization. Cell Stem Cell. 13, 602-616 (2013).
  7. Schoenfelder, S., et al. Polycomb repressive complex PRC1 spatially constrains the mouse embryonic stem cell genome. Nature Genetics. 47, 1179-1186 (2015).
  8. Kundu, S., et al. Polycomb Repressive Complex 1 generates discrete compacted domains that change during differentiation. Molecular Cell. 65, 432-446 (2017).
  9. Skok, J. A., Gisler, R., Novatchkova, M., Farmer, D., de Laat, W., Busslinger, M. Reversible contraction by looping of the Tcra and Tcrb loci in rearranging thymocytes. Nature Immunology. 8, 378-387 (2007).
  10. Zhang, Y., et al. Spatial organization of the mouse genome and its role in recurrent chromosomal translocations. Cell. 148, 908-921 (2012).
  11. Aymard, F., et al. Genome-wide mapping of long-range contacts unveils clustering of DNA double-strand breaks at damaged active genes. Nature Structural & Molecular Biology. 24, 353-361 (2017).
  12. Ryba, T., et al. Evolutionarily conserved replication timing profiles predict long-range chromatin interactions and distinguish closely related cell types. Genome Research. 20, 761-770 (2010).
  13. Pope, B. D., et al. Topologically associating domains are stable units of replication-timing regulation. Nature. 515, 402-405 (2014).
  14. Chandra, T., et al. Global reorganization of the nuclear landscape in senescent cells. Cell Reports. 10, 471-483 (2015).
  15. Carter, D., Chakalova, L., Osborne, C. S., Dai, Y. F., Fraser, P. Long-range chromatin regulatory interactions in vivo. Nature Genetics. 32, 623-626 (2002).
  16. Tolhuis, B., Palstra, R. J., Splinter, E., Grosveld, F., de Laat, W. Looping and interaction between hypersensitive sites in the active beta-globin locus. Molecular Cell. 10, 1453-1465 (2002).
  17. Amano, T., Sagai, T., Tanabe, H., Mizushina, Y., Nakazawa, H., Shiroishi, T. Chromosomal dynamics at the Shh locus: limb bud-specific differential regulation of competence and active transcription. Developmental Cell. 16, 47-57 (2009).
  18. Zuniga, A., et al. Mouse limb deformity mutations disrupt a global control region within the large regulatory landscape required for Gremlin expression. Genes & Development. 18, 1553-1564 (2004).
  19. Sagai, T., Hosoya, M., Mizushina, Y., Tamura, M., Shiroishi, T. Elimination of a long-range cis-regulatory module causes complete loss of limb-specific Shh expression and truncation of the mouse limb. Development. 132, 797-803 (2005).
  20. D'Haene, B., et al. Disease-causing 7.4 kb cis-regulatory deletion disrupting conserved non-coding sequences and their interaction with the FOXL2 promotor: implications for mutation screening. PLoS Genet. 5, e1000522 (2009).
  21. Sur, I. K., et al. Mice lacking a Myc enhancer that includes human SNP rs6983267 are resistant to intestinal tumors. Science. 338, 1360-1363 (2012).
  22. Herranz, D., et al. A NOTCH1-driven MYC enhancer promotes T cell development, transformation and acute lymphoblastic leukemia. Nature Medicine. 20, 1130-1137 (2014).
  23. Deng, W., et al. Controlling long-range genomic interactions at a native locus by targeted tethering of a looping factor. Cell. 149, 1233-1244 (2012).
  24. Groschel, S., et al. A single oncogenic enhancer rearrangement causes concomitant EVI1 and GATA2 deregulation in leukemia. Cell. 157, 369-381 (2014).
  25. Lupianez, D. G., et al. Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell. 161, 1012-1025 (2015).
  26. Franke, M., et al. Formation of new chromatin domains determines pathogenicity of genomic duplications. Nature. 538, 265-269 (2016).
  27. Dekker, J., Rippe, K., Dekker, M., Kleckner, N. Capturing chromosome conformation. Science. 295, 1306-1311 (2002).
  28. Simonis, M., et al. Nuclear organization of active and inactive chromatin domains uncovered by chromosome conformation capture-on-chip (4C). Nature Genetics. 38, 1348-1354 (2006).
  29. Zhao, Z., et al. Circular chromosome conformation capture (4C) uncovers extensive networks of epigenetically regulated intra- and interchromosomal interactions. Nature Genetics. 38, 1341-1347 (2006).
  30. Dostie, J., et al. Chromosome Conformation Capture Carbon Copy (5C): A massively parallel solution for mapping interactions between genomic elements. Genome Research. 16, 1299-1309 (2006).
  31. Lieberman-Aiden, E., et al. Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science. 326, 289-293 (2009).
  32. Belton, J. M., McCord, R. P., Gibcus, J. H., Naumova, N., Zhan, Y., Dekker, J. Hi-C: a comprehensive technique to capture the conformation of genomes. Methods. 58, 268-276 (2012).
  33. Mifsud, B., et al. Mapping long-range promoter contacts in human cells with high-resolution capture Hi-C. Nature Genetics. 47, 598-606 (2015).
  34. Schoenfelder, S., et al. The pluripotent regulatory circuitry connecting promoters to their long-range interacting elements. Genome Res. 25, 582-597 (2015).
  35. Javierre, B. M., et al. Lineage-specific genome architecture links enhancers and non-coding disease variants to target gene promoters. Cell. 167, 1369-1384 (2016).
  36. Wilson, N. K., et al. Integrated genome-scale analysis of the transcriptional regulatory landscape in a blood stem/progenitor cell model. Blood. 127, e12-e23 (2016).
  37. Freire-Pritchett, P., et al. Global reorganisation of cis-regulatory units upon lineage commitment of human embryonic stem cells. Elife. 6, (2017).
  38. Rubin, A. J., et al. Lineage-specific dynamic and pre-established enhancer-promoter contacts cooperate in terminal differentiation. Nature Genetics. 49, 1522-1528 (2017).
  39. Siersbaek, R., et al. Dynamic rewiring of promoter-anchored chromatin loops during adipocyte differentiation. Molecular Cell. 66, 420-435 (2017).
  40. Sahlen, P., et al. Genome-wide mapping of promoter-anchored interactions with close to single-enhancer resolution. Genome Biology. 16, 156 (2015).
  41. Nagano, T., et al. Single-cell Hi-C reveals cell-to-cell variability in chromosome structure. Nature. 502, 59-64 (2013).
  42. Nagano, T., Varnai, C., Schoenfelder, S., Javierre, B. M., Wingett, S. W., Fraser, P. Comparison of Hi-C results using in-solution versus in-nucleus ligation. Genome Biology. 16, 175 (2015).
  43. Wingett, S., et al. HiCUP: pipeline for mapping and processing Hi-C data. F1000 Res. 4, 1310 (2015).
  44. Dryden, N. H., et al. Unbiased analysis of potential targets of breast cancer susceptibility loci by Capture Hi-C. Genome Research. 24, 1854-1868 (2014).
  45. Martin, P., et al. Capture Hi-C reveals novel candidate genes and complex long-range interactions with related autoimmune risk loci. Nature Communications. 6, 10069 (2015).
  46. McGovern, A., et al. Capture Hi-C identifies a novel causal gene, IL20RA, in the pan-autoimmune genetic susceptibility region 6q23. Genome Biol.ogy. 17, 212 (2016).
  47. Hodge, D., et al. A global role for EKLF in definitive and primitive erythropoiesis. Blood. 107, 3359-3370 (2006).
  48. Jager, R., et al. Capture Hi-C identifies the chromatin interactome of colorectal cancer risk loci. Nature Communications. 6, 6178 (2015).
  49. Joshi, O., et al. Dynamic reorganization of extremely long-range promoter-promoter Interactions between two states of pluripotency. Cell Stem Cell. 17, 748-757 (2015).
  50. Hughes, J. R., et al. Analysis of hundreds of cis-regulatory landscapes at high resolution in a single, high-throughput experiment. Nature Genetics. 46, 205-212 (2014).
  51. Kolovos, P., et al. Targeted Chromatin Capture (T2C): A novel high-resolution high-throughput method to detect genomic interactions and regulatory elements. Epigenetics Chromatin. 7, 10 (2014).
  52. Davies, J. O., et al. Multiplexed analysis of chromosome conformation at vastly improved sensitivity. Nature Methods. 13, 74-80 (2016).
  53. Mumbach, M. R., et al. HiChIP: efficient and sensitive analysis of protein-directed genome architecture. Nature Methods. 13, 919-922 (2016).
  54. Fullwood, M. J., et al. An oestrogen-receptor-alpha-bound human chromatin interactome. Nature. 462, 58-64 (2009).
  55. Maurano, M. T., et al. Systematic localization of common disease-associated variation in regulatory DNA. Science. 337, 1190-1195 (2012).
  56. Petersen, R., et al. Platelet function is modified by common sequence variation in megakaryocyte super enhancers. Nat. Commun. 8, 16058 (2017).
  57. Akhtar, W., et al. Chromatin position effects assayed by thousands of reporters integrated in parallel. Cell. 154, 914-927 (2013).
  58. Cairns, J., et al. CHiCAGO: Robust detection of DNA looping interactions in Capture Hi-C data. Genome Biology. 17, 127 (2016).
  59. Rajagopal, N., et al. High-throughput mapping of regulatory DNA. Nature Biotechnology. 34, 167-174 (2016).
Promotor Capture Hi-C: High-resolution, genoom-brede profilering van promotor interacties
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Schoenfelder, S., Javierre, B. M., Furlan-Magaril, M., Wingett, S. W., Fraser, P. Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions. J. Vis. Exp. (136), e57320, doi:10.3791/57320 (2018).More

Schoenfelder, S., Javierre, B. M., Furlan-Magaril, M., Wingett, S. W., Fraser, P. Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions. J. Vis. Exp. (136), e57320, doi:10.3791/57320 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter