Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

PCR quantitative du bactériophage T7 de criblage

doi: 10.3791/58165 Published: September 27, 2018

Summary

Reproductible, précise et temps efficace quantitative PCR (qPCR) décrit une méthode pour énumérer bactériophage T7 est ici. Le protocole décrit clairement la préparation d’ADN génomique de phage, préparation de réaction PCR, qPCR conditions cyclisme et analyse de données de qPCR.

Abstract

Ce protocole décrit l’utilisation de la PCR quantitative (qPCR) pour énumérer les phages T7 d’expériences de sélection phage (c'est-à-dire, « biopanning »). qPCR est une approche axée sur la fluorescence pour quantifier l’ADN, et ici, il est adapté pour quantifier les génomes phagiques comme une approximation des particules phagiques. Dans le présent protocole, un procédé de préparation d’ADN de phage facile est décrite à l’aide de chauffage haute température sans purification d’ADN supplémentaire. La méthode n’a besoin que de petites quantités de phages traité thermiquement et de petits volumes de la réaction de qPCR. qPCR est haut débit et rapide, capable de traiter et d’obtenir des données d’une plaque à 96 puits de réactions en 2 à 4 h. par rapport aux autres approches d’énumération phage, qPCR soit le plus court possible. Ici, qPCR est utilisée pour énumérer les phages T7 identifiés de criblage contre modèle in vitro de mucus comme la fibrose kystique. La méthode de qPCR peut être étendue pour quantifier les phages T7 d’autres expériences, y compris d’autres types de protéines (p. ex.., dépistage de phage immobilisé la liaison aux protéines, in vivo ) et d’autres sources (par exemple, les systèmes de l’eau ou des liquides organiques). En résumé, ce protocole peut être modifié afin de quantifier des virus à ADN-encapsulé.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Technologie d’affichage bactériophage (phage), mis au point par George Smith en 1985, est une approche puissante et à haut débit afin d’identifier des ligands peptidiques ou de protéines contre des cibles ou des récepteurs de la membrane cellulaire, les antigènes de la, les organites cellulaires ou spécifiques organes et tissus dans les dernières deux décennies1,2. Ici, les librairies aléatoires des polypeptides ou des anticorps de la seule chaîne sont affichées sur les protéines de manteau de phages (typiquement M13 ou T7) et des ligands spécifiques peuvent être identifiés de panoramique contre les protéines immobilisées in vitro ou in vivo systèmes biologiques à travers un processus itératif de sélection. Puis, les ligands peuvent être couplés avec des agents d’imagerie ou thérapeutiques pour le diagnostic et le traitement des maladies3,4. Il est essentiel d’énumérer avec précision les phages pendant plusieurs étapes de protéines : (1) pour quantifier les phages qui se lient au substrat et (2) pour quantifier les phages pour déterminer s’il y a enrichissement avec chaque tour de sélection (enrichissement du phage indique biopanned affinité du phage pour la cible). L’étalon-or actuel pour la quantification, essai de plaque double-couche, présente plusieurs défis ; C’est fastidieux, lourd et potentiellement inexacts pour un grand nombre d’échantillons. Par conséquent, notre groupe a développé une méthode de réaction en chaîne (qPCR) de polymérase quantitative sensible, reproductible, précises et économes en temps pour énumérer des particules de protéines5bactériophages M13 et T7.

qPCR est une méthode attrayante et faisable de quantifier avec précision les phages T7 et M13. Étant donné que chaque particule individuelle phage ne peut contenir qu’une seule copie de l’ADN génomique (dsDNA ou ADN simple brin), un génome phagique équivaut à une particule de phage ; en quantifiant le nombre de génomes de phage, il est possible de quantifier le nombre de phages. Au cours de qPCR, journaliste fluorescent colorants lient l’ADN génomique de phage non spécifique ou plus précisément par les amorces spécifiques de séquence au cours de l’amplification par PCR et la fluorescence signal augmente avec chaque tour d’amplification. Lorsque le signal de fluorescence atteint le seuil, ronde/cycle d’amplification est remarqué que le cycle seuil (Ct). Les concentrations connues du phage référence ADN sont tracées contre leurs valeurs de Ct pour tracer une courbe d’étalonnage. À l’aide de la courbe d’étalonnage avec les valeurs de Ct d’échantillons d’ADN, les concentrations de phages peuvent être interpolées.

Alors que de nombreuses stratégies ont été développées précédemment et largement utilisés pour quantifier les phages de criblage, chacun d’eux a des défis particuliers. Méthode la plus populaire et traditionnelle est double couche plaque de dosage. Ici, les hôtes de bactéries sont infectés par des phages préparés à des dilutions successives, sont cultivées sur un substrat solide agar et sont recouvertes d’agar ; les phages sont énumérés avec le nombre de plaques formées (i.e., unités formant des plaques ou pfu) sur la gélose. Essai de plaque est sensible mais fastidieux, chronophage et imprécise, surtout pour les nombreux échantillons et avec des concentrations élevées de5. En outre, les dosages immuno-enzymatiques (ELISA) ont été adaptés pour énumérer les M13 et T7 phage particules6,7,8. Ici, les phages à différentes dilutions sont liés et capturé sur un substrat solide (c.-à-d. une microplaque), hybridés avec des anticorps spécifiques phage et détectés en utilisant des reporters (p. ex., enzyme sensible substrats chromogènes, fluorophores) à déterminer le nombre de particules phagiques présents. Les afficheurs (p. ex., fluorescence, absorbance) des échantillons peuvent être utilisés pour quantifier les concentrations inconnues contre normes phage à des concentrations connues. Différents tests ELISA axée sur les phages ont été développées, mais ils ont limites potentielles. Un groupe a élaboré un sandwich ELISA, sur papier, avec une gamme de quantification qui a duré sept ordres de grandeur (2-10 109 UFP/mL) ; Cependant, cette méthode requise plusieurs étapes du revêtement de l’anticorps et a pris pour une journée entière pour le dosage de8. Notre groupe a également mis au point une méthode ELISA pour quantifier les particules phagiques M13 mais avait une portée de détection moins sensible de 106 à 1011 UFP/mL5. Lanthanide commutable fluorescence sondes ont été développés pour énumérer des M13 et données de quantification peuvent être obtenues dans les 20 min ; Toutefois, ce test a une étroite plage dynamique de 109 1012 UFP/mL9. Un groupe utilisé microscopie à force atomique pour énumérer les particules phagiques M13 en solution, mais cela requiert la microscopie électronique avancée et ne fonctionnait que dans une fourchette étroite de concentrations10. Une autre étude utilisé monodispersés émulsions pour piéger les phages de journaliste M13 et T4 fluorescents et compter les phages par le nombre de gouttelettes fluorescents ; Cependant, cette approche présentait également une gamme étroite de quantification de 102 106 UFP/mL11. Tout en gouttelettes que numérique PCR a été utilisée pour quantifier les phages M13, cette approche ne peut pas faire la différence entre le nombre de particules infectieuses et non-infectieuses phage12.

Notre groupe a récemment mis au point des méthodes de qPCR pour énumérer des phages T7 et M13 identifiés de criblage contre un modèle de barrière hémato - encéphalique cellulaire à l’aide de deux journaliste fluorescents différents colorants5. Par rapport aux méthodes de quantification susmentionnés, les méthodes de qPCR, nous avons développé étaient haut débit et temps-efficace pour quantifier les nombreux échantillons et capable de différencier les phages infectieux et non infectieux à la DNase I avant le traitement de la échantillons de phages. Ce qui est important, cette approche peut reproductible et précisément quantifier des bactériophages M13 et T7 dans des échantillons de protéines. Pour guider les chercheurs débutants dans le domaine du phage qPCR, nous décrivons ici une méthode détaillée de qPCR pour énumérer des particules de phage T7 auprès d’une bibliothèque sont limitées cystéine (CX7C) batées contre une barrière de mucus in vitro la fibrose kystique (FK). De ce travail, qPCR méthode peut être étendue pour quantifier les particules phagiques depuis d’autres types de protéines et d’autres sources, y compris l’eau, le sol et les fluides de corps.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. amorce conception et analyse de l’ADN génomique Phage T7

  1. Conception des amorces pour l’amplification de l’ADN génomique de phage T7.
    NOTE : F (avec impatience) et amorces de R (marche arrière) (voir la Table des matières) amplifient la séquence d’ADN T7 située en amont de la région variable de bibliothèque (Figure 1).
  2. Choisir un analyseur d’apprêt approprié pour évaluer les paramètres des amorces, y compris la température de fusion (Tm), pourcentage contenu de chromatographie gazeuse (GC %), dimères d’amorce, formation en épingle à cheveux et les qualités PCR (Figure 1).
  3. Commandez les oligonucléotides amorces (oligos) et à l’arrivée, remettre en suspension les oligos lyophilisée dans la DNase et RNase free ultra-pures faire concentrations stock de 100 µM dans un tube à centrifuger 1,5 mL, et conserver à-20 ° C pendant plusieurs mois.
  4. Faire plusieurs parties aliquotes (environ 50 µL dans chaque tube de 1,5 mL) du stock amorce 100µm.
    Remarque : Cette étape sert à éviter les cycles de gel-dégel fréquents.

2. élaborer des normes pour la Quantification de l’ADN génomique de Phage T7

  1. Diluer en série référence de 0,1 µg/µL (1,0 x 108 fg/µL) ADN du phage T7 (acheté ; à une concentration de 0,1 µg/µL, voir matériaux) 10 fois plus de 1,0 x 106 à 1,0 x 100 fg/µL avec ultra purs H2O en tubes PCR de 0,2 mL. Préparer chaque concentration dans un volume total de 20 µL (Figure 2).
  2. Vortex du PCR tubes pour assurer un mélange complet à chaque étape de dilution. Aussi, changer des conseils lors de l’ajout de l’échantillon d’ADN à la dilution suivante.
    Remarque : Il est recommandé de préparer la nouvelle solution de normes d’ADN pour une courbe d’étalonnage pour chaque lot de l’expérience de qPCR.
  3. L’équation 1 (ci-dessous) permet de convertir pour référence phage T7 concentrations d’ADN de fg/µL de copies du génome (gc) /µL (Figure 2).
  4. Concentration d’ADN de phage T7 en gc/µL =
    Equation 1(1)
    NOTE : bp : paires de bases ; Référence T7 l’ADN génomique est 37314 bp.

3. traitement préalable des échantillons avant de Phage qPCR préparation de réaction

  1. (Option 1) Pipeter 20 µL d’un clone de T7 (phage) choisis parmi les protéines contre in vitro la fibrose kystique (FK)-comme le modèle de mucus dans les tubes à centrifuger 1,5 mL. Ajouter 1,25 unités de DNase I (0,5 µL) de chaque échantillon de 20 µL.
    NOTE : Bibliothèque des heptapeptide contraint de cystéine bactériophage T7 (CX7C) a été biopanned contre CF type mucus enduit sur inserts membrane 24 puits (voir Table des matières) pendant 15 min. Des précisions sont fournies dans la section résultats. Un clone de T7 a été choisi pour la préparation de l’éluat qPCR.
    1. Option 2 : Pipeter 200 µL de la T7 cloner dans des tubes de 1,5 mL et ajouter 5 unités de DNase I
      (2 µL) à chaque échantillon.
      Remarque : Le volume d’échantillon de phage sélectionné à cette étape dépend du volume collecté de criblage. Bien que la mise au point du protocole sur la qPCR du phage biopanned, les étapes criblage sont détaillées dans le protocole utilisateur du phage T7 l’ensemble (voir Table des matières)13.
  2. Boucher les tubes à échantillon phage T7 (étape 3.1) et les incuber à 37 ° C pendant 10 min dans un Bain thermostaté sec (c'est-à-dire, le bloc chauffant).
  3. Incuber les tubes (de l’étape 3.2) à 100 ° C pendant 15 minutes dans un Bain thermostaté sec (Figure 3 a).
    ATTENTION : Puisque l’évaporation et condensation se produisent pendant l’étape de chauffage, assurez-vous que les tubes de centrifugeuse de 1,5 mL sont plafonnées complètement.
  4. Tournez les phages traité thermiquement à l’étape 3.3 à 18 534 x g pendant 10 s. Mix les phages en plaçant le tube sur un vortex placés à mode de toucher-activation pour 10 s et un essorage à 18 534 x g pendant 10 s à nouveau.
    Remarque : Le cycle de mélange-spin-spin est pour s’assurer que les échantillons de phage chauffée sont bien mélangés.
  5. Refroidir les tubes à échantillon à la température ambiante (RT) en les laissant sur le banc de l’expérience ou le conserver à 4 ° C dans un réfrigérateur pendant la nuit.
    Remarque : L’expérience peut être suspendu à cette étape.

4. préparer des réactions de qPCR

NOTE : Une réaction de PCR est pour un seul échantillon. Chaque réaction PCR contient 5 µL de qPCR master mix (voir documentation), 1 µL de 5 µM amorce paire mix, 2 µL de H2O et 2 µL de l’échantillon de phage T7 traité thermiquement. Pour plusieurs réactions de PCR, tous les réactifs à l’exception des échantillons de phages sont prémélangées dans un tube de 1,5 mL. Le volume de chaque réactif dans le prémélange dépend du nombre d’échantillons de phage pour qPCR.

  1. Préparer le prémélange de qPCR 10 échantillons de phage biopanned de concentration inconnue et 7 échantillons de concentration standard en triple exemplaire. En conséquence, il y a 51 échantillons totaux et par conséquent, 51 réactions qPCR (c.-à-d., une réaction par exemple). 51 réactions, préparer un prémélange de 255 µL du mélange maître qPCR (51 x 5 µL), 51 µL d’amorces (51 x 1 µL) et 102 µL d’H2O (51 x 2 µL).
    Remarque : Il est recommandé de préparer quelques réactions de PCR supplémentaires pour compenser la perte de volume pendant l’aliquotage le mélange PCR dans chaque puits de la plaque de 96 puits qPCR.
  2. Aliquote 8 µL de prémélange PCR dans chaque puits de la plaque de 96 puits qPCR pour un total de 51 puits (c.-à-d., 51 réactions de qPCR). Il n’y a pas besoin de changer des conseils pendant l’aliquotage.
  3. Ajouter 2 µL d’échantillons de phage T7 traité thermiquement (étape 3.4) ou référence de phage T7 ADN (point 2.1) dans chaque puits (Figure 3 b) ; changer les conseils lors de l’ajout de différents échantillons d’ADN dans le puits pour prévenir la contamination croisée. En outre, dispenser les 2 échantillons d’ADN µL au-dessous de la surface du prémélange de qPCR (c.-à-d. dans le prémélange PCR 8 µL).
  4. Sceller la plaque de qPCR avec film adhésif.
    Remarque : Cette étape est critique, quel que soit le type de plaque de qPCR. Utiliser le kit recommandé pour sceller la plaque complètement ; Sinon, n’importe quelle région non scellées dans la plaque engendrera la perte de volume pendant l’ACP cyclisme.
  5. Enrouler la plaque qPCR avec du papier d’aluminium pour réduire au minimum le photoblanchiment de fluorescence et aller de l’avant de l’exécuter sur l’équipement de qPCR.

5. qPCR Conditions de cyclisme

NOTE : qPCR conditions cyclisme ont été installées sur l’équipement spécifique qPCR (voir Table des matières).

  1. Exécutez la plaque 96 puits qPCR sur l’équipement de qPCR. Sur le matériel, sélectionnez Paramètres dans le menu pour mettre en place les conditions expérimentales suivantes (Figure 3).
  2. Mettre en place de conditions comme suit pour un volume d’échantillon de 10 µL de cyclisme : un cycle à 50 ° C pendant 2 min, un cycle à 95 ° C pendant 2 min, suivie de 40 cycles de (95 ° C pendant 15 s, 60 ° C pendant 1 min). Après, exécutez les paramètres de courbe de fusion : un cycle de 95 ° C pour 15 s, 60 ° C pendant 1 min et 95 ° C 15 s.
  3. Procéder à l’analyse des données, tel que décrit à l’étape 6.

6. analyser la qPCR données brutes et de convertir de qPCR Ct valeur à gc/µL de bactériophages T7

  1. Analyser les données brutes qPCR et évaluer la qualité des données en analysant les parcelles caractéristiques des données brutes (Figure 4).
    NOTE : Amplification intrigue, intrigue multicomposant et tracé de courbe de fonte sont que la caractéristique clée complote pour valider la qualité des données de qPCR.
  2. Calculer les valeurs seuil moyen de cycle (Ct) des échantillons en triple à chaque concentration de la courbe d’étalonnage (étape 2.1).
    1. Tracer la moyenne Ct (Y) contre le journal (gc/µL) (X) pour obtenir la courbe linéaire Y = kX + b (k est la pente de la courbe linéaire, b est l’ordonnée à l’origine).
    2. Calculer le coefficient linéaire14 R2 (R2 doit être > 0.99).
  3. Utiliser la courbe d’étalonnage Y = kX + b pour calculer le nombre de phages T7 dans les échantillons de protéines (c.-à-d., les phages sélectionnés contre CF type glaire) au gc/µL (Figure 5).
    NOTE : k est la pente de la courbe standard.
  4. Calculer l’efficacité de l’amplification par l’équation suivante
    Equation 2(2)
    NOTE : k est la pente de la courbe standard produite de référence ADN qPCR. La plage idéale de l’efficacité de l’amplification est de 90 à 110 %.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Outils de conception d’amorce différents permet de concevoir des amorces de qPCR. En général, amorces programmes ont leurs propres algorithmes intégrés pour calculer et valider les paramètres clés des amorces, par exemple, GC %, Tm, dimère d’amorce ou formation en épingle à cheveux, etc. en général, les principaux critères sont similaires dans les différents outils de conception d’amorce et amorces peuvent être conçus en suivant leurs instructions. Amorce BLAST peut être utilisée pour confirmer la spécificité des amorces. Une amorce paire qui cible en amont de la région variable de la T7 l’ADN génomique est illustré à la Figure 1. Pour déterminer la concentration inconnue d’échantillons de phage de protéines, un absolu, méthode de quantification - quantification de la courbe d’étalonnage - a été choisi pour énumérer les copies de l’ADN génomiques phage. ADN de phage T7 de référence (voir documentation) à une concentration 0,1 µg/µL a été dilués en série de 1,0 x 100 à 1,0 x 106 fg / µL. équation 1 a été utilisé pour convertir le T7 concentrations d’ADN de phage de fg/µL de copies du génome (gc) / µL ; concentrations d’ADN phagique référence T7 étaient 2,66 x 101 à 2,66 x 107 gc/µL (Figure 2).

Après avoir préparé les dilutions de référence ADN pour la courbe d’étalonnage, un phage de CX7C T7 sélectionné a été préparé pour qPCR (Figure 3 a). Brièvement, pour décrire le criblage du phage sélectionné : une concentration initiale de 4,2 x 109 pfu T7 CX7C phage a été ajoutée sur le dessus de l’apicale compartiment (donneur) d’un Transwell sur plaque (voir Table des matières) contenant 100 µL de glaire de type CF et 600 µL de phosphate buffered saline (PBS, voir Table des matières) dans le compartiment basolatérale (récepteur) et est incubé à température ambiante (25 ° C) pendant 15 minutes. Après 15 min, l’éluat dans le récepteur ont été recueilli ; de l’éluat, un clone de CX7C T7 a été choisi pour être quantifié en qPCR. préparation de qPCR réaction s’est déroulée sur la glace avec des réactifs nécessaires (p. ex., qPCR master mix, amorces, H2O), comme illustré à la Figure 3 b. Les conditions cyclisme qPCR ont été mises en place sur un thermocycleur qPCR pour exécuter les exemples (voir Table des matières, Figure 3).

Après le qPCR exécuter, l’intrigue de l’amplification, la tracé de courbe de fonte et l’intrigue à plusieurs composantes (Figure 4) ont été analysées les données raw en utilisant le logiciel (voir Table des matières). L’intrigue de l’amplification indique la réussite ou l’échec de l’amplification par PCR de chaque échantillon. L’intrigue multicomposant présente l’amplification et la dégradation du signal de fluorescence (journaliste colorant SYBR et fond colorant ROX) tout au long des cycles d’amplification. Le tracé de courbe de fusion est utilisé pour valider la spécificité des amorces, car chaque produit de la PCR a une température de fusion unique (Tm).

Après évaluation de la qualité de données brutes de qPCR, la courbe d’étalonnage provenait de référence ADN : les valeurs de Ct (Y) au Journal gc/µL (conversion de concentration illustrée à la Figure 5) ; ici, c’est Y =-3.5188 X + 35.09 (R2= 0,999) (Figure 5 a et 5 b). L’efficacité de l’amplification a été évaluée à 92,4 %. La courbe d’étalonnage a été utilisée pour interpoler les concentrations inconnues de dilué T7 phage CX7C clone selon leurs valeurs de Ct. Tous les échantillons de référence et les échantillons de phage ont été exécutés en triple exemplaire, et leurs valeurs moyennes de Ct ont été utilisées pour calculer la concentration d’ADN en gc/µL (Figure 5). La solution stock initiale du clone T7 a été diluée en série afin de valider la stabilité et la reproductibilité de qPCR pour le dénombrement des T7 phages5. À chaque dilution, les échantillons ont été préparés en trois exemplaires. L’essai de plaque double-couche a été utilisé comme méthode de référence pour déterminer les concentrations des dilutions T7 ; méthodes ont été décrites auparavant5. Dans la Figure 6, les résultats représentatifs de qPCR sont indiquées par rapport au dosage de la plaque à la gamme de 101 107 gc / µL. titres ou nombre de phages de quantification de qPCR étaient supérieurs de dosage plaque double-couche. La répétabilité de la méthode de qPCR est représentée par le coefficient de variation (CV) pour des concentrations de 101 107 gc/µL. Les résultats ont été présentés dans le tableau 1; le CV % varie entre 2,85 – 27,2 %.

Figure 1
Figure 1 : conception d’amorce T7-415 phage analyses d’ADN vecteur et la clé de paramètres des amorces conçues. Outils de conception oligo servaient à concevoir plusieurs paires d’amorces pour le phage T7-415 ADN. Un ensemble a été sélectionné après la validation des paramètres clés des amorces, par exemple, Tm, GC %, formation-dimère d’amorce et épingle à cheveux. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : préparation de la courbe d’étalonnage et de conversion d’unité du bactériophage T7 référence ADN. 10 fois des dilutions sont faites de 0,1 référence phage T7 µg/µL ADN pour une courbe d’étalonnage. Équation 1 a été utilisée pour convertir des concentrations d’ADN de fg/µL en gc / µL. s’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : traitement de l’échantillon Phage, préparation de réaction qPCR et qPCR exécuter. DNase j’ai prétraités échantillons phage T7 ont été chauffés à 100° C pendant 15 min libérer l’ADN T7 de particules phagiques intact (A) ; le mélange de qPCR a été préparé comme décrit dans le protocole. Toutes les préparations ont été faites sur la glace (B) ; qPCR matériel et logiciel compatible (C) ont été utilisées pour mettre en place les conditions de cyclisme, exécuter les cycles PCR, acquérir et analyser des données brutes. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4 : parcelles caractéristiques des données brutes de qPCR. Parcelle de l’amplification, intrigue multicomposant et tracé de courbe de fonte ont été acquis de qPCR données brutes d’un clone de phage CX7C T7 de criblage contre in vitro la barrière CF type glaire. Dans l’intrigue à plusieurs composantes, la teinture de référence passive (ROX) est une molécule de colorant incluse dans le mélange maître qPCR qui ne participe pas à l’amplification par PCR et n’affichera pas l’amplification de signal dans l’intrigue. SYBR, qui est la molécule de colorant vert de SYBR en qPCR master mix, fournira un signal de fluorescence qui devrait amplifier et se désintègrent pendant qPCR cyclisme. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 5
Figure 5 : analyse des données brutes de qPCR pour calculer gc/µL des particules phage T7. Seuil du cycle des valeurs (Ct) de la courbe standard de référence de phage T7 ADN (Y) ont comploté contre la transformation du logarithme des concentrations connues de référence ADN en gc/µL (X) pour obtenir la courbe d’étalonnage (A et B). La courbe d’étalonnage a été utilisée pour calculer les valeurs de X (Journal gc/µL) des concentrations inconnues de phage échantillons basés sur leurs valeurs de Ct. (C) T7 peut calculer les concentrations de phage en gc/µL. Aussi, le calcul du rendement de l’amplification de qPCR est fourni. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 6
Figure 6 : Résultats de sensibilité et de la répétabilité de qPCR pour énumérer un T7 clone de criblage contre in vitro barrière de glaire de type CF. Un clone de phage T7 CX7C sélectionné d’expérience de criblage a été dilué en série dans une gamme de concentrations (notées E1-E7 pour représenter 101 107) et en trois exemplaires pour qPCR et essai de plaque double-couche. Tant qPCR et essai de plaque double-couche ont été utilisés pour quantifier la concentration du clone bactériophage T7 à chaque dilution. Les données ont été affichées dans la valeur moyenne de l’écart-type (SD) à chaque échelle pour chaque groupe de traitement. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Répétabilité
Concentration (gc/µL) Données de CV en %
10 1 27.2
10 2 7,65
10 3 2,85
10 4 15,7
10 5 15.6
10 6 5.03
10 7 4.71

Tableau 1 : répétabilité de la méthode de qPCR pour un clone de phage CX7C T7. Variabilité intra a été testée à l’échelle de quantification de 101 107 gc/µL pour le clone de T7 DNA, le coefficient de variation (CV) est calculé comme le rapport de l’écart à la moyenne pour exprimer la répétabilité de la méthode de qPCR. CVs ont été calculés dans l’ordre de 2,85 – 27,2 % à des concentrations testées.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nous avons développé des méthodes de qPCR pour quantifier le phage d’ADN génomique5, et ici nous avons décrit et adapté une méthode de qPCR pour énumérer les phages T7 sélectionnés contre une barrière de type CF glaire. Minimum d’informations pour connaître les instructions Publication de Quantitative Real-time PCR expériences (MIQE) ont été adaptés afin de développer et de valider la méthode de qPCR pour dénombrement des phages de T715. Le protocole que nous avons mis au point afin de quantifier les phages de criblage des expériences est une approche temps-efficace, fiable et économique. Notre protocole pour la préparation d’échantillons de qPCR seulement utilisé le traitement haute température (100 ° C, 15 min) de la solution de phage et ne nécessite pas de phage DNA extraction et la purification des mesures par rapport aux stratégies classiques11,17, 18. Aussi, pour mieux énumérer des particules phagiques, DNase a été ajouté à la solution de phage avant le traitement à haute température pour enlever non capsulées phage ADN18,19,20. ADN résiduel, non encapsulée dans la solution de phage peut entraîner un manque d’encapsulation au cours de l’amplification phage et/ou de la dégradation des particules phagiques. En conséquence, afin de quantifier précisément le nombre de particules phagiques intact à l’aide de leur ADN génomique, prétraitement DNase est essentiel pour éviter les artéfacts de hautes valeurs de copies du génome phagique.

Il existe de nombreuses considérations dans le développement et l’utilisation de qPCR de quantifier avec précision les phages. Variation de qPCR données peut se produire dans tout le protocole et les suivants doivent être considérés pour atteindre un dénombrement précis. Il est important d’assurer la lyse des phages avec traitement à haute température et garder les tubes échantillon phage en conditions scellées pour empêcher des fluctuations subséquentes en concentration de l’échantillon en raison de l’évaporation et condensation de l’eau. Un volume total de la réaction PCR est petit et nécessite des pipettes calibrées et fiable pipetage compétences à chaque étape de la préparation de l’échantillon. Pendant qPCR cyclisme, régulation fonction de la température fiable est nécessaire pour données exactes qPCR et étalonnage systématique du thermocycleur dans l’instrument de qPCR est nécessaire. Pour contrôler la variation, les autres étapes ont été décrites dans le protocole. Si l’opérateur connaît la difficulté de faible volume de pipetage, la réaction de PCR totale peut être transposée à 20 ou 25 µL. Outre les mesures susmentionnées pour le dépannage, le protocole exige le contrôle interne de l’ADN standard15,21,22,23. Comme une méthode de quantification absolue, le coefficient linéaire de la courbe d’étalonnage détermine la précision des données énumération phage. En utilisant un ADN de contrôle interne dans la course de l’échantillon peut réduire au minimum la variation de la préparation des échantillons et matériel de qPCR.

Par rapport aux méthodes de quantification de phage décrites précédemment, notre protocole permet l’énumération d’une large gamme de concentrations de phage et peut se différencier des particules infectieuses et non-infectieuses phage avec et sans traitement de DNase. En outre, notre protocole est séduisante pour quantifier un grand nombre d’échantillons, rendant plus rentable, temps-efficace et haut débit par rapport à l’essai de plaque double couche et d’autres méthodes.

En résumé, ce protocole peut être adapté pour énumérer les particules phagiques dans une variété d’applications, notamment des protéines in vitro et in vivo , préparation d’ADN de phage bibliothèque en séquençage de nouvelle génération et phage environnementale contamination.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Ce travail a été soutenu par PhRMA subvention de la Fondation recherche Starter et le National Heart, Lung, and Blood Institute des National Institutes of Health octroyer sous attribution numéro R01HL138251.

Materials

Name Company Catalog Number Comments
Materials and Reagents
Primers for T7 genomic DNA IDT F: CCTCTTGGGAGGAAGAGATTTG
R: TACGGGTCTCGTAGGACTTAAT
T7 Select packaging control DNA EMD Millipore 69679-1UG
MicroAmp optical 96-well reaction plate ThermoFisher Scientific N8010560
qPCR master mix--Power up SYBR Green master mix Applied biosystems A25742
MicroAmp optical adhesive film kit ThermoFisher Scientific 4313663
T7Select 415-1 Cloning Kit EMD Millipore 70015 User protocols : http://www.emdmillipore.com/US/en/product/T7Select-415-1-Cloning-Kit,EMD_BIO-70015#anchor_USP
DNase I solution ThermoFisher Scientific 90083
24-well transwell plate Corning 3472
UltraPure DNase/RNase-Free Distilled H2O Invitrogen 10977015
Phosphate Buffered Saline (1x) Corning 21040CV
Name Company Catalog Number Comments
Equipments
ViiA7 Real-Time PCR System with Fast 96-Well Block ThermoFisher Scientific 4453535
Heraeus Pico 21 Microcentrifuge ThermoFisher Scientific 75002415
Fisherbrand Digital Vortex Mixer Fisher Scientific 02-215-370
HERMO SCIENTIFIC Multi-Blok Heater ThermoFisher Scientific Model:2001
Sorvall Legend X1 Centrifuge ThermoFisher Scientific 75004220
M-20 Microplate Swinging Bucket Rotor ThermoFisher Scientific 75003624
Name Company Catalog Number Comments
Software
QuantStudio Real-time PCR software ThermoFisher Scientific v1.2
Real-time qPCR primer design IDT
OligoAnalyzer 3.1 IDT

DOWNLOAD MATERIALS LIST

References

  1. Smith, G. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science. 228, (4705), 1315-1317 (1985).
  2. Smith, G. P., Petrenko, V. A. Phage Display. Chemical Reviews. 97, (96), 391-410 (1997).
  3. Sergeeva, A., Kolonin, M. G., Molldrem, J. J., Pasqualini, R., Arap, W. Display technologies: Application for the discovery of drug and gene delivery agents. Advanced Drug Delivery Reviews. 58, (15), 1622-1654 (2006).
  4. Dias-Neto, E., et al. Next-generation phage display: Integrating and comparing available molecular tools to enable costeffective high-throughput analysis. PLoS ONE. 4, (12), 1-11 (2009).
  5. Peng, X., Nguyen, A., Ghosh, D. Quantification of M13 and T7 bacteriophages by TaqMan and SYBR green qPCR. Journal of Virological Methods. 252, (June 2017), 100-107 (2017).
  6. Khan, M. S., Pande, T., Mvan de Ven, T. G. Qualitative and quantitative detection of T7 bacteriophages using paper based sandwich ELISA. Colloids and Surfaces B: Biointerfaces. 132, 264-270 (2015).
  7. Brasino, M., Lee, J. H., Cha, J. N. Creating highly amplified enzyme-linked immunosorbent assay signals from genetically engineered bacteriophage. Analytical Biochemistry. 470, 7-13 (2014).
  8. Yu, X., Burgoon, M., Shearer, A., Gilden, D. Characterization of phage peptide interaction with antibody using phage mediated immuno-PCR. J immunol Methods. 326, (1-2), 33-40 (2007).
  9. Lehmusvuori, A., Manninen, J., Huovinen, T., Soukka, T., Lamminmäki, U. Homogenous M13 bacteriophage quantification assay using switchable lanthanide fluorescence probes. BioTechniques. 53, (5), 301-303 (2012).
  10. Schlaman, H. R. M., et al. Analysis of interactions of signaling proteins with phage-displayed ligands by fluorescence correlation spectroscopy. Journal of Biomolecular Screening. 13, (8), 766-776 (2008).
  11. Tjhung, K. F., Burnham, S., Anany, H., Griffiths, M. W., Derda, R. Rapid enumeration of phage in monodisperse emulsions. Analytical Chemistry. 86, (12), 5642-5648 (2014).
  12. Reitinger, S., Petriv, O. I., Mehr, K., Hansen, C. L., Withers, S. G. Purification and quantitation of bacteriophage M13 using desalting spin columns and digital PCR. Journal of Virological Methods. 185, (1), 171-174 (2012).
  13. T7Select Biopanning Kit. Millipore Sigma. Available from: https://www.emdmillipore.com/US/en/product/T7Select-Biopanning-Kit,EMD_BIO-70018#anchor_USP (2018).
  14. Schneider, A., Hommel, G., Blettner, M. Linear Regression Analysis. Deutsches Ärzteblatt international. 107, (44), 776-782 (2010).
  15. Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggert, J. The MIQE Guidelines: Minimun information for publication of quantitative real-time PCR experiments. Clinical Chemitry. 55, (4), 611-622 (2009).
  16. Lock, M., Alvira, M. R., Chen, S. -J., Wilson, J. M. Absolute Determination of Single-Stranded and Self-Complementary Adeno-Associated Viral Vector Genome Titers by Droplet Digital PCR. Human Gene Therapy Methods. 25, (2), 115-125 (2014).
  17. Fittipaldi, M., et al. Discrimination of infectious bacteriophage T4 virus by propidium monoazide real-time PCR. Journal of Virological Methods. 168, (1-2), 228-232 (2010).
  18. Lodder, W. J., et al. Reduction of bacteriophage MS2 by filtration and irradiation determined by culture and quantitative real-time RT-PCR. Journal of Water and Health. 11, (2), 256-266 (2013).
  19. Brown-Jaque, M., et al. Antibiotic resistance genes in phage particles isolated from human feces and induced from clinical bacterial isolates. International Journal of Antimicrobial Agents. (2017).
  20. Naveca, F. G., et al. Multiplexed reverse transcription real-time polymerase chain reaction for simultaneous detection of Mayaro, Oropouche, and oropouche-like viruses. Memorias do Instituto Oswaldo Cruz. 112, (7), 510-513 (2017).
  21. Jia, J., et al. Simultaneous detection and differentiation of human parvovirus B19 and human parvovirus 4 by an internally controlled multiplex quantitative real-time PCR. Molecular and Cellular Probes. 36, 50-57 (2017).
  22. Bliem, R., et al. A novel triplex quantitative pcr strategy for quantification of toxigenic and nontoxigenic Vibrio cholerae in aquatic environments. Applied and Environmental Microbiology. 81, (9), 3077-3085 (2015).
  23. Wan, Z., Goddard, N. L. Competition Between Conjugation and M13 Phage Infection in Escherichia coli in the Absence of Selection Pressure: A Kinetic Study. G3 Genes|Genomes|Genetics. 2, (10), 1137-1144 (2012).
PCR quantitative du bactériophage T7 de criblage
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).More

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter