Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Preparando a desenvolver tecido olfativo periférico para Molecular e análise imuno-histoquímica em Drosophila

doi: 10.3791/57716 Published: June 13, 2018

Summary

Aqui, apresentamos um protocolo para estágio e dissecar a desenvolver o tecido olfativo de espécies de Drosophila . O tecido dissecado mais tarde pode ser usado para análises moleculares, como quantitativa de RT-PCR (Reverse transcrição-Polymerase Chain Reaction) ou RNA sequenciamento (RNAseq), bem como na vivo de análise como a imuno-histoquímica ou em situ hibridização.

Abstract

O sistema olfativo de Drosophila é um sistema amplamente utilizado em neurobiologia do desenvolvimento, neurociência de sistemas, bem como neurofisiologia, comportamento e evolução comportamental. Drosófila olfativos tecidos casa os neurônios olfactory do receptor (ORNs) que detectam sugestões químicas voláteis, além dos neurônios-hidro e thermo-sensorial. Neste protocolo, descrevemos a dissecação de desenvolver tecido olfativo periférico da espécie Drosophila adulto. Primeiro, descrevemos como fase e idade larvas de Drosophila , seguidas pela dissecação do disco da antena de primeiros estágios pupal, seguidos pela dissecação de antenas de adultos e estágios meados-pupal. Mostramos também métodos onde as preparações podem ser utilizadas em técnicas moleculares, tais como a extração de RNA para qRT-PCR, RNAseq ou imuno-histoquímica. Esses métodos também podem ser aplicados a outras espécies de Drosophila , após desenvolvimento pupal espécie-específicos são determinados e respectivas fases são calculados para envelhecimento adequado.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

O sistema olfativo de Drosophila é um sistema amplamente utilizado em neurobiologia do desenvolvimento, neurociência de sistemas, bem como neurofisiologia, estudos de comportamento e evolução comportamental1,2,3, 4. Drosófila olfativos tecidos casa os neurônios olfactory do receptor (ORNs) que detectam sinais químicos voláteis além de neurônios sensoriais hidro - e thermo1,5,6. O objetivo geral do presente manuscrito é demonstrar como estágio e dissecar desenvolvimento pupal e adulto tecido olfativo em espécies de Drosophila . A justificativa para esta técnica é para gerar amostras de diferentes estágios pupal para análises moleculares e no desenvolvimento do sistema olfativo periférico, tais como RNAseq e RT-PCR quantitativo, além na vivo tecido técnicas de rotulagem . Esta técnica pode ser especialmente útil para identificar a dinâmica do transcriptional perfis no sistema olfativo em desenvolvimento adulto da espécie non -melanogaster da drosófila , que não dispõem de todos os reagentes transgênicos para o tipo de célula específico rotulagem e análises. Neste manuscrito, demonstramos como dissecar discos da antena e antenas de espécies de Drosophila pupa e adultas. Primeiro, mostramos como identificar Drosophila 0 h de formação do casulo (APF, pupas brancas ou pré-pupa) para preparo do desenvolvimento e envelhecimento espécie-específicos. Em seguida, mostramos como dissecar os discos da antena e o terceiro segmento da antena; especificamente, como dissociar o disco do olho e o segundo segmento da antena para a pureza de tecido necessária para RNAseq ou RT-PCR. Os estágios no d. melanogaster descrito neste protocolo aproximadamente correspondem ao disco da antena previamente padronizado (pré-pupa), a seleção de precursores da antena de disco (8 h APF), o início da diferenciação terminal para ORNs (40 h/a APF), e antena de adulta. Finalmente, damos exemplos para um RT-PCR quantitativo de antenas adultas isoladas usando o método e por imuno-histoquímica na vivo . Esse método pode ser usado para gerar amostras para uma análise de DNA/RNA e imuno-histoquímica no desenvolvimento de tecidos periféricos olfativos, de diferentes espécies de Drosophila .

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

O seguinte protocolo é consistente com as diretrizes de ética estabelecidas pelo Comitê de ética de pesquisa Universidade Duke.

1. tecido preparação e encenação do desenvolvimento da Drosophila melanogaster Pupa

  1. Em primeiro lugar, identifica quantas moscas serão necessárias para a dissecação. Por RT-PCR e RNAseq, colete 100-200 discos da antena e antenas de indivíduos que são necessários nas fases prepupal, de 8 h APF, 40 h/a APF e adulto. Por imuno-histoquímica, disse o indivíduo 10-20.
  2. Limpar todos os materiais, incluindo almofadas de dissecação e fórceps, usando lenços com 70% EtOH. Se o material dissecado é para ser usado para extração de RNA, limpar tudo com neutralizador de RNase e fazer todas as soluções usando uma nuclease-livre ou pyrocarbonate de dietilo (DEPC) água tratada.
    Nota: Este protocolo usa almofadas de dissecação do silicone em vez de vidro para as dissecções. Almofadas do silicone são simpáticos a fórceps ultra-fina e promovem dissecações rápidas e de alta qualidade.
  3. Recolha a pupa à h 0 palco APF/prepupal.
    1. Para garantir a encenação mais precisa, monitore as larvas em 30 min com intervalos de 1 h.
      Nota: Errante terceiro ínstar larvas numa garrafa moderadamente lotada serão provavelmente pupate dentro de algumas horas.
    2. Uma vez que as larvas ficam imobilizadas e estão rodeadas por um caso de pupa muito leve (quase branco) colorido, transferi-los para uma pequena 2 - em placa de Petri com papel de filtro úmido.
    3. Continue por 1-2 h, ocasionalmente monitoramento, identificação e transferência de pré-pupa.
      Nota: Como alternativa, limpar uma garrafa de todas as pupas e permitem que as larvas desenvolver para 2h. Todas as pupas coletadas após 2h será dentro de um intervalo APF 0 - 2 h.
  4. Afastar-se imediatamente para o passo 3.1 para dissecar o disco da antena prepupal para a fase APF h 0. Se o prepupa precisa ser envelhecido, recolhê-los em um prato, cubra o prato e coloque uma película de parafina em torno das bordas para inibir a secura e coloque o prato de Petri a 25 ° C.
    Nota: As pupas podem agora ser envelhecidas a eclosão.
  5. Para pupas coletadas em um intervalo de 2 h, era a pré-pupa por 2 h a menos do que a idade desejada a fim de assegurar que as pupas não excedente.
  6. Use o fórceps ultra-fina (Dumont 55) como o tecido é muito pequeno e frágil.

2. tecido preparação e encenação do desenvolvimento da Pupa de outras espécies de Drosophila

  1. Para determinar o comprimento do desenvolvimento pupal em outras espécies de Drosophila , coloque as amostras à temperatura ideal, gravar as datas quando a pré-pupa é observadas, classificá-los dentro de um frasco de fresco e registrar o número de dias de prepupa a idade adulta.
  2. Recorde a proporção de tempo para desenvolvimento pupal para espécies não -melanogaster e melanogaster. Multiplica a relação do tempo do desenvolvimento pelo número de horas utilizadas para encenar melanogaster para obter o número de horas de idade das espécies não -melanogaster .

3. dissecação do disco da antena Pupal de d. melanogaster

Nota: Todas as vezes de envelhecimento e protocolos de dissecação são descritos por melanogaster da drosófila. Para todas as outras espécies, uma modificação do protocolo de envelhecimento com base em pontos de tempo de desenvolvimento específicas serão necessária, como descrito acima.

  1. Para dissecções do disco da antena pupal, coletar 50-100, 0 - 2 h ou pupas velho 6-8 h, usando uma espátula e coloque-os sobre uma almofada de dissecação.
  2. Pipete 150 µ l de solução de isolamento de RNA para um RNase livre microcentrífuga de 1,5 mL com uma pipeta de 200 µ l de tubo e colocar o tubo no gelo.
  3. Disse as pupas em 150-200 µ l de 1X PBS (tampão fosfato solução salina, livre de nuclease). Coloca várias gotículas de PBS (150-200 µ l por gotículas) na rampa de dissecação.
  4. Na rampa de dissecação, coloque o 0 - 2 h ou pupas de 6-8 h envelhecido (uma pupa por gota) para ser dissecado em um do 1x gotículas de PBS. Use o fórceps em uma mão para estabilizar o corpo.
  5. Para o 0 - 2 h envelhecido pupas, usando fórceps na outra mão, segure a parte mais anterior (os ganchos de boca) o prepupa e puxe-o para expor o cérebro e os discos imaginária anexados ao caso anterior pupal.
  6. Para as pupas APF de 8 h, primeiro suavemente Descole o pupa caso do bairro mais anterior da pupa, expondo a cabeça dentro do saco de membrana que envolve o corpo.
    Nota: O corpo, nesta fase, se parece com uma larva de degeneração.
  7. Remova a cabeça na articulação do pescoço.
    Nota: Isso garante que os discos da antena não serão perdidos, que nesta fase estão ligados principalmente a óptica lóbulos do cérebro.
  8. Transferi o tecido com o cérebro e os discos imaginária para outro 1x gotículas de PBS usando fórceps ou uma pipeta de 20 µ l.
  9. Identifica o olho-antena disco conectado ao cérebro em lóbulos óptica. Usando fórceps, desconecte-o olho-antena disco o cérebro e o caso de pupa. Transferi-lo para um novo 1x gotículas de PBS usando fórceps ou uma pipeta de 20 µ l.
    Nota: O disco olho-antena prepupal é um tecido liso. No entanto, pelas pupas de 8 h, os discos de olho são girados colocando os discos da antena, que se senta à frente do cérebro central.
  10. Usando a pinça, corte o tecido no local da conexão entre o olho e o disco da antena. Use uma pipeta de 20 µ l para transferir suavemente o tecido dissecado para o reagente de solução de isolamento de RNA. Minimize a quantidade de líquido transferido pipetando uma quantidade tão pequena quanto possível.
  11. Repita até que todas as pupas tem sido dissecadas.

4. dissecação de d. melanogaster Mid-pupa e adulto antenas

Nota: Por 40 h APF, a maioria da metamorfose é completa, e as estruturas de adultas são evidentes, mas são ainda branco e anódino. Neste ponto do tempo do desenvolvimento, a antena adulta tomou sua forma final, no entanto, ainda é transparente e a maioria dos receptores de olfativo, com exceção de alguns, não ter começado a expressão.

  1. Para dissecções antenais pupal, coletar 50-100 pré-pupa, conforme descrito na etapa 1 e idade-los para 40 h/a 25 ° C.
  2. Pipetar 150 µ l de solução de isolamento de RNA em uma RNase livre microcentrifuga de 1,5 mL tubo utilizando uma pipeta de 200 µ l e colocar o tubo no gelo.
  3. Na rampa de dissecação, coloque a pupa para ser dissecado em um do 1x gotículas de PBS. Use o fórceps em uma mão para estabilizar o corpo. Usando fórceps na outra mão, retire suavemente o caso pupal do bairro mais anterior da pupa, expondo a cabeça dentro do saco de membrana que envolve o corpo.
  4. Usando a pinça, cuidadosamente corte a cabeça do resto do corpo pupal, mantendo o corpo com um conjunto de pinças e arrancando a cabeça no colo da conjunta com outro conjunto de pinças. Transferi suavemente a cabeça outro 1x gotículas de PBS usando fórceps. Pipete para cima e para baixo para limpar o conteúdo da cabeça (o cérebro, etc.) para obter uma membrana clara que costumavam cercar a cabeça de Drosophila em desenvolvimento.
    Nota: A 40-50 h APF, as antenas estão ligadas à seção anterior-a maioria da membrana. Eles se tornarão aparentes para dissecação quando o conteúdo da cabeça é limpas com pipetagem.
  5. Usando fórceps, desconecte as antenas pupal da membrana. Desconecte o segmento 2nd da antena 3rd usando fórceps a fatia na articulação segmentar, como apenas o segmento de 3rd vai abrigar os neurônios olfactory do receptor.
  6. Use uma pipeta de 20 µ l para transferir suavemente o tecido dissecado para o reagente de solução de isolamento de RNA. Minimize a quantidade de líquido transferido pipetando uma quantidade tão pequena quanto possível. Repita até que todas as pupas tem sido dissecadas.
  7. Para adultas antenais dissecações, coletar aproximadamente 50 adultos e idade-los para uma pós-eclosão semana.
    Nota: A expressão de genes de receptores olfativos e outros genes pico uma semana após a eclosão. Os adultos são envelhecidos por uma semana para garantir biologicamente relevantes genes com transcrições de baixa abundância a subir acima do limite de deteção.
  8. Para extração de RNA, disse moscas enquanto eles ainda estão vivos em uma almofada de2 CO. Trate o CO2 pad com inibidores de RNase. Para a imagem latente confocal, dissecar as moscas num bloco de dissecação em 1X PBS ou PBS + 0,2% Triton.
  9. Primeiro, coloca os adultos para dormir na plataforma de estação de CO2 , no âmbito de dissecação. No pad Estação CO2 , usando a pinça na mão para estabilizar o corpo, use fórceps na outra mão para gentilmente puxe/pitada para fora o terceiro segmento da antena do segundo.
  10. Transferi as antenas para uma solução de isolamento de RNA, usando a pinça para colocar as antenas diretamente no líquido. Repita até que todos os adultos têm sido dissecados.
    Nota: Certifique-se que as antenas estão submersos em solução de isolamento de RNA. A antena pode ficar preso na lateral do tubo. Isso fará com que uma maior degradação do RNA, reduzindo a quantidade e a qualidade do RNA.
  11. Diretamente, prossiga para a extração do RNA ou colocar o tubo a-80 ° C para armazenamento a longo prazo.

5. RNA isolamento dos tecidos dissecados

  1. Remova todas as amostras do armazenamento-80 ° C e descongelá-los no gelo.
  2. Brevemente gire (5-6 s, ~ 6.000 x g), cada amostra para coletar o material na parte inferior do tubo.
  3. Moer cada amostra usando um pilão de plástico esterilizado e um motor elétrico para 10 s no gelo.
  4. Repita os passos de 5,2 e 5,3 4.
  5. Realize a extração do RNA usando kits comercialmente disponíveis e seguindo o protocolo do fabricante para um rendimento ideal.
  6. Execute qRT-PCR utilizando primers específicos contra os genes de interesse e seguindo os protocolos do fabricante e reagentes disponíveis comercialmente.
    1. Realizar todas as reações de PCR usando as seguintes condições: desnaturação de 95 ° C por 10 min, seguido de 40 ciclos de 95 ° C por 15 s, 55 ° C por 30 s e 60 ° C por 30 s.
      Nota: Pares de Primer para mergulho e dpr genes estão listados na tabela 1, e primers para genes olfactory do receptor são listados no CE Hueston et al 8.

6. fixação dos discos antenais Pupal e antenas para imuno-histoquímica

Nota: Corrigi os tecidos em lotes de 10 a 20 indivíduos para assegurar que os tecidos são fixos para a mesma quantidade de tempo. Minimize a quantidade de tempo que as amostras fiquem em PBT (PBS com detergente) antes de transferi-las para um fixador para maximizar a integridade dos tecidos.

  1. Recolher os discos antenais dissecados ou pupal antenas em um tubo PCR de 200 µ l contendo 200 µ l de 0,2% PBT no gelo para manter a integridade do tecido e para evitar a amostra da colagem na parede de 200 µ l do PCR tubos que levará a uma fixação incompleta.
    Nota: Antenas Pupal e discos da antena podem ser difícil de ver como eles são completamente translúcidos. É aconselhável usar um escopo de dissecação para todas as etapas de lavagem para evitar qualquer perda de tecido. Alternativamente, placas de 96 poços Terasaki podem ser usado para a fixação e coloração para controlar melhor o tecido.
  2. Corrigir o disco da antena dissecado e amostras da antena de pupas em aproximadamente 200 µ l de 4% PFA (paraformaldeído) por 30 min à temperatura ambiente. Por isto e subsequentes etapas, manter os tubos com as amostras em um nutator para misturar corretamente as amostras na solução. Progresso para a etapa de 6,7.
  3. Para a antena de adulta, dissecar a cabeça primeiro e corrigi-lo em aproximadamente 200 µ l de 4% PFA (paraformaldeído) por 1h à temperatura ambiente.
  4. Lavar 3x com 200 µ l de 0,2% PBT por 10 min cada. Mantenha as amostras no nutator durante a incubação.
  5. Volte para o microscópio de dissecação para dissecção mais fino do segundo segmento da antena das cabeças fixas. Usando o fórceps para estabilizar a cabeça, suavemente puxe/pitada para fora o terceiro segmento da antena do segundo.
  6. Transferir os segmentos antenais terceiros dissecados em aproximadamente 200 µ l de 4% PFA (paraformaldeído) e corrigi-los por 30 min à temperatura ambiente.
  7. Lavar 3x com 200 µ l de 0,2% PBT por 10 min cada. Mantenha as amostras no nutator durante a incubação.
  8. Armazenar as amostras em 4 ° C ou continuar diretamente com toda montagem immunohistochemistry.
    Nota: A eficiência de coloração pode mudar quando o anticorpo está sendo usado. Este método deve ser apropriados para menos etiquetas de proteína abundante ou mais fracos de anticorpos. No entanto, às vezes, ele pode requerer uma otimização do protocolo (a identidade ou quantidade do fixador ou o tempo de fixação).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

O tecido olfativo em desenvolvimento dissecado pode ser usado para a extração de RNA, seguida por RT-PCR para avaliar a expressão do gene ou pode ser tomado através de protocolos de imuno-histoquímica para determinar seu padrão de expressão e a sub celular localização de genes de interesse. Nesta seção, apresentamos resultados representativos de qualquer protocolo. A Figura 1 é o representante RT-PCR quantitativo mostrando a transcrição dos genes de olfactory do receptor e do receptor de superfície celular em adultas antenas tipo selvagem. A Figura 2 mostra a 6-8 h e 12 h APF disco antenais citológicas no Rn-EGFP transgénico voa usando anti-GFP (1: 1000) e anticorpos antijesuina (1: 100) (Figura 2 e 2B). RN-EGFP rótulos determinadas regiões dentro do disco da antena durante as fases iniciais de pupa. Também mostramos 40 h APF pupal antena anti-GFP mancha do anticorpo de Or67d-GAL4 UAS-CD8GFP moscas transgênicas e adulto antena anti-drosà (1: 100) mancha do anticorpo de ORNs (Figura 2). Outros exemplos também podem ser encontrados na literatura7,8,9,10.

Figure 1
Figura 1 . RT-PCR quantitativo do selvagem-tipo adulto antenais RNA as amostras por genes diferentes. Estes painéis mostram resultados de RT-PCR quantitativos para (A) DIP-alfa, DIP-eta, dpr5, dpr8, kug, beatIIIb (para a primeira demão pares ver tabela 1) e (B) olfativa e geleificação do receptor (ou / Ir) genes de adulto amostras de RNA da antena. As barras de erro mostram um erro padrão da média (SEM). Ou / Ir genes são baixa abundância RNAs que ainda pode ser detectado por qRT-PCR. A expressão de cada gene foi analisada em triplicado. Valores de CT foram usados para calcular os fatores de diluição para cada gene baseado em curvas padrão criadas para cada gene. Então, os fatores de diluição foram normalizados para cada gene a emissão média de todos os genes medido conforme descrito antes de8. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2 . Imuno-histoquímica utilizando anticorpos diferentes no desenvolvimento de tecidos olfativos. Estes painéis mostram anti-GFP (verde) e antijesuina (vermelho) Anticorpo citológicas no (A) 6 h APF pupal antenais discos e (B) 12 h APF pupal antenais os discos. (C), este painel mostra uma 40 h APF antena de Or67d GAL4 UAS-CD8GFP transgenics manchado com coelho anticorpos anti-GFP (verde). (D) este painel mostra adultas antenas manchadas com anticorpos anti-CD2, qual rótulo Or47b-CD2 ORNs positivos (magenta). Clique aqui para ver uma versão maior desta figura.

Cartilha para a frente Primeira demão reversa Comprimento
CGGAGAGGAGGTTATGAGCA GGAAGTGCACAACTAGCGTT 143
CGCGAATCGTTGTGTCAGTA TGTCGATAGCGTGAACCTGA 129.
AGGAGTGGACGTTGAGTTACA CAATCATGTCCTCGTGACCG 146
TAGAGTCCGAGCAGCAGATG GTCAGAATTCGAGTTGTCCGC 104
GGCGCTAAGTAGCAGGACG GGCCAAGTCTGTTTGTGAGG 215
TAAGACCCTAGCGCCCTCTT AGGGAGATGCGCTTTGAGAC 129.

Tabela 1. Lista de iniciadores de PCR usado em qRT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Este protocolo é um recurso útil para laboratórios interessados em identificar os programas genéticos e transcriptional operando no desenvolvimento de tecido olfativo de Drosophila , bem como uma análise comparativa destes programas através de Drosophila espécies. É especialmente útil se sistemas-nível transcricionais perfis de diferentes estádios de desenvolvimento são necessários como um primer para futuros estudos. O protocolo descrito aqui demonstra como estágio e isolar a desenvolver o tecido olfativo de drosófila para obter amostras de quatro fases principais de desenvolvimento sistema olfativo de pre-padronização de diferenciação terminal, para ser usado em estudos moleculares e imunológico-histológica. Dissecado Drosophila discos da antena e antenas em diferentes fases de pupa podem ser usadas para identificar perfis de expressão de genes durante o desenvolvimento do sistema olfativo a nível de sistemas por RNA-seq, ou ao nível dos genes individuais por RT-PCR quantitativo. As amostras também podem ser usadas para a hibridação de imuno-histoquímica e em situ para identificar padrões no vivo da expressão tecido-específica do gene. Uma vantagem adicional deste protocolo é que dissecado amostras pode ser ainda dissociada usando métodos padrão e para obter uma população celular purificada (ou células únicas) para análises moleculares do tipo específico celular, tais como FAC-classificados quantitativa RT-PCR ou RNAseq.

Mesmo que o protocolo demonstra as dissecções dos discos da antena e antenas de pupa (às 0 h/prepupa, 8h e 40h APF) e estágios adultos, pode ser adaptado para outros pontos do tempo pupal. Também vale a pena mencionar que aprender essas dissecações requer tempo e prática. Um especialista deve ser capaz de dissecar a 50 amostras por hora. É importante não excedente as pupas. Portanto, uma hora antes de iniciar a dissecação, certifique-se de que nenhum pupas são mais velhas do que a idade desejada. Dissecações podem levar tempo para aprender, portanto, um período de prática para cada fase é necessário antes de iniciar os experimentos. Dissecações tornam-se mais difícil de 9-12 h APF devido a alterações morfológicas. É possível classificar pupas por idade ao coletar a pré-pupa (pela cor do corpo, com cores mais escuras, sendo o mais velho). Classificação inicialmente pré-pupa permite a dissecção em ordem de idade para evitar overaging.

O protocolo descrito acima pode ser aplicado a outras espécies de Drosophila . O timing para as dissecções pupal de outras espécies pode basear-se tanto para a relação entre o desenvolvimento pupal de uma dada espécie a 25 ° C para o d. melanogaster e observações comparativas da antena/antena morfologia do disco durante as dissecções, com um prioridade dada às considerações morfológicas ser tão idêntico quanto possível. Para Drosophila melanogaster, o estágio de pupa leva cerca de 4 dias. D. sechellia e d. erecta a plataforma do desenvolvimento pupal é semelhante ao d. melanogaster; no entanto, d. virilis desenvolvimento pupal é 1.3 x mais11,12. Quando outras espécies estão preparados para dissecação, a encenação deve basear tanto o calendário do período pupal e observações comparativas de estágio específico antenas/antenais morfologia do disco, com a similaridade morfológica, sendo a mais alta prioridade. Em primeiro lugar, identifica o melhor tratamento de temperatura para as espécies que você está interessado em. Muitas espécies crescem bem em 25 ° C, mas as informações detalhadas sobre as condições de manutenção podem ser obtidas no centro UC San Diego drosófila espécie das ações.

As etapas mais críticas no protocolo são o estadiamento correto e adequada dissecação do tecido de interesse em números adequados de diferentes espécies. Uma vez que estas estão em vigor, o protocolo fornece um método eficiente de coleta de tecido para tais análises e pode ser praticamente adaptado para qualquer tecido disco imaginária em desenvolvimento durante a fase pupal, em qualquer espécie de drosófila .

Uma limitação do presente protocolo é que ele não fornece amostras de tipos específicos de células. Uma compreensão mais detalhada da função celular e morfologia requer células específicas do tipo de criação de perfil de transcrição em um nível de sistemas, além de procedimentos moleculares como RT-PCR quantitativo ou imuno-histoquímica. Perfis de tipo específico de célula tem sido difícil, especialmente dada a falta de células específicas do tipo repórter transgênicos em espécies não -melanogaster . Com os avanços atuais na caracterização celular, transgênicos e CRISPR-Cas9 mediada genoma edição em espécies não -melanogaster , é agora possível rotular e classificar células únicas de interesse para o perfil de transcrição13.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada para divulgar.

Acknowledgments

Este estudo foi suportado por uma concessão do National Science Foundation para Pelin C. Volkan (DEB-1457690).

Materials

Name Company Catalog Number Comments
10X Phosphate-buffered Saline Gibco 70011-044 Dilute to 1X in RNase free water
CO2 tank Air Gas CD R200
Two sharp forceps (Dumont #55) Fine Science Tools 11255-20
Trizol Invitrogen 15596-026 RNA isolation solutions
Dissecting Microscope
Small bucket with ice
P20 and P200 micropipettes and tips
1.7 mL Microfuge tubes Purchase nuclease free for best results
0.2 mL PCR tubes
Paraformaldehyde powder Polysciences 380
10% Triton X-100 Teknova T1105 Dilute to 0.2% v/v in 1X PBS
2" petri dishes
55mm filter paper Whatman 1001-055 Wet with water and place in a petri dish to keep pupae moist
25 C incubator
deionized H2O Purchase nuclease free or treat with DEPC
Sylgard 184 Silicone Elastomer Kit Dow Corning to be used for making dissection pads from Terizaki plate covers.
MicroWell Mini Trays with lids Nunc 438733 Lids can be used to make silicone dissection pads
Rabbit anti-GFP antibody MBL international corpor PM005 primary antibody
Mouse anti RAT CD2 AbD seroTec MCA154RHDL primary antibody
ADL195 (anti lamin, mouse) Dev studies hydoma ban ADL195-s primary antibody
Alexa Fluor® 488 goat anti-rabbit IgG (H+L) invitrogen A11008 Secondary antibody
Cy3 Goat Anti-Mouse IgG Jackson ImmunoResearch 115-166-003 Secondary antibody
Triton X-100, Protein Grade Detergent, 10% Solution, Sterile-Filtered CALBIOCHEM 648463 detergent
Lab Rotator Thermo scientific Rotator
Nuclease Free Water Growcells.com NUPW-0125 Water
Light-Duty Tissue Wipers VWR 82003-822 For cleaning dissection supplies
Superscript II invitrogen 18064014 Reverse Transcriptase 
QIAshredder (50) RNA extraction QIAGEN 79654
Oligo(dT)12-18 Primer RT life technologies 18418012
RNeasy MinElute Cleanup Kit (50) RNA extraction QIAGEN 74204
FASTSTART UNIV SG MASTER (5 ML)(500 RXN) qPCR Roche 04913850001
FASTSTART ESSENTIAL GREEN DNA MASTER  qPCR Roche 06402712001
LIGHTCYCLER 480 - MULTIWELL PLATE 96 qPCR Roche 04729692001
NEBNext High-Fidelity 2X PCR Master Mix qPCR NEB M0541S

DOWNLOAD MATERIALS LIST

References

  1. Barish, S., Volkan, P. C. Mechanisms of olfactory receptor neuron specification in Drosophila. Wiley Interdisciplinary Reviews. Developmental Biology. 4, (6), 609-621 (2015).
  2. Pan, J. W., Volkan, P. C. Mechanisms of development and evolution of the insect olfactory system. Cell and Developmental Biology. 2, 130 (2013).
  3. Ramdya, P., Benton, R. Evolving olfactory systems on the fly. Trends in Genetics. 26, (7), 307-316 (2010).
  4. Bellen, H. J., Tong, C., Tsuda, H. 100 years of Drosophila research and its impact on vertebrate neuroscience: a history lesson for the future. Nature Reviews Neuroscience. 11, (7), 514-522 (2010).
  5. Knecht, Z. A., et al. Distinct combinations of variant ionotropic glutamate receptors mediate thermosensation and hygrosensation in Drosophila. eLife. 5, 44-60 (2016).
  6. Enjin, A., et al. Humidity sensing in Drosophila. Current Biology. 26, (10), 1352-1358 (2016).
  7. Li, Q., Barish, S., Okuwa, S., Volkan, P. C. Examination of endogenous rotund expression and function in developing Drosophila. olfactory system using CRISPR-Cas9-mediated protein tagging. G3: Genes|Genomes|Genetics. 5, (12), 2809-2816 (2015).
  8. Hueston, C. E., et al. Chromatin modulatory proteins and olfactory receptor signaling in the refinement and maintenance of fruitless expression in olfactory receptor neurons. PLoS Biology. 14, (4), 1002443 (2016).
  9. Li, Q., et al. Combinatorial rules of precursor specification underlying olfactory neuron diversity. Current Biology. 23, (24), 2481-2490 (2013).
  10. Li, Q., et al. A functionally conserved gene regulatory network module governing olfactory neuron diversity. PLoS Genetics. 12, (1), 1005780 (2016).
  11. Pan, J. W., et al. Patterns of transcriptional parallelism and variation in the developing olfactory system of Drosophila species. Scientific Reports. 7, (1), 8804 (2017).
  12. Pan, J. W., et al. Comparative analysis of behavioral and transcriptional variation underlying CO2 sensory neuron function and development in Drosophila. Fly. 11, (4), 239-252 (2017).
  13. Stern, D. L., et al. Genetic and transgenic reagents for Drosophila simulans, D. mauritiana, D. yakuba, D. santomea, and D. virilis. G3: Genes|Genomes|Genetics. 7, (4), 1339-1347 (2017).
Preparando a desenvolver tecido olfativo periférico para Molecular e análise imuno-histoquímica em <em>Drosophila</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).More

Barish, S., Volkan, P. C. Preparing Developing Peripheral Olfactory Tissue for Molecular and Immunohistochemical Analysis in Drosophila. J. Vis. Exp. (136), e57716, doi:10.3791/57716 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter