Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Preparare lo sviluppo di tessuto periferico olfattivo per molecolare e l'analisi di Immunohistochemical in Drosophila

doi: 10.3791/57716 Published: June 13, 2018

Summary

Qui, presentiamo un protocollo per tappa e sezionare lo sviluppo di tessuto olfattivo da specie di Drosophila . Il tessuto dissecato più tardi può essere utilizzato per le analisi molecolari, quali quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) o RNA sequenziamento (RNAseq), così come in vivo analisi quali immunoistochimica o in situ ibridazione.

Abstract

Il sistema olfattivo di Drosophila è un sistema ampiamente usato in neurobiologia inerente allo sviluppo, neuroscienza sistemiche, come pure neurofisiologia, comportamento ed evoluzione del comportamento. Drosophila olfattivi tessuti casa i neuroni olfattivi (ORNs) che rilevano chimici volatili spunti oltre ai neuroni idro-termo-sensoriale. In questo protocollo, descriviamo la dissezione di sviluppare tessuto periferico olfattivo della specie Drosophila adulto. Descriviamo in primo luogo come tappa e larve di Drosophila , seguite da dissezione del disco antennale dalla prime fasi pupal, seguite da dissezione delle antenne da adulti e metà-pupal fasi di età. Mostriamo anche metodi dove preparazioni possono essere utilizzati in tecniche molecolari, come l'estrazione di RNA per qRT-PCR, RNAseq o immunohistochemistry. Questi metodi possono applicarsi anche ad altre specie di Drosophila dopo tempi di sviluppo pupale specie-specifici sono determinati, e rispettivi stadi sono calcolati per invecchiamento appropriato.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Il sistema olfattivo di Drosophila è un sistema ampiamente usato in neurobiologia inerente allo sviluppo, neuroscienza sistemiche, come pure neurofisiologia, studi di comportamento e comportamentali evolution1,2,3, 4. Drosophila olfattivi tessuti casa i neuroni olfattivi (ORNs) che rilevano chimici volatili spunti oltre a idro-termo-sensoriale neuroni1,5,6. L'obiettivo generale di questo manoscritto è quello di dimostrare come tappa e sezionare sviluppando pupa e adulto tessuto olfattivo nella specie di Drosophila . La spiegazione razionale per questa tecnica è quello di generare campioni da diverse fasi pupal per analisi molecolari e dello sviluppo del sistema olfattivo periferico, come RNAseq e RT-PCR quantitativa, in aggiunta al tessuto in vivo tecniche di etichettatura . Questa tecnica può essere particolarmente utile per identificare la dinamica dei profili trascrizionali in sviluppo del sistema olfattivo adulto da specie non -melanogaster della drosofila , che non hanno tutti i reagenti transgenici per cella tipo specifico etichettatura e analisi. In questo manoscritto, dimostriamo come dissezionare antennali dischi e antenne dalla specie di Drosophila pupa e adulto. In primo luogo, vi mostriamo come identificare Drosophila 0 h di formazione pupario (APF, pupe bianche o membranose) per la stadiazione inerente allo sviluppo e invecchiamento specie-specifico. Successivamente, vi mostriamo come dissezionare antennali dischi e il terzo segmento antennale; in particolare, come li dissociare dal disco di occhio e secondo segmento antennale per la purezza di tessuto necessaria per RNAseq o RT-PCR. Le fasi in d. melanogaster descritti nel presente protocollo all'incirca corrispondono al disco antennale pre-modellato (membranose), la selezione dei precursori dalle antenne a disco (8h APF), l'inizio della differenziazione terminale per ORNs (40h APF), e adulto dell'antenna. Infine, diamo esempi per una RT-PCR quantitativa da adulte Antenne isolate utilizzando il metodo e per l'immunoistochimica in vivo . Questo metodo può essere utilizzato per generare i campioni per l'analisi di RNA/DNA e immunohistochemistry sullo sviluppo di tessuti periferici olfattivi da diverse specie di Drosophila .

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Il seguente protocollo è coerenza con le linee guida etica stabilite dal comitato di etica di Duke University Research.

1. preparazione e messa in scena dello sviluppo di Drosophila melanogaster Pupa

  1. In primo luogo, di identificare quante mosche sarà necessarie per la dissezione. Per RT-PCR e RNAseq, raccogliere 100-200 dischi antennali e antenne da individui che sono necessari nelle fasi prepupa, 8h APF, 40h APF e adulto. Per l'immunoistochimica, sezionare individuo 10-20.
  2. Pulire tutti i materiali, compreso la dissezione pastiglie e pinze, utilizzando salviette con 70% EtOH. Se il materiale sezionato è per essere utilizzato per l'estrazione di RNA, pulire il tutto con neutralizzatori di RNAsi e fare tutte le soluzioni utilizzando uno privo di nucleasi o acqua trattata pirocarbonato dietilico (DEPC).
    Nota: Questo protocollo utilizza cuscinetti di dissezione del silicone al posto del vetro per le dissezioni. Cuscinetti in silicone sono amichevoli per forcipe ultra-fine e promuovono le dissezioni veloce e di alta qualità.
  3. Raccogliere la pupa al 0 h fase APF/prepupa.
    1. Per garantire la messa in scena più preciso, monitorare le larve a 30 min a intervalli di 1 h.
      Nota: Errante terzo instar larve in una bottiglia moderatamente affollata saranno probabilmente pupate entro poche ore.
    2. Una volta che le larve diventano immobile e sono circondate da un caso pupal colorato (quasi bianco) molto leggero, trasferirli in una piccola 2 - nella capsula di Petri con un filtro di carta umida.
    3. Continuare per 1-2 h, occasionalmente monitoraggio, identificazione e trasferimento membranose.
      Nota: In alternativa, deselezionare una bottiglia di tutte le pupe e permettere alle larve di sviluppare per 2 h. Tutte le pupe raccolti dopo 2 h sarà all'interno di una gamma APF 0 - 2 h.
  4. Immediatamente passare alla fase 3.1 dissezionare il disco antennale prepupa per la fase APF 0 h. Se la prepupa deve essere invecchiato, raccoglierle in un piatto, coprire il piatto e posizionare una pellicola di paraffina intorno ai bordi per inibire la secchezza e porre la capsula di Petri a 25 ° C.
    Nota: Le pupe possono ora essere invecchiate di sfarfallamento.
  5. Per pupe raccolti in un intervallo di 2 h, invecchi membranose per 2 h a meno che l'età desiderata al fine di garantire che le pupe non eccedenza.
  6. Utilizzare pinze ultrafine (Dumont 55) come il tessuto è molto piccolo e fragile.

2. preparazione e messa in scena dello sviluppo di Pupa da altre specie di Drosophila

  1. Per determinare la lunghezza dello sviluppo pupa in altre specie di Drosophila , posizionare i campioni ad una temperatura ottimale, registrare le date quando si osservano membranose, ordinarli in una fiala di fresca e registrare il numero di giorni da prepupa fino all'età adulta.
  2. Registrare il rapporto tra tempo per sviluppo pupa per specie non -melanogaster e per melanogaster. Moltiplicare il rapporto tra il tempo dello sviluppo per il numero di ore impiegate per la stadiazione melanogaster per ottenere il numero di ore per le specie non -melanogaster di età.

3. dissezione di d. melanogaster Pupal antennali disco

Nota: Tutti i tempi di invecchiamento e protocolli di dissezione sono descritti per Drosophila melanogaster. Per tutte le altre specie, una modifica del protocollo invecchiamento basato su punti specifici della specie tempo inerente allo sviluppo sarà richiesta, come descritto in precedenza.

  1. Per le dissezioni pupal disco antennali, raccogliere 50-100 0 - 2 h o pupe vecchio 6-8 h con una spatola e metterli su un pad di dissezione.
  2. Dispensare 150 µ l di soluzione di isolamento di RNA in una RNasi gratuito 1,5 mL microfuge utilizzando una pipetta 200-µ l del tubo e posizionare il tubo sul ghiaccio.
  3. Sezionare le pupe in 150-200 µ l di PBS 1X (tampone fosfato salino, nucleasi-free). Collocare le goccioline più di PBS (150-200 µ l per goccia) sul tappetino di dissezione.
  4. Sul pad di dissezione, collocare il 0 - h 2 o 6-8 h invecchiato pupe (una pupa per goccia) per essere sezionata in una delle goccioline di PBS 1X. Utilizzare pinze in una mano per stabilizzare il corpo.
  5. Per lo 0 - 2 h invecchiato pupe, utilizzando forcipe in altra mano, tenere premuto per la parte più anteriore (i ganci di bocca) della prepupa e tirarlo fuori per esporre i cervelli e i dischi immaginali allegati al caso pupal anteriore.
  6. Per le pupe APF 8h, prima di staccare delicatamente il caso pupal dal quartiere più anteriore della pupa, esponendo la testa all'interno del sacco di membrana che circonda il corpo.
    Nota: Il corpo, in questa fase, si presenta come una larva di degenerazione.
  7. Rimuovere la testina al giunto del collo.
    Nota: Questo assicura che i dischi antennali non andranno persi, che in questa fase sono connessi principalmente ai lobi ottica del cervello.
  8. Trasferire il tessuto con il cervello e i dischi immaginali 1x un'altra goccia di PBS utilizzando forcipe o una pipetta 20-µ l.
  9. Identificare il disco occhio-antennali collegato al cervello presso i lobi ottici. Usando il forcipe, scollegare il disco occhio-antennali dal cervello e il caso pupal. Trasferirlo in un nuovo 1 x gocciolina di PBS utilizzando forcipe o una pipetta 20-µ l.
    Nota: Il disco di occhio-antennali prepupa è un tessuto piatto. Tuttavia, dalle pupe di 8 h, i dischi di occhio sono ruotati foggiare a coppa i dischi antennali, che siede anteriore al cervello centrale.
  10. Utilizzando forcipe, tagliare il tessuto al luogo di connessione tra l'occhio e il disco antennale. Utilizzare una pipetta 20-µ l per trasferire delicatamente il tessuto dissecato nel reagente di soluzione di isolamento del RNA. Ridurre al minimo la quantità di liquido trasferito pipettando una quantità più piccola possibile.
  11. Ripetere fino a quando tutte le pupe sono stati sezionati.

4. dissezione di d. melanogaster Mid-pupa e adulto antenne

Nota: Da 40 h APF, la maggior parte della metamorfosi è completa, e le strutture adulte sono sempre evidenti, ma sono ancora bianche e indefinibile. A questo punto del tempo inerente allo sviluppo, l'antenna adulto ha preso la sua forma definitiva ma è ancora trasparente e la maggior parte dei recettori olfattivi, tranne per pochi, non hanno iniziato l'espressione.

  1. Per le dissezioni antennali pupale, raccogliere 50-100 membranose come descritto nel passaggio 1 e loro età per 40 h a 25 ° C.
  2. Dispensare 150 µ l di soluzione di isolamento di RNA in una RNasi free 1,5 mL microcentrifuga utilizzando una pipetta da 200-µ l del tubo e posizionare il tubo sul ghiaccio.
  3. Sul pad di dissezione, collocare la pupa per essere sezionato in una delle goccioline di PBS 1X. Utilizzare pinze in una mano per stabilizzare il corpo. Utilizzando forcipe in altra mano, togliere delicatamente il caso pupal dal quartiere più anteriore della pupa, esponendo la testa all'interno del sacco di membrana che circonda il corpo.
  4. Usando il forcipe, accuratamente tagliato fuori la testa dal resto del corpo pupal tenendo il corpo con un set di pinze e strappando la testa al collo congiunta con un altro set di pinze. Trasferire delicatamente la testa in un altro 1 x gocciolina di PBS usando il forcipe. Pipettare su e giù per pulire il contenuto della testa (il cervello, ecc.) per ottenere una membrana libera che utilizzate per circondare la testa di Drosophila in via di sviluppo.
    Nota: Al 40-50 h APF, le antenne sono collegate alla sezione anteriore-la maggior parte della membrana. Essi diventeranno apparenti per dissezione quando il contenuto della testa vengono cancellati con il pipettaggio.
  5. Usando il forcipe, scollegare le antenne pupale dalla membrana. Scollegare il segmento 2nd dell'antenna dal 3rd usando il forcipe per fetta al giunto segmentale, come solo il segmento 3rd ospiterà i neuroni recettori olfattivi.
  6. Utilizzare una pipetta 20-µ l per trasferire delicatamente il tessuto dissecato nel reagente di soluzione di isolamento del RNA. Ridurre al minimo la quantità di liquido trasferito pipettando una quantità più piccola possibile. Ripetere fino a quando tutte le pupe sono stati sezionati.
  7. Per adulte dissezioni antennali, raccogliere circa 50 adulti e loro età per un post-eclosion settimana.
    Nota: L'espressione di geni per recettori olfattivi e altri geni picco una settimana dopo eclosion. Gli adulti sono invecchiati per una settimana garantire biologicamente rilevanti geni con le trascrizioni di abbondanza bassa elevarsi di sopra della soglia di rilevamento.
  8. Per estrazione di RNA, sezionare mosche mentre sono ancora vivi su un pad di CO2 . Trattare il CO2 pad con inibitori della RNAsi. Per formazione immagine confocal, sezionare le mosche su un pad di dissezione in 1X PBS o PBS + 0,2% Triton.
  9. In primo luogo, mettere gli adulti a dormire sul pad CO2 stazione nell'ambito di dissezione. Sul pad CO2 stazione, utilizzando forcipe in una mano per stabilizzare il corpo, utilizzare pinze in altra mano per delicatamente tirare/pizzico fuori il terzo segmento antennale dal secondo.
  10. Trasferire le antenne in una soluzione di isolamento del RNA, usando pinze per posizionare le antenne direttamente nel liquido. Ripetere fino a quando tutti gli adulti sono stati sezionati.
    Nota: Assicurarsi che le antenne sono immersa in soluzione di isolamento del RNA. Le antenne possono diventare bloccate sul lato del tubo. Questo causerà un'aumentata degradazione del RNA, riducendo la quantità e la qualità di RNA.
  11. Direttamente procedere all'estrazione di RNA o posizionare il tubo a-80 ° C per la conservazione a lungo termine.

5. isolamento RNA da tessuti dissecati

  1. Rimuovere tutti i campioni dall'archiviazione di-80 ° C e li scongelare su ghiaccio.
  2. Brevemente spin (5-6 s, ~ 6.000 x g) ogni campione per raccogliere il materiale nella parte inferiore del tubo.
  3. Macinare ciascun campione utilizzando un motore elettrico e un pestello di plastica sterilizzati nell'autoclave per 10 s sul ghiaccio.
  4. Ripetere i passaggi da 5.2 e 5,3 4.
  5. Eseguire l'estrazione di RNA usando i kit disponibili in commercio e seguendo protocolli del produttore per una resa ottimale.
  6. Eseguire qRT-PCR utilizzando reattivi disponibili in commercio e primers specifici contro geni di interesse e seguendo protocolli del produttore.
    1. Svolgere tutte le reazioni di PCR utilizzando le seguenti condizioni: denaturazione di 95 ° C per 10 min seguiti da 40 cicli di 95 ° C per 15 s, 55 ° C per 30 s e 60 ° C per 30 s.
      Nota: Coppie di Primer per geni DIP e dpr sono elencate nella tabella 1, e gli iniettori per geni per recettori olfattivi sono elencati in Hueston CE et al. 8.

6. fissaggio dei dischi antennali Pupal e antenne per immunoistochimica

Nota: Fissare i tessuti in lotti da 10-20 individui affinché che i tessuti sono stati corretti per la stessa quantità di tempo. Ridurre al minimo la quantità di tempo che i campioni soggiorno in PBT (PBS con detergente) prima di trasferirli ad un fissativo per massimizzare l'integrità dei tessuti.

  1. Raccogliere il dissecata dischi antennali o pupale antenne in un tubo PCR 200-µ l contenente 200 µ l di 0,2% PBT sul ghiaccio per mantenere l'integrità del tessuto e per evitare il campione di attaccarsi alla parete della PCR 200-µ l tubi che porterà ad una fissazione incompleta.
    Nota: Antenne Pupal e antennali dischi possono essere difficile da vedere come sono abbastanza traslucidi. Si consiglia di utilizzare un ambito di dissezione per tutti i passaggi del lavaggio per evitare qualsiasi perdita del tessuto. In alternativa, piastre da 96 pozzetti Terasaki possono essere usato per la fissazione e colorazione per monitorare meglio il tessuto.
  2. Fissare il disco di antennale dissecata antennali campioni da pupe in circa 200 µ l di 4% PFA (paraformaldeide) per 30 min a temperatura ambiente. Per questo e i successivi passaggi, mantenere le provette con i campioni su un nutator per miscelare correttamente i campioni nella soluzione. Progressi al punto 6.7.
  3. Per l'antenna adulto, sezionare l'intera testa prima e risolvere il problema in circa 200 µ l di 4% PFA (paraformaldeide) per 1 h a temperatura ambiente.
  4. Lavare 3 volte con 200 µ l di 0,2% PBT per 10 minuti ciascuno. Mantenere i campioni sul nutator durante l'incubazione.
  5. Torna al microscopio di dissezione per una dissezione più fine del secondo segmento antennale dalle teste fisse. Usando pinze per stabilizzare la testa, delicatamente tirare/pizzico fuori il terzo segmento antennale dal secondo.
  6. Trasferire i segmenti antennali terzi dissecati in circa 200 µ l di 4% PFA (paraformaldeide) e fissarle per 30 min a temperatura ambiente.
  7. Lavare 3 volte con 200 µ l di 0,2% PBT per 10 minuti ciascuno. Mantenere i campioni sul nutator durante l'incubazione.
  8. Conservare i campioni a 4 ° C o continuare direttamente con intero Monte immunohistochemistry.
    Nota: L'efficienza di macchiatura potrebbe cambiare quando viene utilizzato l'anticorpo. Questo metodo dovrebbe essere appropriati per meno Tag proteina abbondante o più deboli di anticorpi. Tuttavia, a volte, potrebbe richiedere un'ottimizzazione del protocollo (identità o quantità di fissativo o il tempo di fissazione).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Il dissecata tessuto olfattivo in via di sviluppo può essere utilizzato per l'estrazione di RNA seguita da RT-PCR per valutare l'espressione genica o può essere preso attraverso protocolli di immunohistochemistry per determinare il modello di espressione e la localizzazione sub-cellulare dei geni di interesse. In questa sezione vi presentiamo i risultati rappresentativi da entrambi i protocolli. Figura 1 è la rappresentante RT-PCR quantitativa mostrando la trascrizione del recettore di superficie delle cellule e geni del recettore olfattivo nel selvaggio-tipo adulte antenne. La figura 2 Mostra il 6-8 h e 12 h APF antennali disco stainings su Rn-EGFP transgenici Vola utilizzando anti-GFP (1: 1000) e anticorpi anti-Liuzzi (1: 100) (Figura 2A e 2B). RN-EGFP etichette particolari regioni all'interno del disco antennale durante le fasi di pupal iniziali. Mostriamo anche 40h APF macchiatura dell'anticorpo anti-GFP antennali pupal di mosche transgenici Or67d-GAL4 UAS-CD8GFP e macchiatura dell'anticorpo adulto antennali anti-elav (1: 100) di ORNs (Figura 2). Altri esempi possono essere trovati anche nella letteratura7,8,9,10.

Figure 1
Figura 1 . RT-PCR quantitativa da campioni di RNA antennali adulti di selvaggio-tipo per geni differenti. Questi pannelli mostrano risultati di RT-PCR quantitativi per (A) DIP-alfa, DIP-eta, kug, dpr5, dpr8, beatIIIb (per primer coppie Vedi tabella 1) e (B) olfattivo e recettori ionotropici (o / Ir) geni da adulto campioni di RNA antennali. Le barre di errore indicano un errore standard della media (SEM). O / Ir geni sono abbondanza bassa RNAs che ancora possono essere rilevati mediante qRT-PCR. L'espressione di ogni gene è stata analizzata in triplicato. I valori CT sono stati utilizzati per calcolare i fattori di diluizione per ogni gene basato su curve standard create per ciascun gene. I fattori di diluizione sono stati poi normalizzati per ogni gene all'espressione media di tutti i geni misurata come descritto prima delle8. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2 . Immunoistochimica utilizzando anticorpi differenti sullo sviluppo di tessuti olfattivi. Questi pannelli mostrano anti-GFP (green) e anti-Liuzzi (rosso) anticorpo stainings su (A) 6 h APF pupal antennali dischi e (B) dischi antennali pupal APF di 12 h. (C), questo pannello mostra un h 40 APF antenna da Or67d GAL4 UAS-CD8GFP transgenetica macchiato con coniglio gli anticorpi anti-GFP (green). (D) questo pannello mostra le antenne adulte macchiate con gli anticorpi anti-CD2, quale etichetta Or47b-CD2 positivi ORNs (magenta). Clicca qui per visualizzare una versione più grande di questa figura.

Forward primer Reverse primer Lunghezza
CGGAGAGGAGGTTATGAGCA GGAAGTGCACAACTAGCGTT 143
CGCGAATCGTTGTGTCAGTA TGTCGATAGCGTGAACCTGA 129
AGGAGTGGACGTTGAGTTACA CAATCATGTCCTCGTGACCG 146
TAGAGTCCGAGCAGCAGATG GTCAGAATTCGAGTTGTCCGC 104
GGCGCTAAGTAGCAGGACG GGCCAAGTCTGTTTGTGAGG 215
TAAGACCCTAGCGCCCTCTT AGGGAGATGCGCTTTGAGAC 129

Tabella 1. Elenco degli iniettori PCR utilizzata in qRT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Questo protocollo è una risorsa utile per i laboratori interessati a individuare i programmi genetici e trascrizionali operanti nello sviluppo di tessuto olfattivo Drosophila , nonché un'analisi comparativa di questi programmi in Drosophila specie. È particolarmente utile se il livello dei sistemi profili trascrizionali da diversi stadi di sviluppo sono necessari come primer per gli studi futuri. Il protocollo descritto qui di seguito viene illustrato come tappa e isolare lo sviluppo di tessuto olfattivo da Drosophila per ottenere campioni da quattro fasi chiave dello sviluppo del sistema olfattivo da pre-patterning di differenziazione terminale, da utilizzarsi in immunitario-istologica e molecolari studi. Dissecato Drosophila dischi antennali e antenne in diverse fasi pupal possono essere utilizzate per identificare profili di espressione genica durante lo sviluppo del sistema olfattivo a livello di sistemi di RNA-seq, o a livello di singoli geni mediante RT-PCR quantitativa. Campioni utilizzabile anche per l'ibridazione immunohistochemistry ed in situ per identificare i modelli in vivo dell'espressione genica tessuto-specifica. Un ulteriore vantaggio di questo protocollo è che può essere ulteriormente campioni sezionati dissociata usando i metodi standard e FAC-ordinati per ottenere una popolazione cellulare purificata (o singole cellule) per analisi molecolari specifici del tipo di cella, ad esempio quantitativa RT-PCR o RNAseq.

Anche se il protocollo dimostra le dissezioni di dischi antennali e antenne dalla pupa (a 0 h/prepupa, 8 h e 40 h APF) e stadi adulti, può essere adattato ad altri punti di tempo pupal. Vale anche la pena ricordare che queste dissezioni di apprendimento richiede tempo e pratica. Un esperto dovrebbe essere in grado di sezionare 50 campioni di un'ora. È importante non eccedenti le pupe. Pertanto, un'ora prima di iniziare la dissezione, assicurarsi che nessun pupe sono più vecchi dell'età desiderata. Le dissezioni possono prendere tempo per imparare, quindi un periodo di pratica per ogni fase è necessario prima di iniziare gli esperimenti. Le dissezioni diventano più difficili da 9-12 h, APF, a causa di cambiamenti morfologici. È possibile ordinare le pupe di età al momento del ritiro membranose (di colore del corpo, con colori più scuri, essendo più vecchio). Inizialmente l'ordinamento membranose consente di dissezione in ordine di età per prevenire l'invecchiamento.

Il protocollo descritto in precedenza può essere applicato ad altre specie di Drosophila . La tempistica per le dissezioni pupale di altre specie possa essere basata sia sul rapporto di sviluppo pupa di una data specie a 25 ° C a d. melanogaster e su osservazioni comparative antenne/antennali disco morfologia durante le dissezioni, con un priorità data alle considerazioni morfologiche di essere quanto più possibile identico. Per Drosophila melanogaster, stadio pupale dura circa 4 giorni. D. sechellia e d. erecta pupal stadiazione inerente allo sviluppo è simile a d. melanogaster; Tuttavia, d. virilis pupal sviluppo è 1.3 x più11,12. Quando altre specie sono preparata per la dissezione, la messa in scena dovrebbe basarsi su entrambi i tempi del periodo pupa e osservazioni comparative, fase-specifici antenne/antennali disco morfologia con la somiglianza morfologica è la priorità più alta. In primo luogo, identificare l'ottimale gestione di temperatura per le specie che vi interessa. Molte specie crescono bene a 25 ° C, ma informazioni dettagliate sulle condizioni di manutenzione possono essere ottenute dal centro stock UC San Diego drosofila specie.

I passaggi più critici nel protocollo sono la stadiazione corretta e la corretta dissezione del tessuto di interesse in numero adeguato da specie diverse. Una volta che questi sono in vigore, il protocollo fornisce un metodo efficiente di raccolta del tessuto per tali analisi e adattabile praticamente a qualsiasi sviluppo tessuto immaginale disco durante le fasi di pupale in qualsiasi specie di Drosophila .

Una limitazione di questo protocollo è che non fornisce campioni specifici del tipo di cellule. Una comprensione più dettagliata della morfologia e funzione cellulare richiede cellula specifica del tipo di profilatura della trascrizione a livello di sistemi, oltre a procedure standard molecolare come RT-PCR quantitativa o immunohistochemistry. Profilatura specifici del tipo di cella è stato difficile, soprattutto data la mancanza di cella reporter di tipo-specific transgenetica in specie non -melanogaster . Con gli avanzamenti correnti nella profilatura cellulare, transgenetica e CRISPR-Cas9 mediato l'editing genomico in specie non -melanogaster , è ora possibile aggiungere etichette e capire singole cellule di interesse per il profilo di trascrizione13.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla a rivelare.

Acknowledgments

Questo studio è stato sostenuto da una sovvenzione della National Science Foundation di Pelin C. Volkan (DEB-1457690).

Materials

Name Company Catalog Number Comments
10X Phosphate-buffered Saline Gibco 70011-044 Dilute to 1X in RNase free water
CO2 tank Air Gas CD R200
Two sharp forceps (Dumont #55) Fine Science Tools 11255-20
Trizol Invitrogen 15596-026 RNA isolation solutions
Dissecting Microscope
Small bucket with ice
P20 and P200 micropipettes and tips
1.7 mL Microfuge tubes Purchase nuclease free for best results
0.2 mL PCR tubes
Paraformaldehyde powder Polysciences 380
10% Triton X-100 Teknova T1105 Dilute to 0.2% v/v in 1X PBS
2" petri dishes
55mm filter paper Whatman 1001-055 Wet with water and place in a petri dish to keep pupae moist
25 C incubator
deionized H2O Purchase nuclease free or treat with DEPC
Sylgard 184 Silicone Elastomer Kit Dow Corning to be used for making dissection pads from Terizaki plate covers.
MicroWell Mini Trays with lids Nunc 438733 Lids can be used to make silicone dissection pads
Rabbit anti-GFP antibody MBL international corpor PM005 primary antibody
Mouse anti RAT CD2 AbD seroTec MCA154RHDL primary antibody
ADL195 (anti lamin, mouse) Dev studies hydoma ban ADL195-s primary antibody
Alexa Fluor® 488 goat anti-rabbit IgG (H+L) invitrogen A11008 Secondary antibody
Cy3 Goat Anti-Mouse IgG Jackson ImmunoResearch 115-166-003 Secondary antibody
Triton X-100, Protein Grade Detergent, 10% Solution, Sterile-Filtered CALBIOCHEM 648463 detergent
Lab Rotator Thermo scientific Rotator
Nuclease Free Water Growcells.com NUPW-0125 Water
Light-Duty Tissue Wipers VWR 82003-822 For cleaning dissection supplies
Superscript II invitrogen 18064014 Reverse Transcriptase 
QIAshredder (50) RNA extraction QIAGEN 79654
Oligo(dT)12-18 Primer RT life technologies 18418012
RNeasy MinElute Cleanup Kit (50) RNA extraction QIAGEN 74204
FASTSTART UNIV SG MASTER (5 ML)(500 RXN) qPCR Roche 04913850001
FASTSTART ESSENTIAL GREEN DNA MASTER  qPCR Roche 06402712001
LIGHTCYCLER 480 - MULTIWELL PLATE 96 qPCR Roche 04729692001
NEBNext High-Fidelity 2X PCR Master Mix qPCR NEB M0541S

DOWNLOAD MATERIALS LIST

References

  1. Barish, S., Volkan, P. C. Mechanisms of olfactory receptor neuron specification in Drosophila. Wiley Interdisciplinary Reviews. Developmental Biology. 4, (6), 609-621 (2015).
  2. Pan, J. W., Volkan, P. C. Mechanisms of development and evolution of the insect olfactory system. Cell and Developmental Biology. 2, 130 (2013).
  3. Ramdya, P., Benton, R. Evolving olfactory systems on the fly. Trends in Genetics. 26, (7), 307-316 (2010).
  4. Bellen, H. J., Tong, C., Tsuda, H. 100 years of Drosophila research and its impact on vertebrate neuroscience: a history lesson for the future. Nature Reviews Neuroscience. 11, (7), 514-522 (2010).
  5. Knecht, Z. A., et al. Distinct combinations of variant ionotropic glutamate receptors mediate thermosensation and hygrosensation in Drosophila. eLife. 5, 44-60 (2016).
  6. Enjin, A., et al. Humidity sensing in Drosophila. Current Biology. 26, (10), 1352-1358 (2016).
  7. Li, Q., Barish, S., Okuwa, S., Volkan, P. C. Examination of endogenous rotund expression and function in developing Drosophila. olfactory system using CRISPR-Cas9-mediated protein tagging. G3: Genes|Genomes|Genetics. 5, (12), 2809-2816 (2015).
  8. Hueston, C. E., et al. Chromatin modulatory proteins and olfactory receptor signaling in the refinement and maintenance of fruitless expression in olfactory receptor neurons. PLoS Biology. 14, (4), 1002443 (2016).
  9. Li, Q., et al. Combinatorial rules of precursor specification underlying olfactory neuron diversity. Current Biology. 23, (24), 2481-2490 (2013).
  10. Li, Q., et al. A functionally conserved gene regulatory network module governing olfactory neuron diversity. PLoS Genetics. 12, (1), 1005780 (2016).
  11. Pan, J. W., et al. Patterns of transcriptional parallelism and variation in the developing olfactory system of Drosophila species. Scientific Reports. 7, (1), 8804 (2017).
  12. Pan, J. W., et al. Comparative analysis of behavioral and transcriptional variation underlying CO2 sensory neuron function and development in Drosophila. Fly. 11, (4), 239-252 (2017).
  13. Stern, D. L., et al. Genetic and transgenic reagents for Drosophila simulans, D. mauritiana, D. yakuba, D. santomea, and D. virilis. G3: Genes|Genomes|Genetics. 7, (4), 1339-1347 (2017).
Preparare lo sviluppo di tessuto periferico olfattivo per molecolare e l'analisi di Immunohistochemical in <em>Drosophila</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).More

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter