Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

זריקות של ליפופוליסכריד לתוך עכברים לחקות כניסה של מוצרים מיקרוביאלית נגזר לאחר פריצה מכשול המעי

doi: 10.3791/57610 Published: May 2, 2018



כאן מוצג פרוטוקול כדי לחקות את הכניסה של נגזר בקטריאלי תרכובות לאחר פריצה מכשול המעי. מינון נמוך לא קטלני של ליפופוליסכריד היה מוזרק מערכתית עכברים, אשר היו במעקב במשך 24 שעות לאחר ההזרקה. הביטוי של ציטוקינים פרו-דלקתיים נקבע במספר נקודות זמן הטחול, הכבד, המעי הגס.


המכשול אפיתל המעי מפריד בין המחשב המארח של microbiota בדרך כלל נסבל או התעלמות. הפרת מחסום זה מתבטא הכניסה של חיידקים או המוצרים נגזר חיידקים לתוך המחשב המארח, גישה איבריך הפנימיים שמובילים הדלקת לא מבוקרת כפי שנצפו בחולים עם מחלות מעי דלקתיות (מחלת המעי הדלקתי), והשאלה מארח את זה מאופיינים חדירות מוגברת אפיתל המעי.

כדי לחקות את הכניסה של נגזר בקטריאלי תרכובות לתוך המחשב המארח, מודל endotoxemia כבר אומץ ב אילו ליפופוליסכריד (LPS), מרכיב של הקיר החיצוני התא של חיידקים גראם שליליים, היו מוזרק עכברים. במחקר זה, מנה לא קטלני של LPS intraperitoneally שהוזרק, העכברים נוטרו לאחר מכן עבור 8 שעות באמצעות ציון המחלה. יתר על כן, הביטוי הרמות ציטוקינים דלקתיים Il6, Il1b, ו Tnfa נותחו הטחול, הכבד, המעי הגס על ידי qPCR בנקודות זמן שונות פוסט הזרקת LPS. מודל זה יכול להיות שימושי עבור המחקרים מעורבים בחקירה של תגובות חיסוניות לאחר הפלישה של מיקרואורגניזמים או המוצרים נגזר בקטריאלי הנגרם על ידי פריצת מחסום של הגוף משטחים.


or Start trial to access full content. Learn more about your institution’s access to JoVE content here

המעי האנושי הוא התנחלו עם קונסורציום גדולה של מיקרואורגניזמים המהווה את microbiota, אשר פיתחה יחסים מועילים הדדיים עם המארח במהלך האבולוציה. במערכת היחסים הזו, המארח מספק גומחה מאובטח עבור microbiota, ואילו microbiota מספק ויטמינים, עיכול מזון והגנה מפני פתוגנים למחשב המארח, שבו נמצא microbiota1. כאשר זה יחסים מועילה בין המארח לבין microbiota את מופר, מחלות יכולים לפתח, כגון מחלות מעי דלקתיות (מחלת המעי הדלקתי). מחלת המעי הדלקתי היא מחלה דלקתית כרונית multifactorial של המעי נגרמת על ידי גורמים גנטיים וסביבתיים שמתרחשים בשתי צורות הגדולות, קרוהן (CD) ומחלת קוליטיס (UC). למרות קווי דמיון בין מחלת המעי הדלקתי בשתי הצורות, והם מאופיינים על ידי הבדלים מסוימים המיקום ואת הטבע של שינויים דלקתיים. תקליטור הוא הפרעה דלקתית transmural relapsing יכול באופן פוטנציאלי להאריך לכל חלק מערכת העיכול, בעוד UC הלא-transmural, מוגבל לשימוש של המעי הגס. יתר על כן, מוטציות בגן נוקלאוטיד מחייב oligomerization מחשבים המכילים חלבון 2 (NOD2), קולטן זיהוי דפוס (PRR) מזהה muramyl dipeptide (MDP), מרכיב של דופן התא של חיידקים גראם חיוביים ביותר - שלילי, הוא הקשורים תקליטור2. יתר על כן, Escherichia coli (e. coli), ליסטריה , Streptococci ומוצרים שלהם כולם נמצאו בתוך המקרופאגים בחולי CD שנכנסו המארח לאחר. מחסום הפרה3. כאשר חיידקים או מוצריהם מזין את המחשב המארח במהלך הפיתוח של תקליטור, המערכת החיסונית מתפתחת תגובה המוביל הייצור של נוגדנים אנטי בקטריאלי4מחזורי. אולי, הראיות המשכנע ביותר לתפקיד microbiota בפתוגנזה של מחלת המעי הדלקתי נובעת העכבר מודלים. כאשר חיות מטופלים עם אנטיביוטיקה, או עכברים נשמרים בתנאים (GF) מחיידקים, חומרת המחלה מצטמצם רוב הדגמים קוליטיס, כגון IL-10-/-עכברים לא לפתח דלקת המעי הגס ב- GF מתקני5,6. יתר על כן, קוליטיס מפריע גם ההרכב של microbiota, אשר מאופיין על-ידי קומפוזיציה מאוזנת שומן מופחתת העושר שנקרא dysbiosis7. התוצאה של מחלת המעי הדלקתי יכול להיות חדירות המעי מוגבר, שעלול לגרום הכניסה של חיידקים, חיידקים, נגזר המוצרים לתוך המחשב המארח.

ב בעלי חיים, היישום של לתוספי נתרן גופרתי (DSS) גורם של הפרה אפיתל המעי המוביל חדירות מוגברת של מחסום האפיתל8. פורטל LPS ריכוז גבוהות אצל בעלי חיים עם קוליטיס כיבית DSS9. מעניין, חיות חסר את סוג לקטין קולטן ספציפי אדהזיה תאיים המולקולה סי3 תופס nonintegrin הקשורות homolog 1 (סימן-R1) מוגנים מפני DSS קוליטיס ו LPS-induced endotoxemia10. עוד יותר להפיץ לתוך המחשב המארח, חיידקים או חיידקים נגזר מוצרים יש לעבור את מחסום הדם11, חלל הצפק, בהם נמצאת המעי קטנים וגדולים, את בלוטות לימפה mesenteric ו/או הכבד12. כדי להפחית את המורכבות של מערכת זו, נעשה שימוש תרכובת מוגדרת נגזר בקטריאלי. LPS, מה שגורם endotoxemia לאחר בקרום הבטן (i.p.) או תוך ורידית (עירוי) הזרקה13 היה מוזרק עכברים, ללמוד את הביטוי של אפופטוזיס Il6 ו Ilb ו של ציטוקינים Tnfa בתגובה LPS.

LPS הוא פתוגן-הקשורים מולקולרית תבנית (PAMP) הביע כרכיב דופן התא של חיידקים גראם שליליים, המורכב ליפיד A (PAMP ראשי במבנה של LPS), של הליבה פחמימה # מיון הפחמימות וחדר בצד שרשרת14. קולטן דמוי אגרה 4 (TLR4) באה לידי ביטוי על ידי תאים דנדריטים, מקרופאגים, תאי אפיתל מזהה LPS15, הדורש שיתוף קולטנים לכריכה המתאים. שלב אקוטי ה LPS מחייב חלבון (הקפאה) מאגד LPS להקים מתחם המעבירה LPS מקבץ של בידול 14 (CD14), חלבון ממברנה מעוגן glycosylphosphatidylinositol. CD14 עוד יותר הסעות LPS לימפוציט אנטיגן 96, או הידוע גם בשם MD-2, אשר מזוהה עם המחשבים חוץ-תאי של TLR4. הכריכה של LPS MD-2 מקלה את dimerization של TLR4/MD-2 כדי לגרום שינויים הסתגלותי לגייס מתאם תאיים מולקולות ולהפעיל downstream איתות מסלול14, הכולל העיקרית התמיינות תאים מיאלואידים ג'ין תגובה 88 (MyD88) - השביל התלוי וגם את טיר המכילות תחום בתדר מתאם אינטרפרון-β (TRIF) - מסלול תלוי16. ההכרה של LPS על-ידי TLR4 ואז מפעילה מסלול NF-κB ומשרה את הביטוי של ציטוקינים proinflammatory, כגון TNFα, IL-6 ו- IL-1β17.

בפרט, כאשר LPS הוא מוזרק לבעלי חיים, הריכוז של LPS שגבה בעלי החיים, הרקע הגנטי של בעלי חיים לבין הדיאטה חייב להילקח בחשבון. ריכוזים גבוהים של LPS מוביל הלם זיהומי, המאופיינת על ידי תת לחץ דם וכישלונות איברים מרובים, ולבסוף ל מוות18. עכברים רגישים פחות LPS בהשוואה לבני אדם, איפה LPS ריכוזים בין 2-4 ng/ק"ג משקל גוף (BW) מסוגלים לגרום סערת ציטוקינים19. על עכברים, מנה קטלנית (LD50), אשר גורם למוות אצל מחצית עכברים נע בין 10-25 mg/kg BW20 בהתאם המתח העכבר להשתמש. עבור זנים נפוצים העכבר, C57Bl/6 ו- BALB/c, מנה קטלנית 50% (LD50) הוא 10 mg/kg BW. לעומת זאת, זנים C3H/HeJ ו- C57BL/10ScCr מוגנים מפני LPS מושרה endotoxemia, אשר עקב מוטציות בגן Tlr421. כתוצאה מכך, Tlr4 לקויה עכברים הם hyporesponsive כדי זריקות עם LPS22. קווים העכבר מהונדסים אחרים, כגון PARP1-/-עכברים23 עמידים LPS-induced הלם רעילים.

המודל העכבר המתואר כאן משתמש מנה לא קטלני של LPS מנוהל מערכתית כדי לחקות את ההשלכות של LPS הפצתו לאחר פריצת מחסום של המשטחים של הגוף. הריכוז LPS שבחרת (2 mg/kg BW) לא לגרום לתמותה בעכברים C56Bl/6, אבל השחרור המושרה של ציטוקינים פרו-דלקתיים.

Subscription Required. Please recommend JoVE to your librarian.


or Start trial to access full content. Learn more about your institution’s access to JoVE content here

עכברים היו בשבייה, נשמרים בתנאים מסוימים ללא פתוגן (SPF) במתקן בעלי חיים של המחלקה וההתערבות, אוניברסיטת בזל (באזל, שוויץ). כל עכבר ניסויים בוצעו בהתאם השוויצרי הפדראלי ולתקנות הקנטונים (מספר בעלי חיים פרוטוקול 2816 [קנטון של באזל-Stadt]).

1. הכנת פתרון LPS

  1. פתח את המניה של LPS מכל Escherichia coli 0111:B4 בתנאים סטריליים, לשקם אותו במים לריכוז 5 מ"ג/מ"ל.
  2. לדלל את המניה LPS בתמיסת פוספט סטרילי buffered (PBS) לריכוז עבודה 0.2 µg/µL.

2. בקרום הבטן הזרקת LPS לעכברים

  1. וארוקן את התקליטים עובד פתרון מזרק 0.5 mL עם מחט 30 גרם זרימת האוויר למינריות.
  2. שוקל C57Bl/6 נקבות עכברים (שש בגיל 10 שבועות) ולחשב את הכמות של LPS זה להיות מוזרק: משקל הגוף /g µL (2 µg) 10.
    הערה: לדוגמה, אם עכבר שוקל 20 גרם, אז µL 20 g x 10 = 200 LPS µL עובד פתרון צריך להיות מוזרק.
  3. להתמודד עם העכבר בעדינות אך בתקיפות, לרסן את החיה ביד אחת. ודא כי החיה מסוגל לנשום כרגיל אך לא לעוות ולהפוך במהלך הריסון.
  4. להטות את האף העכבר מעט לכיוון הרצפה כדי לחשוף את הבטן להזרקה. אתר האמצע של הבטן והמקום הזרקת בבטן נמוך שמאלה או ימינה מן האמצע. להזריק i.p. PBS במקום LPS לתוך בקרת עכברים.
  5. עם יד חופשית, להזריק את אמצעי האחסון המתאים (האחסון שחושבו בצעד 2.2) של התקליטים עובד פתרון. ודא כי המחט נכנסה חלל הצפק אחרת, זריקות שגויה לתוך השכבה שריר הבטן עלולה להתרחש. עדיין, לא עושה יותר מדי עמוק עם המחט לתוך חלל הצפק להימנע ופצעו את איבריך הפנימיים ממוקם באזור הזה.
  6. להחזיר החיה בקפידה, לכלוב עם עכברים עד 5 לכל כלוב.

3. הצג העכברים

  1. לפקח על החיות בזמנו של הזרקת ו- h 2 כל אחרי הזריקה עבור 8 שעות על המופע ועל חומרת endotoxemia. לכן, להשתמש גיליון הניקוד (טבלה 1) כי כבר ממאמרו של כתב היד שפורסמו בעבר 24.
  2. ציון העכברים מוזרק LPS עבור הפרמטרים הבאים הרשומים בטבלה 1
    1. בדוק המראה של הפרווה אשר בדרך כלל חלקה. אם הפרווה מופיע פרווה הסתור, מחודדים או נפוחה המציין אי נוחות או כאב, ציון אותם 1, 2 או 3.
    2. בדוק הפעילות של העכבר.
      הערה: עכברים בדרך כלל לנוע בחופשיות הכלוב כל אכילה, שתייה, טיפוס, אבל פעילות מודחקים או מוגבלות יכול להיות סימן של כאב.
    3. בדוק רמת המודעות.
      הערה: עכברים הם מאוד סקרן, הם בדרך כלל מסתובבים בסביבה הכלוב חוקרים שמסביב. חוסר או תנועה מופחתת יכול להציע לכאב ואי נוחות.
    4. תבדוק את העיניים.
      הערה: באופן מלא פקוחות צפויים בעכברים בריאים, אבל עיניים עצומות באופן חלקי או מלא, אולי עם הפרשת, יכול להיות אינדיקציה של כאב.
    5. בדוק קצב הנשימה.
      הערה: עכברים בריאים בדרך כלל יש קצב נשימה רגיל ומהיר, קצב נשימה מופחתת יכול להיות אינדיקציה של אי נוחות).
    6. בדוק איכות הנשימה.
      הערה: נשימה כבדה עם או בלי להתנשף הוא סימן של כאב.

4. רקמות דגימה מיצוי חומצה ריבונוקלאית (RNA), המגון

  1. להכין אוסף/המגון הצינורות: הוספת 1 mL צעד אחר צעד RNA בידוד ריאגנט ל 2 mL צינורות שמולאו מראש עם הספירות קרמיקה 1.4 מ מ.
  2. בנקודות זמן מתאים (לפני (0 h) ו- 2 h, 4 שעות, 8 שעות לאחר הזרקת LPS) המתת חסד את העכבר עם הרדמה יתר (איזופלוריין) ואחריו דימום למוות ולהמשיך הקרע.
  3. חותכים את העור ואת השכבה שריר לחשוף את חלל הבטן עם האברים הפנימיים עם זוג מספריים.
  4. בזהירות לנתח את הטחול, הכבד, המעי הגס, לנקות את האיברים של שומן ולשמור אותם ב- PBS על קרח.
  5. גוזרים חתיכה קטנה (כ 0.5 ס מ) של כל איבר ואיבר באמצעות מספריים או סכין.
    הערה: חשוב תמיד לקחת את החתיכה כ מאותו חלק של האיבר בכל עכבר (באותו אונת הכבד, צינתור או דיסטלי חלק המעי הגס).
  6. זמן קצר הרקמה על פיסת נייר טישו יבש ומניחים אותו בצינור אוסף/המגון מוודא כי זה הוא לגמרי שקוע ריאגנט בידוד ה-RNA.
  7. Homogenize הרקמה ב מהמגן benchtop במהירות גבוהה. על רקמות רכות כמו הטחול, הכבד, המעי הגס להשתמש מחזור 1 של המגון במהירות 6.00 ל 30 s.
  8. דגירה בדגימות למשך 5 דקות בטמפרטורת החדר.
  9. בזהירות המקום צינור החנקן הנוזלי להצמדת הקפאת הרקמה lysate. אחסן את הצמד קפוא lysate ב-80 מעלות צלזיוס עד הבידוד RNA.

5. RNA החילוץ מרקמות

הערה: בידוד ריאגנטים, כלורופורם כהלים ו RNA נחשבים כחומר מסוכן. מבצע החילוץ-RNA ברדס כימי. השתמש RNase ללא ריאגנטים מוסמך וציוד לשמירה על סביבה נטולת RNase.

  1. שלב ההפרדה
    1. להפשיר את הרקמה קפוא lysate על הקרח.
    2. Centrifuge הדגימה ב- g x 1,000 דקות 5-4 ° C עד הצניפה החלקיקים רקמות הנותרים זה עלולה להישאר.
    3. להעביר את תגובת שיקוע צינור ללא נוקלאז mL 1.5.
    4. להוסיף 200 כלורופורם כקרח µL לכל 1 מ ל RNA בידוד ריאגנט ומנערים נמרצות על ידי יד עבור s 10-15.
    5. תקופת דגירה של 2-3 דקות בטמפרטורת החדר.
    6. צנטריפוגה-12, 000 x g למשך 15 דקות ב 4 º C.
      הערה: המדגם עכשיו יכיל 3 שלבים: להוריד את שלב פנול אדום-כלורופורם, את לאטמוספרה, השלב העליון מימית השקופה. הרנ א קיים השלב העליון מימית.
    7. לאסוף את פאזה מימית העליון (50% הנפח הכולל) ואת העברת לתוך צינור ללא נוקלאז mL 1.5.
  2. RNA משקעים
    1. להוסיף 0.5 מ ל אלכוהול איזופרופיל כקרח לכל 1 מ ל RNA בידוד ריאגנט ולערבב בעדינות על-ידי היפוך הצינור 5 - 6 פעמים.
    2. תקופת דגירה של 10-15 דקות בטמפרטורת החדר.
    3. צנטריפוגה ב 12,000 x g 10 דקות ב 4 º C.
      הערה: גלולה RNA צריך להיות גלוי בשלב זה.
  3. שטיפה של RNA גלולה
    1. להסיר לחלוטין את תגובת שיקוע המכיל את אלכוהול איזופרופיל מבלי להפריע בגדר.
    2. לשטוף את גלולה עם 1 מ"ל אתנול 75% קר כקרח לכל 1 מ ל RNA בידוד ריאגנט המשמש את פירוק ראשוני.
    3. מערבולת המדגם בקצרה.
    4. צנטריפוגה המדגם ב g x 7,500 (או 12,000) עבור 5 דקות ב 4 º C.
  4. מפרק RNA
    1. להסיר לחלוטין האתנול ב תגובת שיקוע מבלי להפריע בגדר.
    2. להשאיר את צינור נפתח מתחת למכסה המנוע כימית למשך 3-5 דקות מילה נהדרת בגדר RNA בטמפרטורת החדר (לא יותר מדי יבשה כמו במקרה הזה יהיה קשה להמיס RNA).
    3. להמיס בגדר RNA במים נטולי נוקלאז µL 20-50 על ידי pipetting בזהירות למעלה ולמטה.
    4. דגירה המדגם ב 55 מעלות צלזיוס למשך 10-15 דקות לשפר עוד יותר את הפתרון של הרנ א.
      הערה: בשלב זה, ה-RNA ניתן לאחסן ב- 80 ° C עד ניתוח נוסף.

6. מערכת העיכול של DNA הנותרים

  1. למדוד את ריכוז ה-RNA עם ספקטרופוטומטרים על ידי pipetting של aliquot (2 µl) לתוך ספקטרופוטומטרים ולהתאים את הריכוז המומלץ ביותר.
  2. התחל העיכול של מזהם DNA עם מקס. רנ א במים 50 µL נטולת נוקלאז 10 µg.
  3. הוסף 0.1 בנפח 10 x DNase אני מאגר, 1 µL rDNase אני לכל דגימה, לערבב בעדינות על-ידי pipetting למעלה ולמטה.
  4. דגירה ב 37 מעלות צלזיוס למשך 20-30 דקות.
  5. מערבולת DNase איון ריאגנט ולהוסיף 0.1 נפח המדגם ערבוב טוב עם פיפטה.
  6. תקופת דגירה של 5 דקות בטמפרטורת החדר, ערבוב מדי פעם ביד.
  7. צנטריפוגה ב 10,000 g x 1.5 דקות.
  8. להעביר את תגובת שיקוע המכיל RNA ללא ה-DNA לתוך הצינור ללא נוקלאז חדש.
  9. למדוד את ריכוז ה-RNA ואת איכות על ידי ספקטרופוטומטרים.

7. שעתוק במהופך

  1. להשתמש ערכת שעתוק במהופך (RT) cDNA חומצה Deoxyribonucleic זמינים מסחרית עבור שעתוק במהופך.
    הערה: כאן, עד 2 µg של RNA יכול להיות הפוך משועתקים.
  2. לחשב את עוצמת הקול, אשר מכיל 2 µg RNA. פיפטה 2 µg RNA בתוך צינור ה-PCR.
  3. להוסיף מים נטולי נוקלאז המדגם בצינור PCR לנפח סופי של 10 µL.
  4. להכין 2 x מיקס מאסטר על ידי ערבוב המרכיבים הבאים המפורטים בטבלה מס ' 2
  5. להוסיף 10 µL 2 x מיקס מאסטר 10 µl RNA כדי לקבל 1 x מיקס מאסטר בהיקף כולל של 20 µL.
  6. סגור את פולימראז תגובת שרשרת (PCR) שפופרת ואת ספין לדגימה בקצרה.
  7. הכנס את הדגימות Thermocycler ה-PCR ולהגדיר שההגדרות שמפורטות בטבלה3.
  8. אחסן את cDNA שנוצר ב-20 ° C לצורך ניתוח נוסף.

8. כמותיים PCR (qPCR)

  1. לבצע את התגובה qPCR עם ערכת זמינים מסחרית.
  2. עצמית עיצוב ובדוק את פורש-אינטרון תחל לפני השימוש, עם ריכוזים שונים של תבנית cDNA. לנתח את היעילות של ומהצמיגים על-ידי יצירת עיקול רגיל והשתמש את תחל עם יעילות גבוהה ועיקולים ההיתוך הנכון.
    הערה: מסדרות תחל השתמשו בניסוי זה מפורטים בטבלה 2.
  3. להכין את התגובה פולימראז כמותיים תגובת שרשרת (qPCR) בצלחת 384-ובכן עם הגדרת תגובת המתוארות בטבלה 4.
  4. כל הפתרונות לשמור את הצלחת על קרח באמצעות נייר אלומיניום כדי למנוע את הצלחת הלובשות כאשר מכינים את תערובת התגובה.
  5. לבצע את כל התגובות triplicates.
  6. לבצע את התגובה PCR על thermocycler הגדרה זו המופיעים בטבלה 5.
  7. לחשב את הערך Ct הממוצע עבור כל מתגובות triplicates. לנרמל את כל הגנים היעד לרמת הביטוי glycerinealdehyde-3-פוספט-דהידרוגנאז (Gapdh) משק הגן על-ידי חישוב 2^(-ΔCt).
    הערה: כל יעד הגנים עם ה-Ct הממוצע > 35 נחשבו המותרת זיהוי.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

כדי לחקות את התוצאות עבור המארח לאחר הכניסה של חיידקים או המוצרים נגזר בקטריאלית המתרחשת לאחר פריצה מכשול המעי, LPS היה מוזרק עכברים C57Bl/6 במנה לא קטלני (משקל הגוף µg/g 2). כל עכבר אחת היה פיקוח, הבקיע עבור המופע של endotoxemia עם הפרמטרים המפורטים בגיליון הציון הכולל, את המראה של העכברים, הפעילות של החיות, התנאי של העיניים, ואת קצב הנשימה איכות (טבלה 1) . החיות הראו סימנים קליניים של מחלה הגיעה לשיאה 6 עד 10 h לאחר ההזרקה של LPS. והחרמתי בתוך 24 שעות (איור 1). עכברים בודדים היו שהקריבה עצמה h 2, 4 שעות ו- 8 שעות לאחר ההזרקה של LPS. חתיכות רקמה נאספו הטחול, הכבד, המעי הגס. RNA היה מבודד מן האיברים האלה, הפוכה עיבד כדי cDNA. CDNA שימש תבנית עבור qPCR כדי לקבוע את רמות הביטוי של Il1b (איור 2B) Il6 (איור 2 א), TNFa (איור 2C) Il10 (איור דו-ממדי) עם תחל המשמש את qPCR ברשימה ' טבלה 6. הביטוי של Il6 הגיעה לשיאה 2 h לאחר ההזרקה הטחול, המעי הגס, וכן 4 שעות לאחר ההזרקה בכבד. הביטוי של Il1b, TNFa, ו- Il10 הגיעה לשיאה 4 שעות לאחר ההזרקה הטחול, הכבד, המעי הגס. בתוך 8 שעות לאחר ההזרקה, הביטוי של Il6, Il1b, TNFa, Il10 חזר לרמה הבסיסית ביותר.

Figure 1
איור 1: הזרקת LPS (משקל הגוף µg/g 2) המושרה סימנים קליניים של endotoxemia ב C57Bl/6mice. לאחר ההזרקה של משקל הגוף µg/g 2 של LPS, עכברים בודדים נוטרו עם התוצאה המחלה הציג 1 טבלה הכוללת את המראה ואת הפעילות של בעלי החיים, פתיחת העיניים שלהם, קצב הנשימה ואיכות שלהם כל שעתיים במשך 12 שעות ו- 24 h aft er הזרקת LPS. התוצאה המחלה (ציר y) נמוג ונעלם לזמן המתאים (ציר x). זאת אומרת ± SD עבור 4-5 עכברים לכל נקודת זמן לכל מוצג. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: הזרקת LPS (משקל הגוף µg/g 2) המניע את הביטוי של ציטוקינים פרו-דלקתיים בעכברים C57Bl/6- עכברים הוזרקו 2 µg/גרם משקל של LPS ואת רמות ביטוי Il6 (א), Il1b (B), Tnfa (ג) ו- Il10 (D) נותחו על ידי qPCR ב הטחול, הכבד, המעי הגס בזמן המצוין נקודות לאחר ההזרקה. רמות ביטוי ציטוקינים כל היו מנורמל כביטוי של Gapdh. זאת אומרת ± SD עבור 4-5 עכברים לכל נקודת זמן לכל מוצג. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

טבלה 1: מחלת גיליון הניקוד יפקח על עכברים C57Bl/6 לאחר הזרקת LPS. פרמטרים המפוקחים לאחר הזרקת LPS. חיות נוטרו כל שעתיים לאחר ההזרקה במשך תקופה של 12 שעות, וניתנה ציונים עבור כל פרמטר בודד המפורטים בטבלה. הציון הסופי עבור כל חיה מייצגת את סכום כל הציונים בודדים. . זהו ממאמרו של הפניה24. אנא לחץ כאן כדי להוריד את הקובץ.

כמות מגיב
µL 2/מדגם 10 x מאגר RT
µL 0.8/מדגם x 25 deoxynucleotide (dNTP) מיקס (100 מ מ)
µL 1/מדגם RT תחל אקראי
µL 4.2/מדגם נוקלאז ללא מים

טבלה 2: ריאגנטים נהגו להכין את תערובת הבסיס עבור שעתוק במהופך.

טמפרטורה זמן
25 ° C 10 דקות
37 ° C 120 דקות
37 ° C 5 דקות
4 ° C . תחזיק

טבלה 3: Thermocycler ההגדרות המשמשות שעתוק במהופך.

כמות מגיב
µL 5/טוב 2 x מיקס מאסטר
µL 0.05/טוב הפניה לצבוע
גמר nM 500/טוב... פריימר לפנים
גמר nM 500/טוב... הפוך פריימר
בין 10 ל- 100 ng/טוב, היינו 40 ng/טוב תבנית cDNA מדולל במאגר דילול תבנית (דילול 1/100 מערכו של מאגר זה היה עשוי במים נטולי נוקלאז ומשמש כדי לדלל את cDNA תבנית). דילול התבנית במאגר הזה מאפשר את החזיית הבארות איפה תבנית נוספת כמו שינויי צבע התגובה מ כחול ירוק
נוקלאז ללא מים לנפח סופי של µL 10/טוב נוקלאז ללא מים

טבלה 4: תיאור של תגובת ה-PCR.

טמפרטורה זמן
95 ° C 2 דקות
95 ° C 5 s מחזורים 40
60 ° C 20 s
95 ° C 15 s התכה עקומת analaysis
60 ° C 1 דקות
95 ° C 15 s

טבלה 5: Thermocycler ההגדרות המשמשות עבור ה-PCR.

פריימר רצף טמפרטורת ההיתוך אורך המוצר
Il6-F TCG איסור פרסום GCT TAA TTA CAC ATG TTC T 60.3 94. לחץ דם
Il10-F ATCGATTTCTCCCCTGTGAA 56.2 108. לחץ דם
Gapdh-F CATCAAGAAGGTGGTGAAGC 56.7 199. לחץ דם

טבלה 6: תחל המשמשים את התגובה qPCR. רצף תחל להשתמש עבור qPCR כדי לזהות העכבר ציטוקינים וג'ין משק Gapdh.

Subscription Required. Please recommend JoVE to your librarian.


or Start trial to access full content. Learn more about your institution’s access to JoVE content here

פרוטוקול זה מחקה אימונולוגי שתהליכים המתרחשים לאחר הפלישה על ידי מוצרים מיקרוביאלית, נגזר. השלבים הקריטיים בתוך הפרוטוקול הם הבחירה של הקו העכבר, המצב היגיינה של העכברים, המינון של LPS, הפיקוח על בעלי החיים עבור המופע של endotoxemia, לבין נקודת זמן של סיום הניסוי. והכי חשוב, הרקע הגנטי של המתח העכבר חייב להילקח בחשבון. העכבר שונים זנים יש רגישות שונה LPS. לדוגמה, C3H/HeJ ו- C57BL/10ScCr עכברים הם עמידים בפני LPS מושרה21,endotoxemia25. יתר על כן, המצב היגיינה של בעלי החיים עשויים להשפיע על מהלך endotoxemia של LPS. ספציפי-פתוגן נטול חיות (SPF) הנפוץ ביותר. אלו עכברים חינם מתוך רשימה מוגדרת של פתוגנים, אך ההרכב microbiota מלאה של בעלי חיים אלה לא ידוע26,27. סטרילי מחיידקים או axenic בעלי חיים (לא הנמל של microbiota) נבדלים SPF עכברים26. סביר להניח, הקולוניזציה של חיות axenic עם מיקרואורגניזם אחד או עם קונסורציום של מיקרואורגניזמים (בעלי חיים gnotobiotic) עשויים להשפיע את הביטוי של גנים, כגון IL-19, לאחר הזרקת LPS לעומת חיות SPF8. יתר על כן, גיליון הניקוד הוצע כי שימש גיליון הניקוד עבור מודל אלח דם הנגרם על ידי הזרקת הפתרון צואה לתוך חלל הצפק24. Sheetcan זו לדון בכך עם הוועדה המקומית רווחת בעלי חיים, שעשוי להיות מותאם לצרכים מקומיים. בפרט, הקריטריונים עבור סיום צריך לדון עם הוועדה המקומית רווחת בעלי חיים. ניסוי זה צריך להיעצר כאשר הציון > 12 מושגת או כאשר הציון המרבי עבור פרמטר בודד אחד. בניסוי זה, אף חיה חיות שמונה חריגה ציון המחלה של 12 לאחר הזרקת LPS (משקל הגוף µg 2/g). במחקר זה, תוצאות מציג את הביטוי של ציטוקינים Il6, Il1b, TNFa , Il10 הכבד, הטחול והמעי הגס לאחר הזרקת LPS מוצגים. הביטוי של Il1b, TNFa ו- Il10 הגיעה לשיאה 4 שעות לאחר הזרקת LPS הטחול, הכבד, המעי הגס, ואילו, Il6 ביטוי הגיעה לשיאה 2 h לאחר הזרקת LPS ב הטחול והמעי הגס ו- 4 שעות לאחר הזרקת LPS בכבד. בתוך 8 שעות הביטוי Il6, Il1b, TNFa ו- Il10 חזר רמות הבסיס הטחול, הכבד, המעי הגס. חומרת המחלה הגיעה לשיאה בין 6-אייץ ' ו- 10 h לאחר הזרקת LPS כאשר הביטוי Il6, Il1b, TNFa , Il10 חזרו כבר את רמות בסיסית המציין כי גדל ביטוי Il6, Il1b, TNFa ו- Il10 מתרחשת במהירות לאחר הזרקת LPS, אבל זה קינטיקה של גנים אחרים עשויים להראות דפוס שונה לאחר הזרקת LPS. הביטוי של ציטוקינים אלה יכול גם להיות מנותח על רמת החלבון בדם של החיות מאת אליסה, אשר יכול להיחשב בנוסף qPCR.

שינויים ופתרון בעיות של הטכניקה נחוצים במקרים כאשר המחלה ציון > 12 מתמלאת. לכן, המינון של LPS צריך להיות מופחת יותר מותאמים הקו בשימוש בעכבר, התנאים המקומיים כדי למנוע סיום מוקדם של הניסוי. המניפולציה של גנים על-ידי מחיקת אזור גנומית נתון או overexpressing גנים עשויים להשפיע הרגישות של עכברים LPS. בניסויים ראשוניים, המינון של LPS עשוי להיות טיטרציה המינון המתאים כדי למנוע פגיעה מיותרת ומוות לבעלי בניסוי זה. ראוי לציין, זיהום של LPS עם בקטריאלי-derived ומוצרים אחרים זריקות שגויה צריך להמנע. יתר על כן, קינטיקה של הביטוי של הגנים של עניין לאחר הזרקת LPS צריך להיקבע.

המגבלות הן כי טכניקה זו מספקת מידע על ההשלכות של הפצת מוצרים מיקרוביאלית לתוך המחשב המארח לאחר פריצה מכשול המעי אבל לא ימסור מידע על אירועים שיובילו פרצה מחסום המעי, גורם על ההדק מחלת המעי הדלקתי. כמובן, מודל זה היא לא דוגמנית קוליטיס כמודל קוליטיס DSS, אבל זה יכול להיות שימושי בנוסף קוליטיס מודלים ללמוד התוצאה של הכניסה של מוצרים מיקרוביאלית לתוך המחשב המארח. יתר על כן, הזרקה i.p. של LPS ישבש חלל הצפק, בה הקטן ואת המעי הגס נמצאות. זה עשוי להקל רוברטסונית של מוצרים חיידקי מעיים, נגזר מן חלל הצפק אל המחשב המארח.

המשמעות של מודל זה היא העובדה שהיא משתמשת PAMP מוגדר. במודלים אחרים כולל הזרקה i.p. של חיידקים כולו, הזרקה i.p. של פתרונות צואה24 או הדגמים דלקת הצפק זיהומית, שבו דלקת הצפק הנגרמת על ידי cecal מצדו, ניקוב28, מגוון רחב של חיידקים או שלהם מוצרים גורם המחלה. יתר על כן, הזרקת LPS לתוך עכברים היא גישה מסובכת, לא דורשת ניתוח כמו דלקת הצפק זיהומית הנגרמת על ידי מצדו cecal ו לנקב.

יישום נוסף של מודל זה הם מחקרים שמטרתם לחקור endotoxemia או ספטיסמיה LPS מושרה כל ההקשרים מאופיין רוברטסונית המוצרים נגזר חיידקים לתוך המחשב המארח, כגון הפרת מחסום העור או הפר של דלקת בדרכי השתן. לסיכום, זהו מודל פשוט יכול לשמש בסביבה כל מעבדה. בהתאם לתנאים המקומיים, אולי יש עיבודים צריך הצרכים המקומיים. בפרט, הגיליון הציון יש לדון עם הרשויות המקומיות לפני ביצוע הניסוי. בגישה זו נעשה שימוש כדי לחקות את התוצאות עבור המארח כאשר חיידקים או המוצרים נגזר בקטריאלי מזין את המחשב המארח לאחר פריצת מחסום. זה עשוי להיות בפרט הרלוונטיים במחקרים בחינת הבסיס של מחלת המעי הדלקתי איפה המופע של הפרה מכשול המעי אירוע נפוץ ב הפתולוגיה של המחלה.

Subscription Required. Please recommend JoVE to your librarian.


המחברים אין לחשוף.


JHN נתמך על ידי הקרן הלאומית השוויצרית (SNSF 310030_146290).


Name Company Catalog Number Comments
DreamTaq Green PCR Master Mix (2x) Thermo Fisher Scientific, Waltham, MA, USA K1081
High Capacity cDNA Reverse Transcription Kit, Applied Biosystems, Foster City, CA, USA 4368813
RNase-Free DNase Set, Qiagen, Hilden, Germany 79254
LPS Escherichia coli O111:B4 Invivogen, San Diego, CA, USA. tlrl-eblps
Omnican 50 Single-use insulin syringe B. Braun Melsungen, Melsungen, Germany 9151125
Bioanalyzer 2100 Agilent Technologie, Santa Clara, USA not applicable
Centrifuge 5430 Eppendorf, Hamburg, Germany not applicable
Centrifuge Mikro 220R Hettich, Kirchlengern, Germany not applicable
Dissection tools Aesculap, Tuttlingen, Germany not applicable
Fast-Prep-24 5G Sample Preparation System M.P. Biomedicals, Santa Ana, CA, USA not applicable
NanoDrop ND-1000 NanoDrop Products, Wilmington, DE, USA not applicable
TRI Reagent Zymo Research, Irvine, CA, USA R2050-1



  1. Backhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. A., Gordon, J. I. Host-bacterial mutualism in the human intestine. Science. 307, 1915-1920 (2005).
  2. Abreu, M. T., et al. Mutations in NOD2 are associated with fibrostenosing disease in patients with Crohn's disease. Gastroenterology. 123, 679-688 (2002).
  3. Liu, Y., et al. Immunocytochemical evidence of Listeria, Escherichia coli, and Streptococcus antigens in Crohn's disease. Gastroenterology. 108, 1396-1404 (1995).
  4. Schaffer, T., et al. Anti-Saccharomyces cerevisiae mannan antibodies (ASCA) of Crohn's patients crossreact with mannan from other yeast strains, and murine ASCA IgM can be experimentally induced with Candida albicans. Inflamm Bowel Dis. 13, 1339-1346 (2007).
  5. Sellon, R. K., et al. Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice. Infect Immun. 66, 5224-5231 (1998).
  6. Gkouskou, K. K., Deligianni, C., Tsatsanis, C., Eliopoulos, A. G. The gut microbiota in mouse models of inflammatory bowel disease. Front Cell Infect Microbiol. 4, 28 (2014).
  7. Schaubeck, M., et al. Dysbiotic gut microbiota causes transmissible Crohn's disease-like ileitis independent of failure in antimicrobial defence. Gut. 65, 225-237 (2016).
  8. Steinert, A., et al. The Stimulation of Macrophages with TLR Ligands Supports Increased IL-19 Expression in Inflammatory Bowel Disease Patients and in Colitis Models. J Immunol. 199, 2570-2584 (2017).
  9. Gabele, E., et al. DSS induced colitis increases portal LPS levels and enhances hepatic inflammation and fibrogenesis in experimental NASH. J Hepatol. 55, 1391-1399 (2011).
  10. Saunders, S. P., et al. C-type lectin SIGN-R1 has a role in experimental colitis and responsiveness to lipopolysaccharide. J Immunol. 184, 2627-2637 (2010).
  11. Spadoni, I., et al. A gut-vascular barrier controls the systemic dissemination of bacteria. Science. 350, 830-834 (2015).
  12. Balmer, M. L., et al. The liver may act as a firewall mediating mutualism between the host and its gut commensal microbiota. Sci Transl Med. 6, 237ra266 (2014).
  13. Maier, R. V., Mathison, J. C., Ulevitch, R. J. Interactions of bacterial lipopolysaccharides with tissue macrophages and plasma lipoproteins. Prog Clin Biol Res. 62, 133-155 (1981).
  14. Lu, Y. C., Yeh, W. C., Ohashi, P. S. LPS/TLR4 signal transduction pathway. Cytokine. 42, 145-151 (2008).
  15. Deng, M., et al. Lipopolysaccharide clearance, bacterial clearance, and systemic inflammatory responses are regulated by cell type-specific functions of TLR4 during sepsis. J Immunol. 190, 5152-5160 (2013).
  16. Kagan, J. C., et al. TRAM couples endocytosis of Toll-like receptor 4 to the induction of interferon-beta. Nat Immunol. 9, 361-368 (2008).
  17. Akira, S., Uematsu, S., Takeuchi, O. Pathogen recognition and innate immunity. Cell. 124, 783-801 (2006).
  18. Cohen, J. The immunopathogenesis of sepsis. Nature. 420, 885-891 (2002).
  19. Suffredini, A. F., et al. Effects of recombinant dimeric TNF receptor on human inflammatory responses following intravenous endotoxin administration. J Immunol. 155, 5038-5045 (1995).
  20. Fink, M. P. Animal models of sepsis. Virulence. 5, 143-153 (2014).
  21. Poltorak, A., et al. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science. 282, 2085-2088 (1998).
  22. Hoshino, K., et al. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J Immunol. 162, 3749-3752 (1999).
  23. Corral, J., et al. Role of lipopolysaccharide and cecal ligation and puncture on blood coagulation and inflammation in sensitive and resistant mice models. Am J Pathol. 166, 1089-1098 (2005).
  24. Shrum, B., et al. A robust scoring system to evaluate sepsis severity in an animal model. BMC Res Notes. 7, 233 (2014).
  25. Brandwein, S. L., et al. Spontaneously colitic C3H/HeJBir mice demonstrate selective antibody reactivity to antigens of the enteric bacterial flora. J Immunol. 159, 44-52 (1997).
  26. Macpherson, A. J., McCoy, K. D. Standardised animal models of host microbial mutualism. Mucosal Immunol. 8, 476-486 (2015).
  27. Masopust, D., Sivula, C. P., Jameson, S. C. Of Mice, Dirty Mice, and Men: Using Mice To Understand Human Immunology. J Immunol. 199, 383-388 (2017).
  28. Wirtz, S., et al. Protection from lethal septic peritonitis by neutralizing the biological function of interleukin 27. J Exp Med. 203, 1875-1881 (2006).


Formal Correction: Erratum: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach
Posted by JoVE Editors on 08/04/2018. Citeable Link.

An erratum was issued for: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach

One of the authors' names was corrected from:

Katarina Raduolovic


Katarina Radulovic

זריקות של ליפופוליסכריד לתוך עכברים לחקות כניסה של מוצרים מיקרוביאלית נגזר לאחר פריצה מכשול המעי
Play Video

Cite this Article

Radulovic, K., Mak’Anyengo, R., Kaya, B., Steinert, A., Niess, J. H. Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach. J. Vis. Exp. (135), e57610, doi:10.3791/57610 (2018).More

Radulovic, K., Mak’Anyengo, R., Kaya, B., Steinert, A., Niess, J. H. Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach. J. Vis. Exp. (135), e57610, doi:10.3791/57610 (2018).

Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter