Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Quantitative PCR von Bakteriophagen T7 aus Biopanning

doi: 10.3791/58165 Published: September 27, 2018

Summary

Eine reproduzierbare und genaue Zeit effizientere quantitative PCR (qPCR) Methode aufzuzählenden T7 Bakteriophagen wird hier beschrieben. Das Protokoll beschreibt klar Phagen genomische DNA-Vorbereitung, PCR Reaktion Vorbereitung, qPCR Radsport Bedingungen und qPCR Datenanalyse.

Abstract

Dieses Protokoll beschreibt den Einsatz von quantitativen PCR (qPCR) aufzuzählenden Phagen T7 von Phagen Auswahl Experimente (z.B. "Biopanning"). qPCR ist eine Fluoreszenz basierenden Ansatz, DNA zu quantifizieren, und es hier angepasst, Phagen Genome als Proxy für den Phagen Partikel zu quantifizieren. In diesem Protokoll wird eine einfache Phagen DNA Vorbereitung Methode beschrieben mit Hochtemperatur-Heizung ohne zusätzliche DNA-Reinigung. Die Methode benötigt nur kleine Mengen an wärmebehandelten Phagen und Kleinmengen der qPCR Reaktion. qPCR ist Hochdurchsatz- und schnell, in der Lage, zu verarbeiten und erhalten Daten von einer 96-Well-Platte von Reaktionen im 2 – 4 h im Vergleich zu anderen Ansätzen Phagen-Enumeration, qPCR ist Zeit effizienter. Hier dient der qPCR aufzuzählenden T7 Phagen aus Biopanning gegen in-vitro- Mukoviszidose-artigen Schleim Modell identifiziert. Die qPCR-Methode kann ausgedehnt werden um Phagen T7 aus anderen Experimenten, einschließlich andere Arten von Biopanning zu quantifizieren (zB., immobilisiert Proteinbindung, in-vivo -Phagen-Screening) und anderen Quellen (z. B. Wasser-Systeme oder Körperflüssigkeiten). Zusammenfassend kann dieses Protokoll geändert werden, um DNA-gekapselte Viren quantifizieren.

Introduction

Bakteriophagen (Phagen)-Display-Technologie, entwickelt von George Smith 1985 ist ein leistungsfähiges, Hochdurchsatz-Ansatz Peptid oder Protein Liganden gegen Ziele oder Rezeptoren von der Zellmembran, Krankheit Antigene, zellulare Organellen oder spezifische identifizieren Organe und Gewebe in den vergangenen zwei Jahrzehnten1,2. Hier zufällige Bibliotheken der Polypeptide oder einzelne Kette Antikörper auf die Hüllproteine des Phagen (in der Regel M13 oder T7) angezeigt werden, und spezifische Liganden identifiziert werden, von panning gegen immobilisierten Proteine in Vitro oder in vivo biologischen Systemen durch einen iterativen Auswahlprozess. Dann können die Liganden mit bildgebenden oder therapeutischen Wirkstoffen für Diagnose und Behandlung von Krankheiten3,4gekoppelt werden. Ist es wichtig, genau Auflisten von Phagen in mehrere Stufen der Biopanning: (1), Phagen zu quantifizieren, die an das Substrat gebunden und (2) zu quantifizieren Phagen um festzustellen, ob Anreicherung mit jeder Runde Auswahl (Phagen Anreicherung zeigt Biopanned Phagen-Affinität für das Ziel). Der derzeitige Goldstandard für Quantifizierung, Doppelschicht-Plaque-Assay, Herausforderungen mehrere; Es ist langwierig, umständlich und möglicherweise ungenau für eine große Anzahl von Proben. Daher hat unsere Fraktion eine sensible, reproduzierbare, präzise und zeitsparend quantitative Polymerase Kettenreaktion (qPCR) Methode, um M13 und T7 Phagen Partikel aus Biopanning5aufzählen entwickelt.

qPCR ist eine attraktive und machbare Methode, T7 und M13 Phagen genau zu quantifizieren. Da jedes einzelnen Phagen Partikel nur eine Kopie der genomischen DNA (DsDNA oder SsDNA) enthalten kann, entspricht einem Phagen-Genom ein Phagen Partikel; durch die Zahl der Phagen Genome zu quantifizieren, ist es möglich, die Zahl der Phagen zu quantifizieren. Während qPCR, fluoreszierende Reporter Farbstoffe binden Phagen genomischer DNA unspezifisch oder speziell durch Sequenz-spezifische Primer während PCR Verstärkung und die Fluoreszenz Signal erhöht sich mit jeder Runde der Verstärkung. Wenn das Fluoreszenzsignal erreicht die Schwelle, die Runde/Zyklus der Verstärkung wird als der Schwellenwert-Zyklus (Ct) vermerkt. Die bekannten Konzentrationen von Referenz-Phagen DNA werden gegen ihre Ct-Werte herstellen eine Standardkurve geplottet. Mit der Ct-Werte von DNA-Proben der Standardkurve, können die Konzentrationen von Phagen interpoliert werden.

Während zahlreiche Strategien wurden zuvor entwickelt und intensiv genutzt, um Phagen aus Biopanning zu quantifizieren, hat jeder von ihnen spezifischen Herausforderungen. Die beliebtesten und konventionelle Methode ist Doppelschicht-Plaque-Assay. Hier, Host Bakterien mit Phagen vorbereitet in Verdünnungsreihen infiziert sind, sind auf einem festen Nährboden Substrat beschichtet und werden mit Agar überlagert; Phagen sind mit der Anzahl von Plaques gebildet (d. h. Plaque bildende Einheiten oder Pfu) auf der Agarplatte aufgezählt. Plaque-Assay ist sensibel aber mühsam, zeitaufwendig und ungenau, vor allem für zahlreiche Proben und mit hohen Konzentrationen5. Darüber hinaus wurden Enzym-linked Immunosorbentprobe Assays (ELISA) M13 und T7 Phagen Partikel6,7,8aufzählen angepasst. Hier werden Phagen bei verschiedenen Verdünnungen gebunden und auf ein festes Substrat (d. h. einer Mikrotestplatte) gebannt, sondiert mit Phagen-spezifische Antikörper und mithilfe von Reportern (z. B. Enzym empfindliche chromogene Substrate, Fluorophore) erkannt bestimmen Sie die Anzahl der Phagen Partikel vorhanden. Die anzeigen (z. B. Fluoreszenz, Absorption) der Proben können verwendet werden, zu unbekannte Konzentrationen gegen Phagen Standards bei bekannten Konzentrationen zu quantifizieren. Verschiedenen Phagen-basierte ELISAs entwickelt worden, aber sie haben mögliche Einschränkungen. Eine Gruppe entwickelte eine Papier-basierten Sandwich ELISA mit einer Quantifizierung-Palette, die überspannte sieben Größenordnungen (102-109 Pfu/mL); jedoch diese Methode erforderte mehrere Schritte der Antikörper-Beschichtung und dauerte bis einen ganzen Tag für den Assay-8. Unsere Fraktion auch entwickelt eine ELISA-Methode zur Quantifizierung der M13 Phagen Partikel aber hatte ein unempfindlicher Erfassungsbereich 106 bis 1011 Pfu/mL5. Schaltbare lanthanid Fluoreszenz Sonden wurden entwickelt, um M13 aufzählen und Quantifizierung Daten innerhalb von 20 min gewonnen werden; Dieser Test hat jedoch einen engen Dynamikbereich von 109 1012 Pfu/mL9. Eine Gruppe verwendet Rasterkraftmikroskopie M13 Phagen Partikel in Lösung aufzählen, aber dies erfordert erweiterte Elektronenmikroskopie und funktionierte nur in einem engen Bereich von Konzentrationen10. Eine weitere Studie zur trap fluoreszierender M13 und T4 Reporter Phagen und Phagen zählen, indem Sie die Anzahl der fluoreszierenden Tröpfchen Monodisperse Emulsionen; jedoch stellte dieser Ansatz auch eine schmale Quantifizierung reichen von 102 bis 106 Pfu/mL11. Während Tröpfchen, die digitale PCR verwendet wurde, um M13 Phagen zu quantifizieren, ist dieser Ansatz nicht in der Lage, zwischen der Anzahl der infektiösen und nicht infektiösen Phagen Partikel12zu unterscheiden.

Unsere Gruppe hat vor kurzem qPCR Methoden zum Auflisten von T7 und M13 Phagen aus Biopanning gegen ein Blut - Hirn-Schranke-Zelle-Modell mit zwei verschiedenen fluoreszierenden Reporter Farbstoffe5identifiziert entwickelt. Im Vergleich zu oben genannten Quantifizierungsmethoden, qPCR-Methoden, die wir entwickelt wurden Hochdurchsatz- und zeiteffizient zu zahlreichen Proben zu quantifizieren und in der Lage zu differenzieren zwischen infektiösen und nicht infektiösen Phagen mit DNase ich Vorbehandlung von der Phagen Proben. Wichtig ist, kann dieser Ansatz reproduzierbar und präzise M13 und T7 Bakteriophagen von Biopanning Proben quantifizieren. Um Anfänger Forscher auf dem Gebiet des Phagen qPCR zu leiten, beschreiben wir hier eine detaillierte qPCR-Methode, um T7 Phagen Partikel aus einer Cystein eingeschränkt Bibliothek (CX7C) gegen eine in-vitro- zystische Fibrose (CF) Schleim Barriere verrissen aufzählen. Aus dieser Arbeit kann qPCR-Methode erweitert werden um Phagen Partikel aus anderen Arten von Biopanning und aus anderen Quellen, einschließlich Wasser, Boden und Körperflüssigkeiten zu quantifizieren.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

(1) besser gekleideteres Design und Analyse für T7 Phagen genomischer DNA

  1. Primer für die Amplifikation der T7 Phagen genomischer DNA zu entwerfen.
    Hinweis: F (vorwärts) und R (rückwärts) Primer (siehe Tabelle der Materialien) verstärken die T7 DNA-Sequenz befindet sich oberhalb der Bibliothek Variable Region (Abbildung 1).
  2. Wählen Sie einen geeignete Grundierung-Analysator, Parameter der Primer, einschließlich Schmelztemperatur (Tm), prozentuale GC-Gehalt (GC %), Grundierung Dimere, Haarnadel Bildung und PCR-Eignung (Abbildung 1) zu bewerten.
  3. Bestellen Sie die Grundierung Oligonucleotides (Oligos), und bei der Ankunft, Aufschwemmen Sie lyophilisierter Oligos in DNase und RNase frei Ultrareines Wasser zu 100 µM Lager Konzentrationen in einem 1,5 mL Zentrifugenröhrchen, mehrere Monate bei-20 ° C lagern.
  4. Machen Sie mehrere Aliquote (rund 50 µL in jedem 1,5 mL-Röhrchen) von 100 µM-Grundierung-Lager.
    Hinweis: Dieser Schritt dient zur häufigen Frost-Tau-wechseln zu verhindern.

2. bereiten Sie Standards für die Quantifizierung der T7 Phagen genomischer DNA

  1. Verdünnen Sie Seriell 0,1 µg/µL (1,0 x 108 fg/µL) Referenz T7-Phagen-DNA (gekauft, bei einer bekannten Konzentration von 0,1 µg/µL, siehe Materialien) 10-divisibel von 1,0 x 106 bis 1.0 x 100 fg/µL mit hochreinem H2O in 0,2 mL PCR-Röhrchen. Bereiten Sie jede Konzentration in einem Gesamtvolumen von 20 µL (Abbildung 2).
  2. Vortex-Röhren die PCR dafür ein gründliches mischen bei jedem Schritt der Verdünnung. Ändern Sie auch Tipps, wenn Sie die folgenden Verdünnung DNA-Probe hinzufügen.
    Hinweis: Es wird empfohlen, neue Lösung von DNA-Standards für eine Standardkurve für jede Charge des Experiments qPCR vorzubereiten.
  3. Verwenden Sie die Gleichung 1 (unten), konvertieren Sie zu Referenzzwecken T7 Phagen DNA-Konzentrationen von fg/µL Genom Kopien (gc) /µL (Abbildung 2).
  4. T7-Phagen-DNA-Konzentration im gc/µL =
    Equation 1(1)
    Hinweis: bp: Basenpaar; Referenz T7 genomischer DNA ist 37314 bp.

(3) vor der Behandlung des Phagen Proben vor qPCR Reaktion Vorbereitung

  1. (Option 1) Pipettieren 20 µL einer T7 Klon (Phagen) ausgewählt aus Biopanning gegen in-vitro- zystische Fibrose (CF)-wie Schleim-Modell in 1,5 mL Zentrifuge Röhren. Hinzufügen von 1,25 Einheiten der DNase I (0,5 µL) zu jeweils 20 µL Probe.
    Hinweis: T7 Phagen Cystein eingeschränkte Heptapeptid Bibliothek (CX7C) war Biopanned gegen CF-artigen Schleim beschichtet 24 Wohlen Membran Einsätze (siehe Tabelle der Materialien) für 15 Minuten. Weitere Details sind in den Abschnitt "Ergebnisse" zur Verfügung gestellt. Eine T7 Klon wurde für qPCR Probenvorbereitung aus Eluat gewählt.
    1. Option 2: Pipettieren 200 µL T7 Klonen in einem 1,5 mL-Tuben, und fügen Sie 5 Einheiten der DNase ich
      (2 µL) zu jeder Probe.
      Hinweis: Die Lautstärke des Phagen Probe ausgewählt bei diesem Schritt richtet sich nach den Sammelband von Biopanning. Während des Protokolls auf der qPCR Biopanned Phagen konzentriert, kit denn Biopanning sind detailliert in der Benutzer-Protokoll von den Phagen T7 die Schritte (siehe Tabelle der Materialien)13.
  2. Verschließe die Phagen T7 Probenröhrchen (Schritt 3.1) und inkubieren sie bei 37 ° C für 10 min in einem beheizten Trockenbad (d. h. Heizblock).
  3. Inkubieren Sie Röhren (von Schritt 3.2) bei 100 ° C für 15 min in einem beheizten Trockenbad (Abb. 3A).
    Achtung: Da Verdampfung und Kondensation während der Heizung Schritt auftreten, stellen Sie sicher, dass die 1,5 mL Zentrifuge Rohre komplett verschlossen werden.
  4. Drehen der wärmebehandelten Phagen aus Schritt 3.3 18.534 x g für 10 S. Mix Phagen, indem das Rohr auf einem Vortex-Mixer eingestellt am Touch-Aktivierungsmodus für 10 s und Spin 18.534 x g für 10 s wieder.
    Hinweis: Der Spin-Mix-Schleuder ist um sicherzustellen, dass die beheizten Phagen Proben gut vermischt sind.
  5. Die Probenröhrchen bei Raumtemperatur (RT) indem man sie auf den Experiment-Bank oder Store bei 4 ° C im Kühlschrank über Nacht abkühlen.
    Hinweis: Experiment kann an dieser Stelle angehalten werden.

4. bereiten Sie qPCR Reaktionen

Hinweis: Eine PCR Reaktion ist für eine Probe. Jeder PCR-Reaktion enthält 5 µL qPCR Master mix (siehe Material), 1 µL 5 µM Primer paar Mix, H2O 2 µL und 2 µL wärmebehandelte T7-Phagen-Probe. Für mehrere PCR-Reaktionen sind alle Reagenzien mit Ausnahme von Phagen Probe in eine 1,5 mL Tube vorgemischt. Das Volumen der einzelnen Reagenz in der Vormischung hängt von der Anzahl der Phagen Proben für qPCR.

  1. 10 Biopanned Phagen unbekannter Konzentration und 7 Proben von standard-Konzentrationen in dreifacher Ausfertigung der qPCR-Premix vorbereiten. Infolgedessen gibt es 51 gesamt Proben und daher 51 qPCR Reaktionen (d. h. eine Reaktion je Probe). 51 Reaktionen zu bereiten eine Vormischung von 255 µL qPCR master-Mix (51 x 5 µL), 51 µL von Primern (51 x 1 µL) und H2O 102 µL (51 x 2 µL).
    Hinweis: Es wird empfohlen, ein paar zusätzliche PCR-Reaktionen zum Ausgleich der Volumenverlust während Aliquotierung des PCR-Mixes in jede Vertiefung der qPCR 96-Well-Platte vorzubereiten.
  2. Aliquoten 8 µL des PCR-Vormischung in jede Vertiefung der qPCR 96-Well-Platte für eine Gesamtmenge von 51 Brunnen (d. h. 51 qPCR Reaktionen). Es gibt keine Spitzenwechsel während Aliquotierung.
  3. Fügen Sie 2 µL der wärmebehandelten T7 Phagen Proben (Schritt 3.4) oder T7 Phagen Referenz DNA (Schritt 2.1) in jede Vertiefung (Abb. 3 b); Tipps zu ändern, wenn Sie verschiedene DNA-Proben zum Brunnen, um Kreuzkontaminationen zu vermeiden. Darüber hinaus verzichten Sie die 2 µL DNA-Proben unter der Oberfläche der qPCR Premix (d. h. in den 8 µL PCR Premix).
  4. Die qPCR Dichtplatte mit Klebefilm.
    Hinweis: Dieser Schritt ist wichtig, unabhängig von der Art der qPCR-Platte. Verwenden Sie das empfohlene Kit, um die Platte vollständig zu verschließen; Andernfalls wird eine nicht versiegelte Region in der Platte Volumenverlust führen, während der PCR Radfahren.
  5. Wickeln Sie die qPCR-Platte mit Aluminium-Folie, Immunofluoreszenz Fluoreszenz zu minimieren und fahren Sie mit auf die qPCR Ausrüstung ausgeführt.

5. qPCR Cycling Bedingungen

Hinweis: qPCR Radsport Bedingungen wurden auf die spezifischen qPCR Ausrüstung eingerichtet (siehe Tabelle der Materialien).

  1. Die qPCR 96-Well-Platte auf die qPCR-Ausrüstung ausgeführt. Am Gerät wählen Sie Einstellungen aus dem Menü zum Einrichten der folgenden experimentellen Bedingungen (Abbildung 3).
  2. Bedingungen wie folgt für ein Probenvolumen von 10 µL Radfahren eingerichtet: ein Zyklus bei 50 ° C für 2 min, ein Zyklus bei 95 ° C für 2 min, gefolgt von 40 Zyklen (95 ° C für 15 s, 60 ° C für 1 min). Danach laufen die Schmelze Kurveneinstellungen: ein Zyklus von 95 ° C für 15 s, 1 min, 60 ° C und 95 ° C 15 s.
  3. Fahren Sie fort, um die Daten zu analysieren, wie in Schritt 6 beschrieben.

6. der qPCR Rohdaten analysieren und Konvertieren von qPCR Ct Wert auf gc/µL für T7 Bakteriophagen

  1. Analysieren Sie die rohen qPCR-Daten und bewerten Sie die Qualität der Daten durch die Analyse der charakteristischen Grundstücke der raw-Daten (Abbildung 4).
    Hinweis: Amplification Plot, Mehrkomponenten Plot und Schmelze Kurve Handlung sind das Hauptmerkmal-plots, um die Datenqualität der qPCR validiert.
  2. Berechnen Sie die mittlere Zyklus (Ct) Schwellenwerte von dreifacher Proben bei jeder Konzentration der Standardkurve (Schritt 2.1).
    1. Plot-mittlere Ct (Y) gegen Log (gc/µL) (X) zu den linearen Kurve Y = kX + b (k ist die Steigung der linearen Kurve, b ist der Schnittpunkt).
    2. Berechnen Sie die lineare Koeffizient14 R2 (R2 muss sein > 0,99).
  3. Verwenden die Standardkurve Y = kX + b, um die Anzahl der Phagen T7 in den Biopanning Proben (z.B. Phagen gewählt gegen CF-artigen Schleim) im gc/µL (Abbildung 5) zu berechnen.
    Hinweis: k ist die Steigung der Standardkurve.
  4. Die Effizienz der Verstärkung durch die folgende Gleichung berechnen
    Equation 2(2)
    Hinweis: k ist die Steigung der Standardkurve generiert aus Referenz DNA qPCR. Die ideale Verstärkung Effizienz ist 90 – 110 %.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Verschiedene Primer-Design-Tools lässt sich qPCR Primer zu entwerfen. In der Regel ähneln besser gekleideteres Design Programme haben ihre eigenen eingebauten Algorithmen berechnen und validieren die Schlüsselparameter für die Grundierungen, z. B. GC %, Tm, Grundierung Dimer oder Haarnadel Bildung usw. in der Regel, die wichtigsten Kriterien in verschiedenen Grundierung-Design-Tools und Primer ist gestaltbar nach ihren Anweisungen. Grundierung BLAST kann verwendet werden, um die Spezifität der Primer zu bestätigen. Eine Grundierung zu koppeln, dass Ziele stromaufwärts der Variable Region der T7 genomischer DNA in Abbildung 1dargestellt ist. Um festzustellen, die unbekannten Konzentrationen von Phagen Proben aus Biopanning, ein absolutes wurde Quantifizierung Ansatz - Standardkurve Quantifizierung - aufzuzählenden Phagen genomischen DNA-Kopien gewählt. T7-Phagen-DNA zu verweisen (siehe Material) in einer bekannten Konzentration 0,1 µg/µL seriell von 1,0 x 10 verdünnt wurde0 bis 1.0 x 106 fg / µL. Gleichung 1 wurde verwendet, um konvertieren T7 Phagen-DNA-Konzentrationen von fg/µL Genom Kopien (gc) / µL; Referenz T7-Phagen-DNA-Konzentrationen wurden 2,66 x 101 bis 2,66 x 107 gc/µL (Abbildung 2).

Nach der Zubereitung von Verdünnungen von Referenz-DNA für die Standardkurve, war eine ausgewählte CX7C T7-Phagen qPCR (Abbildung 3A) vorbereitet. Kurz, um die Biopanning des ausgewählten Phagen zu beschreiben: eine Ausgangskonzentration von 4,2 x 109 Pfu T7 CX7C Phagen wurde hinzugefügt, auf der Oberseite der apikalen Fach (Spender) der eine Transwell Platte (siehe Tabelle der Materialien) mit 100 µL CF-wie Schleim und 600 µL Phosphat gepufferte Kochsalzlösung (PBS, siehe Tabelle of Materials) in der basolateralen Fach (Empfänger) und wurde für 15 min bei Raumtemperatur (25 ° C) inkubiert. Nach 15 min war das Eluat im Empfänger gesammelt; aus dem Eluat wählte einen CX7C T7-Klon mit qPCR quantifiziert werden. qPCR Reaktion Vorbereitung erfolgte auf Eis mit erforderlichen Reagenzien (z. B. qPCR master-Mix, Grundierungen, H2O), wie in Abbildung 3 bgezeigt. Die qPCR Radsport Bedingungen wurden auf einem qPCR Thermocycler eingerichtet, um die Proben laufen (siehe Tabelle der Materialien, Abbildung 3).

Nach der qPCR ausgeführt, die Verstärkung Plot, Schmelze Kurve Handlung und Mehrkomponenten-Diagramm (Abbildung 4) wurden aus den Rohdaten mit Hilfe der Software analysiert (siehe Tabelle der Materialien). Die Verstärkung-Plot zeigt den Erfolg oder Misserfolg der PCR-Amplifikation jeder Probe. Die Mehrkomponenten Handlung präsentiert Verstärkung und Zerfall des Fluoreszenzsignals (Reporter-Farbstoff SYBR und Hintergrund ROX Farbstoff) während der Amplifikation Zyklen. Die Schmelze Kurve Handlung wird verwendet, um die Spezifität der Primer zu validieren, da jeder PCR-Produkt eine einzigartige Schmelztemperatur (Tm hat).

Nach Bewertung der qPCR Rohdaten Qualität, wurde die Standardkurve generiert aus Referenz DNA: Ct-Werte (Y) über Log gc/µL (Konzentration Konvertierung in Abbildung 5dargestellten); Es war hier, Y =-3.5188 X + 35,09 (R2= 0,999) (Abbildung 5A und 5 b). Die Verstärkung Effizienz war 92,4 % berechnet. Die Standardkurve wurde verwendet, um die unbekannten Konzentrationen verdünnt T7 Phagen CX7C Klon basierend auf den Ct-Werten interpolieren. Alle Referenz und Phagen-Proben wurden in dreifacher Ausfertigung, und ihre mittlere Ct-Werte wurden verwendet, um DNA-Konzentration im gc/µL (Abbildung 5) zu berechnen. Erste Vorratslösung des T7-Klons wurde seriell verdünnt, um die Stabilität und Wiederholbarkeit der qPCR für die Enumeration von T7 Phagen5zu überprüfen. Bei jeder Verdünnung wurden Proben in dreifacher Ausfertigung erstellt. Die Doppelschicht-Plaque-Assay wurde als Referenzmethode verwendet, um die Konzentrationen von T7 Verdünnungen bestimmen; Methoden wurden beschrieben, vorher5. In Abbildung 6, die repräsentativen Ergebnisse von qPCR erscheinen im Vergleich zu Plaque-Assay an geprüften Bereich von 101 bis 107 gc / µL. Titer oder Anzahl der Phagen aus qPCR Quantifizierung waren höher als bei Doppelschicht-Plaque-Assay. Die Wiederholbarkeit der qPCR-Methode wird vertreten durch den Koeffizienten der Varianz (CV) bei Konzentrationen von 101 bis 107 gc/µL. Die Ergebnisse wurden in Tabelle 1dargestellt; die CV % reichten von 2,85 – 27,2 %.

Figure 1
Abbildung 1: besser gekleideteres Design für T7-415 Phagen DNA-Vektor und Schlüssel Parameter Analysen der gestalteten Primer. Oligo-Design-Tools wurden verwendet, um mehrere Paare von Grundierungen für T7-415 Phagen DNA zu entwerfen. Ein Satz wurde nach der Validierung der Schlüsselparameter der Zündkapseln, z. B. Tm, GC %, Primer-Dimer und Haarnadel Bildung ausgewählt. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: Vorbereitung der Standardkurve und Einheitenumrechnung von Phagen T7 verweisen DNA. 10-divisibel Verdünnungsreihen wurden von 0,1 µg/µL T7 Phagen Referenz DNA für eine Standardkurve. Gleichung 1 wurde verwendet, um DNA-Konzentrationen von fg/µL auf gc zu konvertieren / µL. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3: Phagen Probenbehandlung, qPCR Reaktion Vorbereitung und qPCR laufen. DNase ich T7 Phagen Proben vorbehandelt waren beheizt, bei 100° C für 15 min zur Freigabe der T7-DNA aus intakten Phagen Partikel (A); die qPCR-Mischung wurde vorbereitet, wie im Protokoll beschrieben. Alle Vorbereitungen fertig waren auf dem Eis (B); qPCR Ausrüstung und kompatible Software (C) wurden verwendet, um die PCR-Zyklen laufen Radfahren Bedingungen zu schaffen, zu erwerben und analysieren die raw-Daten. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4: charakteristische Grundstücke qPCR Rohdaten. Amplification Plot, Mehrkomponenten Plot und Schmelze Kurve Plotten wurden aus den Rohdaten qPCR eine T7 Phagen CX7C Klon von Biopanning gegen in-vitro- CF-artigen Schleim Barriere erworben. In der Mehrkomponenten-Handlung ist der passive Referenz Farbstoff (ROX) ein Dye-Molekül in der qPCR-master-Mix, der nicht in die PCR-Amplifikation teilnehmen und zeigen keine Verstärkung Signal in die Handlung einbezogen. SYBR, die SYBR grünen Farbstoff Molekül in der qPCR-master-Mix ist, bieten ein Fluoreszenzsignal, das sollte zu verstärken und zerfallen während qPCR Radfahren. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 5
Abbildung 5: Analyse der Rohdaten der qPCR gc/µL der T7 Phagen Partikel berechnen. Schwelle Zyklus (Ct) Werte der Standardkurve T7 Phagen Bezugspunkt DNA (Y) wurden aufgetragen gegen Logarithmus-Transformation der bekannten Konzentrationen von DNA auf gc/µL (X) die Standardkurve (A und B) zu bekommen. Die Standardkurve wurde verwendet, um die X (Log gc/µL) Werte der unbekannten Konzentrationen von Phagen Proben anhand ihrer Ct-Werte zu berechnen. (C) T7 Phagen-Konzentrationen im gc/µL errechnet werden. Berechnung der qPCR Verstärkung Effizienz steht auch zur Verfügung. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 6
Abbildung 6: Sensitivität und Reproduzierbarkeit Ergebnisse der qPCR aufzuzählenden eine T7-Klon aus Biopanning gegen in-vitro- CF-artigen Schleim Barriere. Eine T7 CX7C Phagen Klon aus Biopanning Experiment ausgewählt wurde serienmäßig in einem Konzentrationsbereich verdünnt (bezeichnet als E1-E7 darzustellende 101 bis 107) und in dreifacher Ausfertigung für qPCR und Doppelschicht-Plaque-Assay. QPCR und Doppelschicht-Plaque-Assay wurden verwendet, um die Konzentration des Phagen T7 Klons bei jeder Verdünnung zu quantifizieren. Daten wurden im Mittelwert mit der Standardabweichung (SD) bei jedem Maßstab für jede Behandlungsgruppe gezeigt. Bitte klicken Sie hier für eine größere Version dieser Figur.

Wiederholgenauigkeit
Konzentration (gc/µL) CV-Angaben in %
10 1 27.2
10 2 7.65
10 3 2,85
10 4 15.7
10 5 15.6
10 6 5.03
10 7 4.71

Tabelle 1: Reproduzierbarkeit der qPCR-Methode für einen Klon der T7-Phagen CX7C. Intra Variabilität wurde getestet auf Quantifizierung Skala von 101 bis 107 gc/µL für den T7-Klon DNA, die Variationskoeffizienten (CV) wurde berechnet als Verhältnis der Standardabweichung zum Mittelwert die Wiederholbarkeit der qPCR-Methode zum Ausdruck bringen. CVs wurden im Bereich von 2,85 – 27,2 % für getestete Konzentrationen berechnet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Wir qPCR-Methoden zur Quantifizierung von genomische DNA-Phagen5entwickelt, und wir hier beschrieben und eine qPCR-Methode zum Auflisten der T7 Phagen gewählt gegen eine CF-wie Schleim-Barriere angepasst. Mindestangaben für die Veröffentlichung der Quantitative Real-Time PCR Experimente (MIQE) Leitlinien wurden angepasst, um Entwicklung und Validierung der qPCR-Methode für die Enumeration von T7 Phagen15. Das Protokoll, die wir entwickelt, um die Phagen aus Biopanning Experimenten zu quantifizieren ist ein Zeit-effiziente, zuverlässige und kostengünstige Ansatz. Unser Protokoll für qPCR Probenvorbereitung nur Hochtemperaturbehandlung (100 ° C, 15 min) der Phagen-Lösung verwendet und erforderte keine Phagen DNA-Extraktion und Reinigung Schritte im Vergleich zu konventionellen Strategien11,17, 18. Außerdem wurde um genauer Phagen Partikel aufzuzählen, die Phagen-Lösung vor der Hochtemperatur-Behandlung gossene Phagen DNA-18,19,20entfernen DNase hinzugefügt. Non-gekapselte, passives DNA in der Phagen-Lösung kann aus Mangel an Kapselung während Phagen Verstärkung und/oder Abbau von Phagen Partikel führen. Infolgedessen ist um die Anzahl der intakten Phagen Partikel mit Hilfe ihrer genomischen DNA genau zu quantifizieren, DNase Vorbehandlung entscheidend artifactually hohe Werte von Phagen Genom Kopien zu verhindern.

Es gibt zahlreiche Überlegungen bei der Entwicklung und Verwendung von qPCR, Phagen genau zu quantifizieren. Variation der qPCR Daten kann auftreten, während das Protokoll und die folgenden berücksichtigt werden, genaue Aufzählung zu erreichen. Es ist wichtig, Phagen Lyse mit Hochtemperatur-Behandlung zu gewährleisten und hält Phagen Probenröhrchen in versiegelten Bedingungen nachfolgende Schwankungen der probenkonzentration durch Verdunstung und Kondensation von Wasser zu verhindern. Einem Gesamtvolumen von PCR-Reaktion ist klein und erfordert kalibrierte mehrkanalpipette und zuverlässige pipettieren Geschicklichkeit bei jedem Schritt der Probenvorbereitung. Während qPCR Radfahren zuverlässige Temperatur Steuerungsfunktion ist notwendig für genaue qPCR Daten und routinemäßige Kalibrierung der Thermocycler im qPCR Instrument ist erforderlich. Um Veränderung zu steuern, wurden alternative Schritte im Protokoll beschrieben. Wenn der Betreiber die Schwierigkeit des niedrigen Volumens pipettieren erfährt, kann die gesamte PCR-Reaktion auf 20 oder 25 µL skaliert. Das Protokoll erfordert neben der oben genannten Schritte zur Problembehandlung die interne Steuerung des standard-DNA-15,21,22,23. Als absolute Quantifizierungsmethode bestimmt der lineare Koeffizient der Standardkurve die Genauigkeit der Phagen-Enumeration Daten. Mit einer internen Kontrolle-DNA in der Probe kann die Abweichung von der Probenvorbereitung und qPCR Ausrüstung minimieren.

Im Vergleich zu den zuvor beschriebenen Phagen Quantifizierungsmethoden, unser Protokoll ermöglicht Enumeration einer breiten Palette von Phagen Konzentrationen und infektiösen und nicht infektiösen Phagen Partikel mit und ohne DNase-Behandlung zu unterscheiden. Unser Protokoll ist auch attraktiv für eine große Anzahl von Proben, so dass es kostengünstig, zeitsparend und hohen Durchsatz im Vergleich zu doppelte Schicht Plaque-Assay und andere Methoden zu quantifizieren.

Zusammenfassend lässt sich sagen kann dieses Protokoll aufzuzählenden Phagen Partikel in einer Vielzahl von Anwendungen, einschließlich in Vitro und in Vivo Biopanning, Phagen Bibliothek DNA-Vorbereitung in Next Generation Sequencing und Umwelt Phagen angepasst werden. Kontamination.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgments

Diese Arbeit wurde von PhRMA Stiftung Forschungsstipendium Starter unterstützt und das National Heart, Lung and Blood Institute der National Institutes of Health unter prämiennummer R01HL138251 gewähren.

Materials

Name Company Catalog Number Comments
Materials and Reagents
Primers for T7 genomic DNA IDT F: CCTCTTGGGAGGAAGAGATTTG
R: TACGGGTCTCGTAGGACTTAAT
T7 Select packaging control DNA EMD Millipore 69679-1UG
MicroAmp optical 96-well reaction plate ThermoFisher Scientific N8010560
qPCR master mix--Power up SYBR Green master mix Applied biosystems A25742
MicroAmp optical adhesive film kit ThermoFisher Scientific 4313663
T7Select 415-1 Cloning Kit EMD Millipore 70015 User protocols : http://www.emdmillipore.com/US/en/product/T7Select-415-1-Cloning-Kit,EMD_BIO-70015#anchor_USP
DNase I solution ThermoFisher Scientific 90083
24-well transwell plate Corning 3472
UltraPure DNase/RNase-Free Distilled H2O Invitrogen 10977015
Phosphate Buffered Saline (1x) Corning 21040CV
Name Company Catalog Number Comments
Equipments
ViiA7 Real-Time PCR System with Fast 96-Well Block ThermoFisher Scientific 4453535
Heraeus Pico 21 Microcentrifuge ThermoFisher Scientific 75002415
Fisherbrand Digital Vortex Mixer Fisher Scientific 02-215-370
HERMO SCIENTIFIC Multi-Blok Heater ThermoFisher Scientific Model:2001
Sorvall Legend X1 Centrifuge ThermoFisher Scientific 75004220
M-20 Microplate Swinging Bucket Rotor ThermoFisher Scientific 75003624
Name Company Catalog Number Comments
Software
QuantStudio Real-time PCR software ThermoFisher Scientific v1.2
Real-time qPCR primer design IDT
OligoAnalyzer 3.1 IDT

DOWNLOAD MATERIALS LIST

References

  1. Smith, G. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science. 228, (4705), 1315-1317 (1985).
  2. Smith, G. P., Petrenko, V. A. Phage Display. Chemical Reviews. 97, (96), 391-410 (1997).
  3. Sergeeva, A., Kolonin, M. G., Molldrem, J. J., Pasqualini, R., Arap, W. Display technologies: Application for the discovery of drug and gene delivery agents. Advanced Drug Delivery Reviews. 58, (15), 1622-1654 (2006).
  4. Dias-Neto, E., et al. Next-generation phage display: Integrating and comparing available molecular tools to enable costeffective high-throughput analysis. PLoS ONE. 4, (12), 1-11 (2009).
  5. Peng, X., Nguyen, A., Ghosh, D. Quantification of M13 and T7 bacteriophages by TaqMan and SYBR green qPCR. Journal of Virological Methods. 252, (June 2017), 100-107 (2017).
  6. Khan, M. S., Pande, T., Mvan de Ven, T. G. Qualitative and quantitative detection of T7 bacteriophages using paper based sandwich ELISA. Colloids and Surfaces B: Biointerfaces. 132, 264-270 (2015).
  7. Brasino, M., Lee, J. H., Cha, J. N. Creating highly amplified enzyme-linked immunosorbent assay signals from genetically engineered bacteriophage. Analytical Biochemistry. 470, 7-13 (2014).
  8. Yu, X., Burgoon, M., Shearer, A., Gilden, D. Characterization of phage peptide interaction with antibody using phage mediated immuno-PCR. J immunol Methods. 326, (1-2), 33-40 (2007).
  9. Lehmusvuori, A., Manninen, J., Huovinen, T., Soukka, T., Lamminmäki, U. Homogenous M13 bacteriophage quantification assay using switchable lanthanide fluorescence probes. BioTechniques. 53, (5), 301-303 (2012).
  10. Schlaman, H. R. M., et al. Analysis of interactions of signaling proteins with phage-displayed ligands by fluorescence correlation spectroscopy. Journal of Biomolecular Screening. 13, (8), 766-776 (2008).
  11. Tjhung, K. F., Burnham, S., Anany, H., Griffiths, M. W., Derda, R. Rapid enumeration of phage in monodisperse emulsions. Analytical Chemistry. 86, (12), 5642-5648 (2014).
  12. Reitinger, S., Petriv, O. I., Mehr, K., Hansen, C. L., Withers, S. G. Purification and quantitation of bacteriophage M13 using desalting spin columns and digital PCR. Journal of Virological Methods. 185, (1), 171-174 (2012).
  13. T7Select Biopanning Kit. Millipore Sigma. Available from: https://www.emdmillipore.com/US/en/product/T7Select-Biopanning-Kit,EMD_BIO-70018#anchor_USP (2018).
  14. Schneider, A., Hommel, G., Blettner, M. Linear Regression Analysis. Deutsches Ärzteblatt international. 107, (44), 776-782 (2010).
  15. Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggert, J. The MIQE Guidelines: Minimun information for publication of quantitative real-time PCR experiments. Clinical Chemitry. 55, (4), 611-622 (2009).
  16. Lock, M., Alvira, M. R., Chen, S. -J., Wilson, J. M. Absolute Determination of Single-Stranded and Self-Complementary Adeno-Associated Viral Vector Genome Titers by Droplet Digital PCR. Human Gene Therapy Methods. 25, (2), 115-125 (2014).
  17. Fittipaldi, M., et al. Discrimination of infectious bacteriophage T4 virus by propidium monoazide real-time PCR. Journal of Virological Methods. 168, (1-2), 228-232 (2010).
  18. Lodder, W. J., et al. Reduction of bacteriophage MS2 by filtration and irradiation determined by culture and quantitative real-time RT-PCR. Journal of Water and Health. 11, (2), 256-266 (2013).
  19. Brown-Jaque, M., et al. Antibiotic resistance genes in phage particles isolated from human feces and induced from clinical bacterial isolates. International Journal of Antimicrobial Agents. (2017).
  20. Naveca, F. G., et al. Multiplexed reverse transcription real-time polymerase chain reaction for simultaneous detection of Mayaro, Oropouche, and oropouche-like viruses. Memorias do Instituto Oswaldo Cruz. 112, (7), 510-513 (2017).
  21. Jia, J., et al. Simultaneous detection and differentiation of human parvovirus B19 and human parvovirus 4 by an internally controlled multiplex quantitative real-time PCR. Molecular and Cellular Probes. 36, 50-57 (2017).
  22. Bliem, R., et al. A novel triplex quantitative pcr strategy for quantification of toxigenic and nontoxigenic Vibrio cholerae in aquatic environments. Applied and Environmental Microbiology. 81, (9), 3077-3085 (2015).
  23. Wan, Z., Goddard, N. L. Competition Between Conjugation and M13 Phage Infection in Escherichia coli in the Absence of Selection Pressure: A Kinetic Study. G3 Genes|Genomes|Genetics. 2, (10), 1137-1144 (2012).
Quantitative PCR von Bakteriophagen T7 aus Biopanning
Play Video
PDF DOI

Cite this Article

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).More

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter