Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Voorbereiding van de ontwikkeling van de perifere olfactorische weefsel voor moleculaire en analyse van Immunohistochemical in Drosophila

doi: 10.3791/57716 Published: June 13, 2018

Summary

Hier presenteren we een protocol om te stagen en ontleden olfactorische weefsel van Drosophila diersoorten te ontwikkelen. Het ontleed weefsel kan later worden gebruikt voor moleculaire analyses, zoals kwantitatieve RT-PCR (Reverse transcriptie-Polymerase Chain Reaction) of RNA sequencing (RNAseq), evenals in vivo analyses uitgevoerd, zoals immunohistochemistry of in situ hybridisatie.

Abstract

De olfactorische systeem van Drosophila is een veelgebruikt systeem in developmental neurobiologie, systemen neurowetenschappen, evenals neurofysiologie, gedrag en gedrags evolutie. Drosophila olfactorische weefsels huis de olfactorische receptor neuronen (ORNs), die vluchtige chemische signalen naast hydro - en thermo-sensoriële neuronen detecteren. In dit protocol beschrijven we de dissectie van de ontwikkeling van de perifere olfactorische weefsel van de volwassen Drosophila soorten. Eerst beschrijven we hoe stagen en leeftijd Drosophila larven, gevolgd door de dissectie van de antennal schijf van vroege pop stadia, gevolgd door de dissectie van de antennes van medio-pop podia en volwassenen. We tonen ook methoden waar de voorbereidingen in moleculaire technieken, zoals de RNA extractie voor qRT-PCR, RNAseq of immunohistochemistry kunnen worden gebruikt. Deze methoden kunnen ook worden toegepast op andere soorten Drosophila na soortspecifieke pop ontwikkelingstijd worden bepaald, en de respectieve fasen worden berekend voor passende veroudering.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De olfactorische systeem van Drosophila is een veelgebruikt systeem in developmental neurobiologie, systemen neurowetenschappen, evenals neurofysiologie, gedrag studies en gedrags evolutie1,2,3, 4. Drosophila olfactorische weefsels huis de olfactorische receptor neuronen (ORNs) die vluchtige chemische signalen naast hydro - en thermo-sensorische neuronen1,5,6te detecteren. Het algemene doel van dit manuscript is om aan te tonen hoe te stagen en ontleden ontwikkelen van pop en volwassen olfactorische weefsel in Drosophila soorten. De reden voor deze techniek is het genereren van monsters van verschillende pop stadia voor moleculaire en developmental analyses van de perifere olfactorische systeem, zoals RNAseq en kwantitatieve RT-PCR, daarnaast aan in vivo weefsel labeling technieken . Deze techniek kunnen vooral nuttig zijn om te identificeren dynamiek van transcriptionele profielen in de ontwikkelingslanden volwassen olfactorische systeem van niet -Drosophila melanogaster soorten, die niet over alle transgene reagentia voor celtype specifieke beschikken labelen en analyses. In dit manuscript, laten we zien hoe te ontleden antennal schijven en antennes van pop en volwassen Drosophila diersoorten. Eerst laten we zien hoe te identificeren Drosophila 0 h van de puparium formatie (APF, witte poppen of prepupae) voor ontwikkelingsstoornissen fasering en soortspecifieke veroudering. Vervolgens laten we zien hoe ontleden antennal schijven en het derde antennal segment; in het bijzonder hoe hen te distantiëren van de oog-schijf en tweede antennal segment voor de zuiverheid van de weefsel vereist voor RNAseq of RT-PCRs. De stadia in D. melanogaster beschreven in dit protocol ongeveer overeenkomen met de vooraf gedessineerde antennal schijf (prepupae), de selectie van precursoren van de antennal disc (8 h APF), het begin van de terminal differentiatie voor ORNs (40 h APF), en volwassen antenne. Tot slot geven we voorbeelden voor een kwantitatieve RT-PCR van volwassen antennes geïsoleerd met behulp van de methode, en voor in vivo immunohistochemistry. Deze methode kan worden gebruikt voor het genereren van monsters voor een RNA/DNA-analyse en voor immunohistochemistry op de ontwikkeling van de perifere olfactorische weefsels van verschillende soorten van Drosophila .

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Het volgende protocol is in overeenstemming met de richtsnoeren van de ethiek door het Duke University onderzoek ethisch comité vastgesteld.

1. de weefsels voorbereiding en Developmental enscenering van Drosophila melanogaster Verpopping

  1. Kies eerst hoeveel vliegen nodig zal zijn voor de dissectie. Voor RT-PCR en RNAseq, 100-200 antennal schijven en antennes van individuen die nodig in prepupal, 8 h APF, 40 h APF, en volwassen stadia zijn te verzamelen. Ontleden voor immunohistochemistry, 10-20 individu.
  2. Alle materialen, met inbegrip van hersendissectie pads en pincet, doekjes met 70% reinigen EtOH. Als de ontleed materiaal is om te worden gebruikt voor RNA extracties, schoon alles met RNase neutraliserende en alle oplossingen via nuclease-vrije of diethyl-pyrocarbonate (DEPC) behandeld water.
    Opmerking: Dit protocol maakt gebruik van silicone dissectie pads in plaats van glas voor de ontledingen. Silicone pads zijn vriendelijk voor ultra-fijne pincet en bevorderen van snelle en kwalitatief hoogwaardige dissecties.
  3. Verzamelen Verpopping bij de 0 h APF/prepupal stadium.
    1. Om de meest nauwkeurige tijdelijke, monitor de larven op 30 min tot 1U intervallen.
      Opmerking: Dolende derde instar-larven in een matig overvolle fles zal waarschijnlijk binnen een paar uur verpoppen.
    2. Zodra de larven immobiel en zijn omringd door een erg licht (bijna witte) gekleurde pop geval, ze vervolgens overbrengen naar een kleine 2 - in petrischaal met een vochtig filterpapier.
    3. Blijven voor 1-2 h, af en toe controle, identificatie, en de overdracht van prepupae.
      Opmerking: Als alternatief, duidelijk een fles van alle poppen en laat de larven te ontwikkelen gedurende 2 uur. Alle poppen verzameld na 2U zal binnen een 0 - 2 h APF bereik.
  4. Onmiddellijk naar stap 3.1 verplaatsen om te ontleden de prepupal antennal schijf voor de fase van de APF 0 h. Als de prepupa worden ouder moet, verzamelen ze in een schotel, dekking van de schotel en plaats een paraffine-film rond de randen voor de remming van de droogte en plaats de petrischaal bij 25 ° C.
    Opmerking: De poppen kunnen nu worden leeftijd tot eclosion.
  5. Leeftijd voor poppen verzameld in een 2U-bereik, de prepupae voor minder dan de gewenste leeftijd 2 h om ervoor te zorgen dat de poppen geen overdosering.
  6. Gebruik ultra-fijne pincet (Dumont 55) als het weefsel is zeer klein en kwetsbaar.

2. de weefsels voorbereiding en ontwikkelingsstoornissen enscenering van Verpopping van andere diersoorten Drosophila

  1. Om te bepalen van de lengte van de pop ontwikkeling in andere soorten Drosophila , leg de monsters op de optimale temperatuur, vastleggen van de data wanneer prepupae worden waargenomen, sorteren hen in een verse flesje en registreren het aantal dagen vanaf de prepupa tot volwassenheid.
  2. De verhouding van tijd voor pop ontwikkeling voor niet -melanogaster soorten en melanogasteropnemen. De verhouding van de ontwikkelings tijd door het aantal uren voor de enscenering melanogaster gebruikt zodat het aantal uren tot de leeftijd van de soorten niet -melanogaster vermenigvuldigen.

3. dissectie van D. melanogaster pop Antennal Disc

Opmerking: Alle tijden van de veroudering en dissectie protocollen worden beschreven voor Drosophila melanogaster. Voor alle andere soorten, zal een wijziging van het protocol van de veroudering op basis van de punten van de soortspecifieke ontwikkelings tijd nodig zijn, zoals hierboven beschreven.

  1. Voor pop antennal schijf dissecties, verzamelen van 50-100 0 - 2 h of 6-8 h oude poppen met behulp van een spatel en leg ze op een dissectie pad.
  2. Pipetteer 150 µL van RNA isolatie-oplossing in een RNase gratis 1.5-mL microfuge buis met behulp van een precisiepipet 200-µL en plaats de buis op ijs.
  3. Het ontleden van de poppen in 150-200 µL van 1 x PBS (phosphate buffered saline, nuclease-gratis). Plaats meerdere druppels met PBS (150-200 µL per druppel) op de dissectie-pad.
  4. Op het pad van de dissectie, plaats u de 0 - 2 h of 6-8 h ouder poppen (één Verpopping per druppel) om te worden ontleed in één van de 1 x PBS druppels. Gebruik pincet in de ene hand om het lichaam te stabiliseren.
  5. Voor de 0 - 2 h veroudering van poppen, pincet in de andere hand, houd op met het meest voorste deel (de mond hooks) van de prepupa en het blootstellen van de hersenen en het imaginaire schijven aangesloten op het voorste pop geval uitlichten.
  6. Voor de 8 h APF poppen, eerst zachtjes afschilferen het pop geval vanaf het meest anterior kwartaal voor de verpopping, bloot het hoofd binnen de membraan-zak, die het lichaam omringt.
    Opmerking: Het lichaam, in dit stadium ziet eruit als een degenererende larve.
  7. Verwijder het hoofd op het gewricht van de nek.
    Opmerking: Dit zorgt ervoor dat de antennal schijven zal niet verloren gaan, die in dit stadium zijn aangesloten voornamelijk op de optische kwabben van de hersenen.
  8. Het weefsel met de hersenen en het imaginaire schijven naar een andere 1 x PBS druppel met pincet of een 20-µL pipet overbrengen.
  9. Het identificeren van de oog-antennal schijf aangesloten op de hersenen bij de optische kwabben. Met behulp van Tang, Verbreek de oog-antennal schijf de hersenen en de pop zaak. Overbrengen naar een nieuwe 1 x PBS druppel met pincet of een 20-µL pipet.
    Opmerking: De prepupal oog-antennal disc is een platte weefsel. Echter door de 8 h poppen, worden de oog-schijven geroteerd cupping de antennal schijven, die zit anterior to de centrale hersenen.
  10. Met behulp van Tang, knip het weefsel op de site van de verbinding tussen het oog en de antennal schijf. Een 20-µL pipet zachtjes overdracht van het ontleed weefsel in het RNA reagens voor de oplossing van de isolatie gebruiken Het minimaliseren van de hoeveelheid vloeistof die door een zo klein mogelijk bedrag pipetteren overgedragen.
  11. Herhaal totdat alle poppen hebben is ontleed.

4. dissectie van D. melanogaster medio-pop en volwassen antennes

Opmerking: Door 40 h APF, de meerderheid van de metamorfose is voltooid, en de volwassen structuren zijn steeds herkenbaar, maar zijn nog steeds wit en onopvallend. Op dit punt van de ontwikkelings tijd, de volwassen antenne heeft haar definitieve vorm gekregen maar nog steeds is transparant en de meerderheid van de olfactorische receptoren, met uitzondering van enkelen, expressie niet zijn begonnen.

  1. Voor pop antennal dissecties, verzamelen van 50-100 prepupae zoals beschreven in stap 1 en leeftijd ze voor 40 h bij 25 ° C.
  2. Pipetteer 150 µL van RNA isolatie-oplossing in een RNase gratis 1.5-mL microcentrifuge tube met behulp van een 200-µL pipet en plaats de buis op ijs.
  3. Het pad van de dissectie, plaatst de verpopping te worden ontleed in één van de 1 x PBS druppels. Gebruik pincet in de ene hand om het lichaam te stabiliseren. Zachtjes de pop geval vanaf het meest anterior kwartaal van de verpopping, bloot het hoofd binnen de membraan-zak, die het lichaam omringt met pincet in de andere hand, afschilferen.
  4. Met behulp van Tang, zorgvuldig afgesneden het hoofd van de rest van de pop lichaam door het lichaam met één set pincet en rippen van het hoofd af bij de hals gezamenlijk met een andere set van verlostang. Pipetteer zachtjes het hoofd in een ander 1 x PBS druppel met pincet. Pipetteer omhoog en omlaag om de inhoud van het hoofd (hersenen, etc.) te verkrijgen van een duidelijke membraan dat gebruikt om te omringen het ontwikkelende Drosophila hoofd leeghalen.
    Opmerking: Bij 40-50 h APF, de antennes zijn aangesloten op het anterior-meeste gedeelte van het membraan. Zij zal blijken voor dissectie wanneer de inhoud van het hoofd met pipetteren zijn gewist.
  5. Met behulp van Tang, wordt de pop antennes verbreken door het membraan. De 2nd -segment van de antenne te verbreken van de 3rd met behulp van Tang aan het segment op het segmentale gewricht, zoals alleen de 3rd segment zal het huis van de olfactorische receptor neuronen.
  6. Een 20-µL pipet zachtjes overdracht van het ontleed weefsel in het RNA reagens voor de oplossing van de isolatie gebruiken Het minimaliseren van de hoeveelheid vloeistof die door een zo klein mogelijk bedrag pipetteren overgedragen. Herhaal totdat alle poppen hebben is ontleed.
  7. Voor volwassen antennal dissecties, verzamelen van ongeveer 50 volwassenen en hen voor een week na eclosion leeftijd.
    Opmerking: De expressie van genen die olfactorische receptor en andere genen piek een week na eclosion. De volwassenen zijn leeftijd voor een week om biologisch relevante genen met lage overvloed afschriften te stijgen boven de drempel van detectie.
  8. Ontleden voor RNA extracties, vliegen terwijl ze nog in leven op een CO2 pad. Behandel de CO2 -pad met RNase remmers. Voor confocal imaging, ontleden de vliegen op een pad van de dissectie in 1 x PBS of PBS + 0,2% Triton.
  9. Ten eerste, de volwassenen om te slapen op de CO2 station pad onder het toepassingsgebied van de dissectie plaatsen Op de CO2 station pad, gebruik pincet in de ene hand te stabiliseren van het lichaam, kunt pincet in de andere hand zachtjes trekken/snuifje uit het derde antennal segment van de tweede.
  10. Overdracht van de antennes in een isolatie-oplossing van RNA, gebruik pincet te plaatsen van de antenne rechtstreeks in de vloeistof. Herhaal totdat alle volwassenen hebben is ontleed.
    Opmerking: Zorg ervoor dat de antennes zijn ondergedompeld in RNA isolatie-oplossing. De antennes kunnen worden vast te zitten aan de zijkant van de buis. Hierdoor wordt een verhoogde afbraak van het RNA, vermindering van RNA kwaliteit en kwantiteit.
  11. Direct overgaan tot de RNA extractie of plaats de buis bij-80 ° C voor langdurige opslag.

5. RNA isolatie uit ontleed weefsels

  1. Verwijder alle monsters van de opslag-80 ° C en hen in de ijskast ontdooien.
  2. Kort draaien (5-6 s, ~ 6.000 x g) elk monster voor het verzamelen van het materiaal aan de onderkant van de buis.
  3. Slijpen van elk monster met behulp van een gesteriliseerde met autoclaaf kunststof stamper en een elektromotor voor 10 s op ijs.
  4. Herhaal stap 5.2 en 5.3 4.
  5. Uitvoeren van het RNA extractie met behulp van commercieel beschikbare kits en de protocollen van de fabrikant voor een optimale opbrengst.
  6. QRT-PCR met verkrijgbare reagentia en specifieke primers tegen genen van belang en na de fabrikant protocollen uitvoeren.
    1. Alle PCR reacties met behulp van de volgende voorwaarden vervullen: denaturatie van 95 ° C gedurende 10 minuten gevolgd door 40 cycli van 95 ° C voor 15 s, 55 ° C gedurende 30 s en 60 ° C gedurende 30 s.
      Opmerking: Primerparen voor DIP en dpr genen zijn vermeld in tabel 1, en inleidingen voor olfactorische receptor genen staan in Hueston CE et al. 8.

6. fixatie van de pop Antennal schijven en antennes voor Immunohistochemistry

Opmerking: Correctie van de weefsels in batches van 10-20 personen te zorgen dat de weefsels zijn vaste voor dezelfde hoeveelheid tijd. Minimaliseer de hoeveelheid tijd die de monsters in PBT (PBS met afwasmiddel blijven) vóór het overbrengen van hen naar een fixatief om te maximaliseren van de integriteit van de weefsels.

  1. Verzamel de ontleed antennal schijven of pop antennes in een 200-µL PCR buis met 200 µL van 0,2% PBT op ijs om weefsel integriteit te handhaven, en om te voorkomen dat het monster van het plakken aan de muur van 200-µL PCR buizen die tot een onvolledige fixatie leiden zal.
    Opmerking: Pop antennes en antennal schijven kunnen worden moeilijk te zien zoals ze vrij doorzichtig zijn. Het is raadzaam om een dissectie bereik voor alle wassen stappen gebruiken om te voorkomen dat enig verlies van weefsel. Anderzijds kunnen 96-wells-platen voor Terasaki worden gebruikt voor de fixatie en kleuring voor het beste bijhouden van het weefsel.
  2. Fix de ontleed antennal schijf en antennal monsters van poppen in ongeveer 200 µL van 4% PFA (Paraformaldehyde) gedurende 30 minuten bij kamertemperatuur. Voor dit en daaropvolgende houd stappen, de buizen met de monsters op een nutator goed mengen de monsters in de oplossing. Vooruitgang naar stap 6.7.
  3. Voor de volwassen antenne, eerst de gehele kop ontleden en repareren in ongeveer 200 µL van 4% PFA (paraformaldehyde) gedurende 1 uur bij kamertemperatuur.
  4. Wassen van 3 x met 200 µL van 0,2% PBT voor elke 10 min. Houd de monsters op de nutator tijdens de incubatie.
  5. Ga terug naar de dissectie Microscoop voor een fijnere dissectie van de tweede antennal segment van de vaste hoofden. Met behulp van Tang te stabiliseren van het hoofd zachtjes trekken/snuifje uit het derde antennal segment van de tweede.
  6. Breng de ontleed derde antennal segmenten in ongeveer 200 µL van 4% PFA (paraformaldehyde) en corrigeren gedurende 30 minuten bij kamertemperatuur.
  7. Wassen van 3 x met 200 µL van 0,2% PBT voor elke 10 min. Houd de monsters op de nutator tijdens de incubatie.
  8. Opslaan van de monsters bij 4 ° C of gaan direct met hele mount immunohistochemistry.
    Opmerking: De efficiëntie van de kleuring kan veranderen wanneer het antilichaam wordt gebruikt. Deze methode moet geschikt zijn voor minder overvloedige eiwit tags of zwakkere antilichamen. Nochtans, soms, wellicht het een optimalisering van het protocol (de identiteit of de fixeerspray hoeveelheid of de tijd van fixatie).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De ontleed ontwikkelende olfactorische weefsels voor RNA extractie gevolgd door RT-PCR kan worden gebruikt voor het beoordelen van de genexpressie of via de protocollen van immunohistochemistry kan worden genomen om te bepalen zijn expressiepatroon, en de sub cellulaire lokalisatie van genen van belang. In deze sectie presenteren wij representatieve resultaten uit beide protocol. Figuur 1 is de vertegenwoordiger kwantitatieve RT-PCR de transcriptie van cel oppervlakte receptor en olfactorische receptor genen in volwassen wild-type-antennes tonen. Figuur 2 toont de 6-8 h en 12 h APF antennal schijf technieken op Rn-EGFP transgene vliegt met behulp van anti-GFP (1:1000) en anti-triplex antilichamen (1:100) (Figuur 2 en 2B). Bepaalde regio's binnen de antennal schijf etiketten RN-EGFP tijdens de vroege stadia van de pop. We tonen ook 40 h APF pop antennal anti-GFP antilichaam kleuring van Or67d-GAL4 UAS-CD8GFP transgene vliegen, en volwassen antennal anti-elav (1:100) antilichaam kleuring van ORNs (Figuur 2). Andere voorbeelden kunnen ook worden gevonden in de literatuur7,8,9,10.

Figure 1
Figuur 1 . Kwantitatieve RT-PCR van wild-type volwassen antennal RNA monsters voor verschillende genen. Deze panelen Showresultaten kwantitatieve RT-PCR voor (A) DIP-alpha, DIP-eta, dpr5, dpr8, kug, beatIIIb (voor primer paren Zie tabel 1), en (B) olfactorische en ionotropic receptor (of / Ir) genen van volwassene antennal RNA monsters. De foutbalken Toon een standaardfout van gemiddelde (SEM). Of / Ir genen zijn lage overvloed RNAs die nog kan worden gedetecteerd door qRT-PCR. De expressie van elk gen werd geanalyseerd in drievoud. CT-waarden werden gebruikt voor het berekenen van de verdunningsfactoren voor elk gen gebaseerd op standaard curven gemaakt voor elk gen. De verdunningsfactoren werden vervolgens genormaliseerd voor elk gen op de gemiddelde expressie van alle genen gemeten zoals is beschreven voor8. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2 . Immunohistochemistry met verschillende antilichamen op de ontwikkeling van de olfactorische weefsels. Deze panelen tonen anti-GFP (groen) en anti-triplex (rood) antilichaam technieken op (A) 6 h APF pop antennal schijven en (B) 12 h APF pop antennal schijven. (C) dit paneel toont een 40 h APF antenne van Or67d GAL4 UAS-CD8GFP transgenics gekleurd met konijn antilichamen anti-GFP (groen). (D) dit paneel toont volwassen antennes gekleurd met anti-CD2 antilichamen, welk label Or47b-CD2 positieve ORNs (magenta). Klik hier voor een grotere versie van dit cijfer.

Voorwaartse primer Omgekeerde primer Lengte
CGGAGAGGAGGTTATGAGCA GGAAGTGCACAACTAGCGTT 143
CGCGAATCGTTGTGTCAGTA TGTCGATAGCGTGAACCTGA 129
AGGAGTGGACGTTGAGTTACA CAATCATGTCCTCGTGACCG 146
TAGAGTCCGAGCAGCAGATG GTCAGAATTCGAGTTGTCCGC 104
GGCGCTAAGTAGCAGGACG GGCCAAGTCTGTTTGTGAGG 215
TAAGACCCTAGCGCCCTCTT AGGGAGATGCGCTTTGAGAC 129

Tabel 1. Lijst van PCR inleidingen in qRT-PCR gebruikt.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dit protocol is een nuttige bron voor labs geïnteresseerd in het identificeren van de genetische en transcriptionele programma's actief in het ontwikkelen van Drosophila olfactorische weefsel, evenals een vergelijkende analyse van deze programma's over Drosophila soorten. Het is vooral nuttig als systemen-niveau transcriptionele profielen uit verschillende ontwikkelingsstadia nodig zijn als een primer voor toekomstige studies. Het protocol beschreven hier laat zien hoe stagen en isoleren olfactorische weefsel van Drosophila te verkrijgen van monsters van de vier belangrijkste fasen van de olfactorische systeemontwikkeling van pre patronen naar terminal differentiatie, worden gebruikt ontwikkeling moleculaire en immuun-histologisch onderzoek. Ontleed van Drosophila antennal schijven en antennes in verschillende stadia van de pop kunnen worden gebruikt voor identificatie van gene expressieprofielen tijdens de olfactorische systeemontwikkeling op het niveau van de systemen door RNA-seq, of op het niveau van afzonderlijke genen door kwantitatieve RT-PCR. Monsters kunnen ook worden gebruikt voor immunohistochemistry en in situ hybridisatie ter identificatie van in vivo patronen van weefsel-specifieke genexpressie. Een bijkomend voordeel van dit protocol is dat ontleed monsters kunnen worden verdere gedissocieerde met standaardmethoden, en FAC-gesorteerd naar het verkrijgen van een gezuiverde cellulaire bevolking (of afzonderlijke cellen) voor cel type-specifieke moleculaire analyses, zoals kwantitatieve RT-PCR of RNAseq.

Hoewel het protocol dissecties antennal schijven en antennes van pop (bij 0 h/prepupa, 8 h en 40 h APF) en volwassen stadia aantoont, kan het worden aangepast aan andere pop tijdstippen. Het is ook vermeldenswaard dat leren deze dissecties tijd en praktijk kost. Een deskundige moet zitten kundig voor 50 monsters per uur ontleden. Het is belangrijk om geen overdosering de poppen. Dus, voor een uur voordat u begint met dissectie, zorgen dat geen poppen ouder dan de gewenste leeftijd zijn. Ontledingen kunnen duren om te leren, dus een periode van praktijk voor elk stadium vereist is voor het begin van de experimenten. Ontledingen van 9-12 h APF als gevolg van morfologische veranderingen moeilijker geworden. Het is mogelijk om te sorteren poppen op leeftijd bij het verzamelen van prepupae (door het lichaam kleur, met donkere kleuren worden oudere). In eerste instantie sorteren prepupae zorgt voor dissectie in volgorde van leeftijd om te voorkomen dat overaging.

Het protocol hierboven beschreven kan worden toegepast op andere soorten Drosophila . De timing voor de pop ontledingen van andere soorten kan gebaseerd zijn zowel op de verhouding van de pop ontwikkeling van een bepaalde soort bij 25 ° C tot de D. melanogaster op vergelijkende waarnemingen van antennes/antennal schijf morfologie tijdens dissecties, met een prioriteit aan morfologische overwegingen zo identiek mogelijk te zijn. Voor Drosophila melanogasterduurt het popstadium ongeveer 4 dagen. D. sechellia en D. erecta pop developmental enscenering is vergelijkbaar met D. melanogaster; D. virilis pop ontwikkeling is echter 1.3 x langer11,12. Wanneer er andere soorten worden opgesteld voor de dissectie moet de enscenering berusten op zowel de timing van de pop periode en vergelijkende waarnemingen van fase-specifieke antennes/antennal schijf morfologie, met de morfologische gelijkenis wordt de hoogste prioriteit. Kies eerst de optimale temperatuur voor de soorten die u geïnteresseerd bent in behandeling. Vele soorten groeien goed bij 25 ° C, maar gedetailleerde informatie over de voorwaarden van onderhoud kan worden verkregen vanaf het UC San Diego Drosophila soorten voorraad center.

De belangrijkste stappen in het protocol zijn de juiste enscenering en de juiste dissectie van het weefsel van belang in voldoende aantallen van verschillende soorten. Zodra deze uitgevoerd worden, wordt het protocol biedt een efficiënte methode van weefsel collectie voor dergelijke analyses en kan praktisch aangepast worden aan elke ontwikkeling imaginaire schijf weefsel tijdens de pop stadia in elke soort Drosophila .

Een beperking van dit protocol is dat geen type-specifieke celsteekproeven biedt. Een meer gedetailleerde kennis van cellulaire functie en morfologie vereist cel type-specifieke profilering van transcriptie op een niveau van de systemen, naast moleculaire standaardprocedures zoals kwantitatieve RT-PCR of immunohistochemistry. Cel type-specifieke profilering moeilijk geweest, vooral gezien het gebrek aan cel type-specifieke verslaggever transgenics in niet -melanogaster soorten. Met de huidige ontwikkelingen in de cellulaire profilering, transgenics en CRISPR-Cas9 gemedieerde genoom bewerken in niet -melanogaster soorten, is het nu mogelijk om te etiketteren en uitzoeken van afzonderlijke cellen van belang zijn voor het profiel van transcriptie13.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Deze studie werd gesteund door een subsidie van de National Science Foundation Pelin C. Volkan (DEB-1457690).

Materials

Name Company Catalog Number Comments
10X Phosphate-buffered Saline Gibco 70011-044 Dilute to 1X in RNase free water
CO2 tank Air Gas CD R200
Two sharp forceps (Dumont #55) Fine Science Tools 11255-20
Trizol Invitrogen 15596-026 RNA isolation solutions
Dissecting Microscope
Small bucket with ice
P20 and P200 micropipettes and tips
1.7 mL Microfuge tubes Purchase nuclease free for best results
0.2 mL PCR tubes
Paraformaldehyde powder Polysciences 380
10% Triton X-100 Teknova T1105 Dilute to 0.2% v/v in 1X PBS
2" petri dishes
55mm filter paper Whatman 1001-055 Wet with water and place in a petri dish to keep pupae moist
25 C incubator
deionized H2O Purchase nuclease free or treat with DEPC
Sylgard 184 Silicone Elastomer Kit Dow Corning to be used for making dissection pads from Terizaki plate covers.
MicroWell Mini Trays with lids Nunc 438733 Lids can be used to make silicone dissection pads
Rabbit anti-GFP antibody MBL international corpor PM005 primary antibody
Mouse anti RAT CD2 AbD seroTec MCA154RHDL primary antibody
ADL195 (anti lamin, mouse) Dev studies hydoma ban ADL195-s primary antibody
Alexa Fluor® 488 goat anti-rabbit IgG (H+L) invitrogen A11008 Secondary antibody
Cy3 Goat Anti-Mouse IgG Jackson ImmunoResearch 115-166-003 Secondary antibody
Triton X-100, Protein Grade Detergent, 10% Solution, Sterile-Filtered CALBIOCHEM 648463 detergent
Lab Rotator Thermo scientific Rotator
Nuclease Free Water Growcells.com NUPW-0125 Water
Light-Duty Tissue Wipers VWR 82003-822 For cleaning dissection supplies
Superscript II invitrogen 18064014 Reverse Transcriptase 
QIAshredder (50) RNA extraction QIAGEN 79654
Oligo(dT)12-18 Primer RT life technologies 18418012
RNeasy MinElute Cleanup Kit (50) RNA extraction QIAGEN 74204
FASTSTART UNIV SG MASTER (5 ML)(500 RXN) qPCR Roche 04913850001
FASTSTART ESSENTIAL GREEN DNA MASTER  qPCR Roche 06402712001
LIGHTCYCLER 480 - MULTIWELL PLATE 96 qPCR Roche 04729692001
NEBNext High-Fidelity 2X PCR Master Mix qPCR NEB M0541S

DOWNLOAD MATERIALS LIST

References

  1. Barish, S., Volkan, P. C. Mechanisms of olfactory receptor neuron specification in Drosophila. Wiley Interdisciplinary Reviews. Developmental Biology. 4, (6), 609-621 (2015).
  2. Pan, J. W., Volkan, P. C. Mechanisms of development and evolution of the insect olfactory system. Cell and Developmental Biology. 2, 130 (2013).
  3. Ramdya, P., Benton, R. Evolving olfactory systems on the fly. Trends in Genetics. 26, (7), 307-316 (2010).
  4. Bellen, H. J., Tong, C., Tsuda, H. 100 years of Drosophila research and its impact on vertebrate neuroscience: a history lesson for the future. Nature Reviews Neuroscience. 11, (7), 514-522 (2010).
  5. Knecht, Z. A., et al. Distinct combinations of variant ionotropic glutamate receptors mediate thermosensation and hygrosensation in Drosophila. eLife. 5, 44-60 (2016).
  6. Enjin, A., et al. Humidity sensing in Drosophila. Current Biology. 26, (10), 1352-1358 (2016).
  7. Li, Q., Barish, S., Okuwa, S., Volkan, P. C. Examination of endogenous rotund expression and function in developing Drosophila. olfactory system using CRISPR-Cas9-mediated protein tagging. G3: Genes|Genomes|Genetics. 5, (12), 2809-2816 (2015).
  8. Hueston, C. E., et al. Chromatin modulatory proteins and olfactory receptor signaling in the refinement and maintenance of fruitless expression in olfactory receptor neurons. PLoS Biology. 14, (4), 1002443 (2016).
  9. Li, Q., et al. Combinatorial rules of precursor specification underlying olfactory neuron diversity. Current Biology. 23, (24), 2481-2490 (2013).
  10. Li, Q., et al. A functionally conserved gene regulatory network module governing olfactory neuron diversity. PLoS Genetics. 12, (1), 1005780 (2016).
  11. Pan, J. W., et al. Patterns of transcriptional parallelism and variation in the developing olfactory system of Drosophila species. Scientific Reports. 7, (1), 8804 (2017).
  12. Pan, J. W., et al. Comparative analysis of behavioral and transcriptional variation underlying CO2 sensory neuron function and development in Drosophila. Fly. 11, (4), 239-252 (2017).
  13. Stern, D. L., et al. Genetic and transgenic reagents for Drosophila simulans, D. mauritiana, D. yakuba, D. santomea, and D. virilis. G3: Genes|Genomes|Genetics. 7, (4), 1339-1347 (2017).
Voorbereiding van de ontwikkeling van de perifere olfactorische weefsel voor moleculaire en analyse van Immunohistochemical in <em>Drosophila</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).More

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter