Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

T7 भोजी की मात्रात्मक पीसीआर panning से

doi: 10.3791/58165 Published: September 27, 2018

Summary

T7 भोजी की गणना करने के लिए एक reproducible, सटीक और समय कुशल मात्रात्मक पीसीआर (qPCR) विधि यहां वर्णित है । प्रोटोकॉल स्पष्ट रूप से वर्णन फेज जीनोमिक डीएनए तैयारी, पीसीआर रिएक्शन तैयारी, qPCR सायक्लिंग शर्तों, और qPCR डेटा विश्लेषण ।

Abstract

यह प्रोटोकॉल मात्रात्मक पीसीआर (qPCR) के उपयोग को फेज चयन प्रयोगों (यानी, "" panning ") से T7 phages की गणना करने के लिए वर्णन करता है । qPCR एक प्रतिदीप्ति-आधारित दृष्टिकोण डीएनए यों तो है, और यहां, यह फेज कणों के लिए एक प्रॉक्सी के रूप में फेज जीनोम यों तो है अनुकूलित है । इस प्रोटोकॉल में, एक सतही फेज डीएनए तैयारी विधि अतिरिक्त डीएनए शोधन के बिना उच्च तापमान हीटिंग का उपयोग करते हुए वर्णित है । विधि केवल गर्मी का इलाज phages और qPCR प्रतिक्रिया के छोटे संस्करणों की छोटी मात्रा की जरूरत है । qPCR उच्च प्रवाह और तेजी से, प्रक्रिया और एक ९६ से डेटा प्राप्त करने में सक्षम है-प्रतिक्रियाओं का अच्छी तरह से प्लेट में 2-4 एच अंय फेज गणन दृष्टिकोण की तुलना में, qPCR अधिक समय कुशल है । यहां, qPCR T7 के खिलाफ इन विट्रो सिस्टिक फाइब्रोसिस-बलगम मॉडल की तरह panning से पहचाना phages गणना करने के लिए प्रयोग किया जाता है । qPCR विधि अन्य प्रयोगों से T7 phages यों को बढ़ाया जा सकता है, जिसमें अन्य प्रकार की panning (जैसे, मैटीरियल प्रोटीन बाइंडिंग, विवो फेज स्क्रीनिंग में) और अन्य स्रोतों (जैसे, पानी की व्यवस्था या शरीर के तरल पदार्थ) शामिल हैं. संक्षेप में, इस प्रोटोकॉल के लिए किसी भी डीएनए-encapsulated वायरस यों तो संशोधित किया जा सकता है ।

Introduction

भोजी (फेज) प्रदर्शन प्रौद्योगिकी, १९८५ में जॉर्ज स्मिथ द्वारा विकसित की है, एक शक्तिशाली, उच्च प्रवाह दृष्टिकोण के लक्ष्य या कोशिका झिल्ली, रोग एंटीजन, सेलुलर organelles या विशिष्ट से रिसेप्टर्स के खिलाफ पेप्टाइड या प्रोटीन लाइगैंडों की पहचान है अंगों और ऊतकों पिछले दो दशकों में1,2. यहां, polypeptides या एकल चेन एंटीबॉडी के यादृच्छिक पुस्तकालयों phages (आमतौर पर M13 या T7) के कोट प्रोटीन पर प्रदर्शित कर रहे हैं, और विशिष्ट लाइगैंडों इन विट्रो में या vivo में मैटीरियल प्रोटीन के खिलाफ panning से पहचाना जा सकता है एक चलने चयन प्रक्रिया के माध्यम से जैविक प्रणालियों । फिर, लाइगैंडों3,4रोगों के निदान और उपचार के लिए इमेजिंग या चिकित्सकीय एजेंटों के साथ युग्मित किया जा सकता है । यह सही है की गणना करने के लिए phages के कई चरणों के दौरान सटीक: (1) सब्सट्रेट करने के लिए बाइंड करने के लिए phages है और (2) phages यों तो चयन के प्रत्येक दौर के साथ संवर्धन है निर्धारित करने के लिए (फेज संवर्धन panned इंगित करता है लक्ष्य के लिए फेज अपनत्व) । ठहराव, डबल परत पट्टिका परख के लिए वर्तमान सोने के मानक, कई चुनौतियां प्रस्तुत करता है; यह थकाऊ, बोझिल है, और संभावित नमूनों की एक बड़ी संख्या के लिए गलत है । इसलिए, हमारे समूह ने एक संवेदनशील, reproducible, सटीक और समय कुशल मात्रात्मक पोलीमरेज़ श्रृंखला प्रतिक्रिया (qPCR) विधि विकसित की है M13 और T75panning से फेज कणों की गणना करने के लिए ।

qPCR एक आकर्षक और व्यवहार्य विधि को सही मात्रा T7 और M13 phages है । के बाद से प्रत्येक व्यक्ति फेज कण केवल जीनोमिक डीएनए (dsDNA या ssDNA) की एक प्रति शामिल कर सकते हैं, एक फेज जीनोम एक फेज कण के बराबर है; फेज जीनोम की संख्या को बढ़ाता द्वारा, यह phages की संख्या यों तो संभव है । qPCR के दौरान, फ्लोरोसेंट रिपोर्टर रंजक फेज जीनोमिक डीएनए गैर विशेष रूप से या विशेष रूप से अनुक्रम के माध्यम से, पीसीआर प्रवर्धन के दौरान विशिष्ट प्राइमरों, और प्रतिदीप्ति संकेत वृद्धि के प्रत्येक दौर के साथ बढ़ जाती है । जब प्रतिदीप्ति संकेत दहलीज तक पहुँच जाता है, उस दौर/प्रवर्धन का चक्र दहलीज साइकिल (सीटी) के रूप में विख्यात है । संदर्भ फेज डीएनए के ज्ञात सांद्रता उनके सीटी मूल्यों के खिलाफ साजिश के लिए एक मानक वक्र स्थापित कर रहे हैं । डीएनए नमूनों की सीटी मूल्यों के साथ मानक वक्र का उपयोग करना, phages की सांद्रता दुओं जा सकता है ।

जबकि कई रणनीतियों पहले से विकसित किया गया है और बड़े पैमाने पर panning से phages यों तो इस्तेमाल किया, उनमें से प्रत्येक विशिष्ट चुनौतियों है । सबसे लोकप्रिय और पारंपरिक विधि डबल परत पट्टिका परख है । यहां, मेजबान जीवाणु सीरियल कमजोर पड़ने पर तैयार phages से संक्रमित हैं, एक ठोस आगर सब्सट्रेट पर चढ़ाया जाता है, और आगर के साथ मढ़ा जाता है; phages का गठन सजीले टुकड़े की संख्या के साथ गणना कर रहे हैं (यानी, पट्टिका बनाने इकाइयों या pfu) पर आगर प्लेट. पट्टिका परख संवेदनशील लेकिन थकाऊ, समय लेने वाली और गलत है, विशेष रूप से कई नमूनों के लिए और उच्च सांद्रता5के साथ है । इसके अतिरिक्त, एंजाइम से जुड़े immunosorbent परख (एलिसा) के लिए M13 और T7 फेज6 कणों,7,8गणना अनुकूलित किया गया है । यहां, विभिंन कमजोर पड़ने पर phages और बंधे है एक ठोस सब्सट्रेट पर कब्जा कर लिया (यानी, एक microplate), फेज के साथ जांच की विशिष्ट एंटीबॉडी, और रिपोर्टर का उपयोग करके पता चला (जैसे, एंजाइम संवेदनशील chromogenic सब्सट्रेट, fluorophores) वर्तमान फेज कणों की संख्या निर्धारित करते हैं । नमूनों की readouts (जैसे, प्रतिदीप्ति, अवशोषण) ज्ञात सांद्रता में फेज मानकों के खिलाफ अज्ञात सांद्रता यों तो इस्तेमाल किया जा सकता है । विभिंन फेज आधारित एलिसा विकसित की गई है लेकिन वे संभावित सीमाएं हैं । एक समूह एक ठहराव रेंज है कि परिमाण के सात आदेश फैले के साथ एक कागज आधारित सैंडविच एलिसा विकसित (102-109 pfu/ हालांकि, इस विधि एंटीबॉडी कोटिंग के कई कदम की आवश्यकता है और8परख के लिए एक पूरे दिन के लिए ले लिया । हमारे समूह ने भी M13 फेज कणों यों तो एक एलिसा विधि विकसित की है लेकिन एक कम संवेदनशील 106 से 1011 pfu/ स्विच lanthanide प्रतिदीप्ति जांच M13 की गणना करने के लिए विकसित किया गया है और ठहराव डेटा 20 मिनट के भीतर प्राप्त किया जा सकता है; हालांकि, इस परख 109 से 1012 pfu/एमएल9के एक संकीर्ण गतिशील रेंज है । एक समूह परमाणु बल माइक्रोस्कोपी समाधान में M13 फेज कणों की गणना करने के लिए इस्तेमाल किया, लेकिन इस उन्नत इलेक्ट्रॉन माइक्रोस्कोपी की आवश्यकता है और केवल10सांद्रता की एक संकीर्ण रेंज के भीतर काम किया. एक और अध्ययन फ्लोरोसेंट बूंदों की संख्या से फ्लोरोसेंट M13 और टी-4 रिपोर्टर phages और गिनती phages जाल monodisperse इमल्शन का इस्तेमाल किया; हालांकि, इस दृष्टिकोण भी 102 से 106 pfu/एमएल11से एक संकीर्ण ठहराव रेंज का प्रदर्शन किया । छोटी बूंद डिजिटल पीसीआर M13 phages यों तो इस्तेमाल किया गया है, इस दृष्टिकोण12संक्रामक और गैर संक्रामक फेज कणों की संख्या के बीच अंतर करने में असमर्थ है.

हमारे समूह ने हाल ही में qPCR तरीकों को विकसित किया है T7 और M13 phages एक रक्त मस्तिष्क बाधा सेल मॉडल के खिलाफ panning से पहचाना दो अलग फ्लोरोसेंट रिपोर्टर5रंजक का उपयोग कर । aforementioned ठहराव तरीकों की तुलना में, qPCR तरीकों हम विकसित उच्च प्रवाह और समय के लिए कई नमूनों और DNase मैं पूर्व उपचार के साथ संक्रामक और गैर संक्रामक phages के बीच अंतर करने में सक्षम कर रहे थे कुशल फेज नमूने । महत्वपूर्ण बात, इस दृष्टिकोण reproducibly और सही ढंग से panning नमूनों से M13 और T7 bacteriophages मात्रा कर सकते हैं । फेज qPCR के क्षेत्र में नौसिखिया शोधकर्ताओं गाइड करने के लिए, यहाँ हम एक विस्तृत qPCR विधि एक फेज-विवश पुस्तकालय से T7 cysteine कणों की गणना करने के लिए का वर्णन (CX7C) एक इन विट्रो सिस्टिक फाइब्रोसिस (CF) बलगम बाधा के खिलाफ panned. इस काम से, qPCR विधि अंय प्रकार की panning और पानी, मिट्टी, और शरीर के तरल पदार्थ सहित अंय स्रोतों से फेज कणों यों तो बढ़ाया जा सकता है ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. T7 फेज जीनोमिक डीएनए के लिए प्राइमर डिजाइन और विश्लेषण

  1. डिजाइन T7 फेज जीनोमिक डीएनए के प्रवर्धन के लिए प्राइमर ।
    नोट: एफ (आगे) और आर (रिवर्स) प्राइमर ( सामग्री की तालिकादेखें) T7 डीएनए अनुक्रम बढ़ाना पुस्तकालय चर क्षेत्र (चित्रा 1) के ऊपर स्थित है ।
  2. प्राइमरों के मानकों का मूल्यांकन करने के लिए एक उपयुक्त प्राइमर विश्लेषक चुनें, पिघलने तापमान सहित (Tm), प्रतिशत जीसी सामग्री (जीसी%), प्राइमरी dimers, hairpin गठन और पीसीआर उपयुक्तता (चित्रा 1) ।
  3. आदेश प्राइमर oligonucleotides (ओलिगोस्पर्मिया), और आगमन पर, DNase में lyophilized ओलिगोस्पर्मिया resuspend और RNase मुक्त अल्ट्रा शुद्ध पानी के लिए एक १.५ एमएल केंद्रापसारक ट्यूब में १०० µ एम शेयर सांद्रता बनाने के लिए, और दुकान पर-20 डिग्री सेल्सियस कई महीनों के लिए ।
  4. १०० µ एम प्राइमरी स्टॉक के कई aliquots (प्रत्येक १.५ मिलीलीटर ट्यूब में लगभग ५० µ एल) बनाओ ।
    नोट: यह कदम लगातार फ्रीज-गल चक्र को रोकने के लिए प्रयोग किया जाता है ।

2. T7 फेज जीनोमिक DNA के ठहराव के लिए मानक तैयार करना

  1. प्रश्नपत्र पतला ०.१ µ g/µ l (१.० x 108 fg/µ l) संदर्भ T7 फेज डीएनए (खरीदी; ०.१ µ g/µ l की एक ज्ञात एकाग्रता में, सामग्री देखें) 10 गुना से १.० x 106 करने के लिए १.० x 100 fg/µ l के साथ अल्ट्रा शुद्ध एच2ओ में ०.२ मिलीलीटर पीसीआर ट्यूबों । 20 µ l (चित्रा 2) की कुल मात्रा में प्रत्येक एकाग्रता तैयार करते हैं.
  2. पीसीआर ट्यूबों को कमजोर पड़ने के हर कदम पर पूरी तरह से मिश्रण सुनिश्चित करने के भंवर । इसके अलावा, जब निंनलिखित कमजोर पड़ने के लिए डीएनए नमूना जोड़ने के सुझाव बदलें ।
    नोट: यह qPCR प्रयोग के हर बैच के लिए एक मानक वक्र के लिए डीएनए मानकों के नए समाधान तैयार करने के लिए सिफारिश की है ।
  3. T7 फेज संदर्भ डीएनए सांद्रता fg/µ एल से जीनोम प्रतियां (gc)/µ l (चित्रा 2) के लिए परिवर्तित करने के लिए समीकरण 1 (नीचे) का उपयोग करें ।
  4. gc/µ l = में T7 फेज डीएनए एकाग्रता
    Equation 11
    नोट: bp: आधार युग्म; संदर्भ T7 जीनोमिक डीएनए ३७३१४ बीपी है ।

3. qPCR रिएक्शन तैयारी से पहले फेज नमूनों का प्री-ट्रीटमेंट

  1. (विकल्प 1) प्लास्टिक 20 µ एल एक T7 क्लोन (फेज) के खिलाफ में इन विट्रो सिस्टिक फाइब्रोसिस (CF) से चयनित-१.५ मिलीलीटर केंद्रापसारक ट्यूबों में बलगम मॉडल की तरह । प्रत्येक 20 µ l नमूना के लिए DNase I (०.५ µ l) की १.२५ इकाइयां जोड़ें ।
    नोट: T7 फेज cysteine विवश heptapeptide पुस्तकालय (CX7C) CF के खिलाफ panned-की तरह बलगम लेपित पर 24-well झिल्ली आवेषण ( सामग्री की तालिकादेखें) के लिए 15 मिनट. परिणाम अनुभाग में अधिक विवरण प्रदान किए गए हैं । एक T7 क्लोन eluate से qPCR नमूना तैयारी के लिए चुना गया था ।
    1. विकल्प 2: प्लास्टिक २०० µ एल T7 क्लोन के एक १.५ मिलीलीटर ट्यूबों में, और जोड़ने के 5 इकाइयों DNase मैं
      (2 µ एल) प्रत्येक नमूने के लिए ।
      नोट: इस चरण में चयनित फेज नमूना की मात्रा panning से एकत्र की मात्रा पर निर्भर करता है. जबकि प्रोटोकॉल का ध्यान panned फेज के qPCR पर है, panning के लिए कदम T7 फेज किट के उपयोगकर्ता प्रोटोकॉल में विस्तृत रहे हैं ( सामग्री की तालिकादेखें)13.
  2. टोपी T7 फेज नमूना ट्यूबों (चरण ३.१) और उन्हें एक गर्म शुष्क स्नान में 10 मिनट के लिए ३७ डिग्री सेल्सियस पर मशीन (यानी, हीट ब्लॉक).
  3. एक गर्म शुष्क स्नान (चित्रा 3ए) में 15 मिनट के लिए १०० डिग्री सेल्सियस पर (३.२ कदम से) मशीन ट्यूब ।
    चेतावनी: के बाद से वाष्पीकरण और संघनित्र हीटिंग कदम के दौरान हो, सुनिश्चित करें कि १.५ मिलीलीटर केंद्रापसारक ट्यूबों पूरी तरह से छाया हुआ है ।
  4. स्पिन हीट-इलाज phages से कदम ३.३ पर १८,५३४ x g के लिए 10 एस । टच-एक्टिवेशन मोड पर 10 एस के लिए सेट भंवर मिक्सर पर ट्यूब रखकर phages मिश्रण, और 10 एस के लिए १८,५३४ x g पर स्पिन फिर से ।
    नोट: स्पिन-मिश्रण-स्पिन चक्र गर्म फेज नमूने अच्छी तरह से मिश्रित कर रहे हैं सुनिश्चित करने के लिए है.
  5. कमरे के तापमान पर नमूना ट्यूबों शांत (आरटी) उंहें प्रयोग पीठ पर छोड़ने या एक फ्रिज में 4 डिग्री सेल्सियस पर स्टोर रातोंरात ।
    नोट: इस चरण में प्रयोग को रोका जा सकता है ।

4. qPCR प्रतिक्रियाओं को तैयार

नोट: एक पीसीआर प्रतिक्रिया एक नमूना के लिए है । प्रत्येक पीसीआर रिएक्शन में 5 µ एल ऑफ qPCR मास्टर मिक्स (see सामग्री), 1 µ l के 5 µ एम प्राइमरी पेयर मिक्स, 2 µ एल के एच2ओ और 2 µ एल के हीट का इलाज T7 फेज के सैंपल शामिल हैं । कई पीसीआर प्रतिक्रियाओं के लिए, फेज नमूना को छोड़कर सभी एजेंट एक १.५ मिलीलीटर ट्यूब में मिश्रित कर रहे हैं । premix में प्रत्येक रिएजेंट की मात्रा qPCR के लिए फेज नमूनों की संख्या पर निर्भर करता है ।

  1. अज्ञात एकाग्रता और तपसिल में मानक सांद्रता के 7 नमूनों के 10 panned फेज नमूनों के लिए qPCR premix तैयार करें । एक परिणाम के रूप में, वहाँ रहे हैं ५१ कुल नमूनों और इसलिए, ५१ qPCR प्रतिक्रियाओं (यानी, नमूना प्रति एक प्रतिक्रिया). ५१ प्रतिक्रियाओं के लिए, qPCR मास्टर मिक्स (51x 5 µ l) के २५५ µ l का एक premix तैयार करें, ५१ µ एल ऑफ प्राइमर्स (51x 1 µ l), और १०२ µ एल ऑफ एच2ओ (51x 2 µ एल) ।
    नोट: यह ९६-well qPCR प्लेट के प्रत्येक कुआं में पीसीआर मिश्रण aliquoting के दौरान मात्रा घटाने के लिए क्षतिपूर्ति करने के लिए कुछ अतिरिक्त पीसीआर प्रतिक्रियाओं को तैयार करने के लिए सिफारिश की है ।
  2. Aliquot 8 µ एल के प्रत्येक कुआं में ९६-५१ कुओं की कुल के लिए अच्छी तरह से qPCR प्लेट (यानी, ५१ qPCR प्रतिक्रियाओं) । aliquoting के दौरान सुझावों को बदलने की जरूरत नहीं है ।
  3. गर्मी के इलाज T7 फेज नमूनों की 2 µ एल जोड़ें (३.४ कदम) या T7 फेज संदर्भ डीएनए (चरण २.१) के लिए एक अच्छी तरह से (आंकड़ा 3 बी); परिवर्तन युक्तियां जब अलग डीएनए नमूने को जोड़ने के लिए अच्छी तरह से पार संक्रमण को रोकने के । इसके अलावा, qPCR premix की सतह के नीचे 2 µ एल डीएनए नमूने वितरण (यानी, 8 µ एल पीसीआर premix में) ।
  4. चिपकने वाली फिल्म के साथ qPCR प्लेट सील ।
    नोट: यह चरण qPCR प्लेट के प्रकार की परवाह किए बिना, महत्वपूर्ण है । पूरी तरह से प्लेट सील करने के लिए अनुशंसित किट का उपयोग करें; अन्यथा, प्लेट में किसी भी गैर-सीलबंद क्षेत्र पीसीआर साइकिल चालन के दौरान मात्रा हानि का कारण होगा ।
  5. प्रतिदीप्ति photobleaching को कम करने के लिए एल्यूमीनियम पंनी के साथ qPCR प्लेट लपेटें और इसे qPCR उपकरण पर चलाने के लिए आगे बढ़ना ।

5. qPCR सायक्लिंग शर्तें

नोट: qPCR सायक्लिंग शर्तों विशिष्ट qPCR उपकरण पर स्थापित किया गया ( सामग्री की तालिकादेखें) ।

  1. qPCR उपकरण पर ९६-well qPCR प्लेट चलाते हैं । उपकरण पर, निंन प्रायोगिक शर्तों (चित्र 3सी) को सेट करने के लिए मेनू से सेटिंग्स का चयन करें ।
  2. 10 µ एल का एक नमूना मात्रा के लिए इस प्रकार के रूप में सायक्लिंग शर्तों सेट करें: एक चक्र के लिए ५० ° c पर 2 मिनट, एक चक्र के लिए ९५ ° c पर 2 मिनट, ४० चक्र के बाद के लिए (९५ ° c के लिए 15 s, ६० ° c 1 मिनट के लिए). इसके बाद, पिघल वक्र सेटिंग्स चलाने के लिए: एक चक्र के लिए ९५ ° c 15 s, ६० ° c 1 मिनट के लिए, और ९५ ° c 15 s.
  3. चरण 6 में वर्णित के रूप में डेटा का विश्लेषण करने के लिए आगे बढ़ें ।

6. qPCR रॉ डेटा का विश्लेषण और qPCR सीटी मूल्य से gc/µ एल के लिए T7 Bacteriophages के लिए कंवर्ट

  1. कच्चे qPCR डेटा का विश्लेषण और कच्चे डेटा (चित्रा 4) के विशिष्ट भूखंडों का विश्लेषण करके डेटा की गुणवत्ता का मूल्यांकन ।
    नोट: प्रवर्धन भूखंड, multicomponent भूखंड और पिघल वक्र भूखंड qPCR के डेटा की गुणवत्ता को मांय करने के लिए प्रमुख विशेषता भूखंड हैं ।
  2. मानक वक्र (चरण २.१) के प्रत्येक एकाग्रता पर तपसिल नमूनों से माध्य थ्रेशोल्ड चक्र (सीटी) मूल्यों की गणना.
    1. भूखंड मतलब सीटी (y) के खिलाफ लॉग (gc/µ l) (X) रैखिक वक्र प्राप्त करने के लिए y = kX + b (k रेखीय वक्र की ढलान है, b अवरोधन है).
    2. रेखीय गुणांक14 r2 (r2 होना चाहिए > 0.99) की गणना ।
  3. का प्रयोग करें मानक वक्र Y = kX + b T7 phages की संख्या की गणना करने के लिए panning नमूनों में (यानी, phages के खिलाफ CF-जैसे बलगम का चयन) gc/µ l (चित्रा 5).
    नोट: k मानक वक्र की ढलान है ।
  4. निंनलिखित समीकरण द्वारा प्रवर्धन क्षमता की गणना
    Equation 22
    नोट: कश्मीर संदर्भ डीएनए qPCR से उत्पंन मानक वक्र की ढलान है । प्रवर्धन क्षमता की आदर्श सीमा 90-110% है ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

अलग प्राइमर डिजाइन उपकरण qPCR प्राइमरों डिजाइन करने के लिए इस्तेमाल किया जा सकता है । आम तौर पर, प्राइमर डिजाइन कार्यक्रमों की गणना करने और प्राइमरों के प्रमुख मापदंडों को मान्य करने के लिए अपने स्वयं के एल्गोरिदम में बनाया गया है, जैसे, जीसी%, टीएम, प्राइमरी डिमर या hairpin गठन, आदि आम तौर पर, प्रमुख मानदंड अलग में समान हैं प्राइमर डिजाइन उपकरण, और प्राइमर उनके निर्देशों के बाद डिजाइन किया जा सकता है । प्राइमरी ब्लास्ट प्राइमरियों की विशिष्टता की पुष्टि के लिए किया जा सकता है । T7 जीनोमिक डीएनए के चर क्षेत्र के ऊपर लक्ष्य है कि एक प्राइमरी जोड़ी चित्रा 1में दिखाया गया है । panning से फेज नमूनों की अज्ञात सांद्रता निर्धारित करने के लिए, एक निरपेक्ष ठहराव दृष्टिकोण-मानक वक्र ठहराव-फेज जीनोमिक डीएनए प्रतियां गणना करने के लिए चुना गया था. संदर्भ T7 फेज डीएनए (सामग्री देखें) एक ज्ञात एकाग्रता में ०.१ µ g/µ l का प्रश्नपत्र पतला था १.० x 100 से १.० x 106 fg/µ एल । 1 समीकरण T7 फेज डीएनए सांद्रता fg/µ एल से जीनोम प्रतियां (gc)/µ एल में परिवर्तित करने के लिए इस्तेमाल किया गया था; संदर्भ T7 फेज डीएनए सांद्रता थे २.६६ x 101 to २.६६ x 107 gc/µ l (चित्रा 2).

मानक वक्र के लिए संदर्भ डीएनए के कमजोर पड़ने की तैयारी के बाद, एक चयनित CX7C T7 फेज qPCR (आंकड़ा 3ए) के लिए तैयार किया गया था । संक्षेप में, चयनित फेज के panning का वर्णन करने के लिए: ४.२ x 109 pfu T7 CX7C फेज की एक प्रारंभिक एकाग्रता शिखर डिब्बे (एक Transwell प्लेट के दाता) के शीर्ष पर जोड़ा गया था ( सामग्री की तालिकादेखें) १०० µ एल युक्त CF-बलगम की तरह और फास्फेट के ६०० µ एल खारा (पंजाबियों, सामग्री की तालिकादेखें) basolateral डिब्बे (रिसीवर) में और कमरे के तापमान (25 डिग्री सेल्सियस) पर 15 मिनट के लिए मशीन था । 15 मिनट के बाद, रिसीवर में eluate एकत्र किया गया था; eluate से, एक CX7C T7 क्लोन qPCR द्वारा quantified के लिए चुना गया था । qPCR रिएक्शन तैयारी आवश्यक रिएजेंट के साथ बर्फ पर प्रदर्शन किया गया था (जैसे, qPCR मास्टर मिक्स, प्राइमर, एच2ओ), के रूप में चित्र 3 बीमें दिखाया गया है । qPCR सायक्लिंग शर्तों नमूनों को चलाने के लिए एक qPCR thermocycler पर स्थापित किया गया ( सामग्री की तालिका, 3 सी चित्रदेखें) ।

qPCR चलाने के बाद, प्रवर्धन भूखंड, पिघल वक्र भूखंड और multicomponent भूखंड (चित्रा 4) रॉ सॉफ्टवेयर का उपयोग कर डेटा से विश्लेषण किया गया ( सामग्री की तालिकादेखें) । प्रवर्धन भूखंड सफलता या प्रत्येक नमूने के पीसीआर प्रवर्धन की विफलता को इंगित करता है । multicomponent भूखंड प्रवर्धन और प्रवर्धन चक्र भर में प्रतिदीप्ति संकेत (रिपोर्टर डाई SYBR और पृष्ठभूमि ROX डाई) के क्षय प्रस्तुत करता है. पिघल वक्र भूखंड के बाद से प्रत्येक पीसीआर उत्पाद एक अद्वितीय पिघलने तापमान (Tm) है प्राइमरों की विशिष्टता को मांय करने के लिए प्रयोग किया जाता है ।

qPCR कच्चे डेटा की गुणवत्ता के मूल्यांकन के बाद, मानक वक्र संदर्भ डीएनए से उत्पंन किया गया था: सीटी मूल्यों (Y) पर लॉग gc/µ l (एकाग्रता रूपांतरण चित्रा 5में दिखाया गया); यहां, यह था Y =-३.५१८८ X + ३५.०९ (R2= ०.९९९) (चित्र 5 ए और 5B)। प्रवर्धन क्षमता ९२.४% होने की गणना की गई । मानक वक्र उनके सीटी मूल्यों के आधार पर पतला T7 फेज CX7C क्लोन की अज्ञात सांद्रता लगाना करने के लिए इस्तेमाल किया गया था । सभी संदर्भ नमूने और फेज नमूने तपसिल में चलाए गए थे, और उनके मतलब सीटी मूल्यों gc/µ एल में डीएनए एकाग्रता की गणना करने के लिए इस्तेमाल किया गया (चित्रा 5). T7 क्लोन के आरंभिक स्टॉक समाधान T7 phages5के गणन के लिए qPCR की स्थिरता और दोहराव को मान्य करने के लिए प्रश्नपत्र पतला था । प्रत्येक कमजोर पड़ने पर, नमूनों को तपसिल में तैयार किया गया । डबल परत पट्टिका परख T7 कमजोर पड़ने की सांद्रता निर्धारित करने के लिए एक संदर्भ विधि के रूप में इस्तेमाल किया गया था; तरीके पहले5बताए गए थे । चित्रा 6में, qPCR से प्रतिनिधि परिणाम 101 से 107 gc/µ एल Titers या qPCR quantitation से phages की संख्या के परीक्षण की सीमा पर पट्टिका परख की तुलना में दिखाए जाते है डबल परत पट्टिका परख से अधिक थे । qPCR विधि की पुनरावृत्ति 101 से 107 gc/µ एल से सांद्रता के लिए प्रसरण के गुणांक (CV) द्वारा प्रतिनिधित्व किया है । परिणाम तालिका 1में दिखाए गए थे; CV% 2.85 से लेकर-27.2% ।

Figure 1
चित्रा 1: T7 के लिए प्राइमर डिजाइन-415 फेज डीएनए वेक्टर और डिजाइन प्राइमरों के प्रमुख मापदंडों विश्लेषण । Oligo डिजाइन उपकरण T7-415 फेज डीएनए के लिए प्राइमरों के कई जोड़े डिजाइन करने के लिए इस्तेमाल किया गया । एक सेट प्राइमरों के प्रमुख मापदंडों के सत्यापन के बाद चुना गया था, जैसे, Tm, जीसी%, प्राइमर-डिमर और hairpin गठन । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2: मानक वक्र तैयारी और T7 फेज संदर्भ डीएनए की इकाई रूपांतरण । सीरियल 10 गुना कमजोर पड़ने से ०.१ µ g/µ l T7 फेज संदर्भ डीएनए से एक मानक वक्र के लिए किए गए थे । 1 समीकरण को fg/µ एल से gc/µ एल से डीएनए सांद्रता परिवर्तित करने के लिए उपयोग किया गया था कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्र ३: फेज नमुना उपचार, qPCR प्रतिक्रिया वडा र qPCR भएन । DNase मैं T7 फेज नमूनों 15 मिनट के लिए बरकरार फेज कणों से T7 डीएनए जारी करने के लिए १०० डिग्री सेल्सियस पर गरम किया गया इलाज (); qPCR मिश्रण को प्रोटोकॉल में वर्णित के रूप में तैयार किया गया था । सभी तैयारियों बर्फ () पर किया गया; qPCR उपकरण और संगत सॉफ्टवेयर (सी) के लिए साइकल शर्तों की स्थापना, पीसीआर साइकिल चलाने के लिए, अधिग्रहण, और कच्चे डेटा का विश्लेषण किया गया । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्रा 4: qPCR कच्चे डेटा की विशेषता भूखंडों । प्रवर्धन भूखंड, multicomponent भूखंड और पिघल वक्र भूखंड एक T7 फेज CX7C क्लोन के खिलाफ इन विट्रो CF-बलगम बैरियर की तरह से qPCR कच्चे डेटा से अधिग्रहीत किया गया । multicomponent भूखंड में, निष्क्रिय संदर्भ डाई (ROX) qPCR मास्टर मिश्रण है कि पीसीआर प्रवर्धन में भाग नहीं करता है में शामिल एक डाई अणु है और साजिश में कोई प्रवर्धन संकेत दिखाएगा । SYBR, जो qPCR मास्टर मिश्रण में SYBR हरी डाई अणु है, एक प्रतिदीप्ति संकेत है कि बढ़ाना चाहिए और qPCR साइकिल चालन के दौरान क्षय प्रदान करेगा । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 5
चित्रा 5: T7 फेज कणों की gc/µ एल की गणना करने के लिए qPCR के कच्चे डेटा का विश्लेषण. दहलीज साइकिल (सीटी) T7 फेज संदर्भ डीएनए (वाई) के मानक वक्र के मूल्यों को मानक वक्र ( और बी) पाने के लिए जीसी/µ एल (एक्स) में संदर्भ डीएनए के ज्ञात सांद्रता के लघुगणक परिवर्तन के खिलाफ साजिश रची गई । मानक वक्र एक्स की गणना करने के लिए इस्तेमाल किया गया था (gc/µ एल) फेज नमूनों की अज्ञात सांद्रता के मूल्यों उनके सीटी मूल्यों पर आधारित है । () gc/µ l में T7 फेज सांद्रता की गणना की जा सकती है. इसके अलावा, qPCR प्रवर्धन क्षमता की गणना प्रदान की जाती है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 6
चित्रा 6: संवेदनशीलता और qPCR के दोहराव परिणामों के खिलाफ इन विट्रो CF-बलगम बाधा की तरह panning से एक T7 क्लोन गणना करने के लिए । एक T7 CX7C फेज panning प्रयोग से चयनित क्लोन एक एकाग्रता रेंज में पतला था (चिह्नित के रूप में E1-E7 101 से 107का प्रतिनिधित्व करने के लिए) और तपसिल और डबल परत पट्टिका परख के लिए qPCR में । दोनों qPCR और डबल परत पट्टिका परख के लिए प्रत्येक कमजोर पड़ने पर T7 फेज क्लोन की एकाग्रता मात्रा का इस्तेमाल किया गया । प्रत्येक उपचार समूह के लिए प्रत्येक स्केल पर मानक विचलन (SD) के साथ डेटा माध्य मान में दिखाया गया था. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Repeatability
एकाग्रता (gc/µ एल) % में सीवी डेटा
10 1 २७.२
10 2 ७.६५
10 3 २.८५
10 4 १५.७
10 5 १५.६
10 6 ५.०३
10 7 ४.७१

तालिका 1: एक T7 फेज CX7C क्लोन के लिए qPCR विधि की पुनरावृत्ति । इंट्रा परिवर्तनशीलता 101 से 107 gc/µ एल के ठहराव पैमाने पर T7 क्लोन डीएनए के लिए परीक्षण किया गया था, भिन्नता के गुणांक (CV) मानक विचलन के अनुपात के रूप में qPCR विधि की पुनरावृत्ति व्यक्त करने के लिए माध्य करने के लिए गणना की गई थी. सीवी 2.85 की श्रेणी में गणना की गई-27.2% पर परीक्षण सांद्रता के लिए ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

हम विकसित qPCR तरीके फेज जीनोमिक डीएनए यों तो5, और यहां हम वर्णित है और एक qPCR विधि T7 phages एक CF-बलगम की तरह बाधा के खिलाफ चयनित गणना करने के लिए अनुकूलित । मात्रात्मक रीयल-टाइम पीसीआर प्रयोगों (MIQE) दिशानिर्देशों के प्रकाशन के लिए न्यूनतम जानकारी विकसित करने और T7 phages15के गणन के लिए qPCR विधि को मान्य करने के लिए अनुकूलित किया गया था । प्रोटोकॉल हम panning प्रयोगों से phages यों तो विकसित एक समय है, कुशल, विश्वसनीय, और किफायती दृष्टिकोण । qPCR नमूना तैयारी के लिए हमारे प्रोटोकॉल केवल उच्च तापमान उपचार (१०० ° c, फेज समाधान के 15 मिनट) का इस्तेमाल किया और फेज डीएनए निष्कर्षण और शुद्धि कदम की आवश्यकता नहीं थी पारंपरिक रणनीतियों11,17की तुलना में, 18. इसके अलावा, और अधिक सही फेज कणों की गणना करने के लिए, DNase फेज समाधान करने के लिए पहले उच्च तापमान उपचार करने के लिए जोड़ा गया था गैर encapsulated फेज डीएनए18,19,20। गैर encapsulated, फेज समाधान में अवशिष्ट डीएनए फेज प्रवर्धन और/या फेज कणों के क्षरण के दौरान encapsulation की कमी से परिणाम हो सकता है । एक परिणाम के रूप में, अपने जीनोमिक डीएनए का उपयोग कर बरकरार फेज कणों की संख्या को सही मात्रा में, DNase पूर्व उपचार फेज जीनोम प्रतियां के artifactually उच्च मूल्यों को रोकने के लिए महत्वपूर्ण है ।

वहां विकास और qPCR का उपयोग करने के लिए सही phages मात्रा में कई विचार कर रहे हैं । qPCR डेटा की भिन्नता प्रोटोकॉल भर में हो सकता है और सटीक गणन प्राप्त करने के लिए निम्न माना जाना चाहिए । यह उच्च तापमान उपचार के साथ फेज lysis सुनिश्चित करने और पानी की वाष्पीकरण और संघनित्र के कारण नमूना एकाग्रता में बाद में उतार चढ़ाव को रोकने के लिए सीलबंद स्थितियों में फेज नमूना ट्यूबों रखने के लिए महत्वपूर्ण है । पीसीआर रिएक्शन की कुल मात्रा छोटी है और नमूना तैयारी के हर कदम पर नपे pipets और विश्वसनीय pipetting कौशल की आवश्यकता है । qPCR सायक्लिंग के दौरान, विश्वसनीय तापमान नियंत्रण समारोह सटीक qPCR डेटा के लिए आवश्यक है, और qPCR साधन में थर्मल साइकिल चालक की दिनचर्या अंशांकन की जरूरत है । भिंनता को नियंत्रित करने के लिए, प्रोटोकॉल में वैकल्पिक चरण बताए गए । अगर ऑपरेटर कम वॉल्यूम pipetting की कठिनाई का अनुभव करता है, तो कुल पीसीआर रिएक्शन को 20 या 25 µ तक स्केल किया जा सकता है l समस्या निवारण के लिए aforementioned चरणों के अलावा, प्रोटोकॉल मानक डीएनए15,21,22,23के आंतरिक नियंत्रण की आवश्यकता है । एक निरपेक्ष ठहराव विधि के रूप में, मानक वक्र के रेखीय गुणांक फेज गणन डेटा की शुद्धता निर्धारित करता है । नमूना रन में एक आंतरिक नियंत्रण डीएनए का उपयोग नमूना तैयारी और qPCR उपकरणों से भिन्नता को कम कर सकते हैं.

पहले वर्णित फेज ठहराव तरीकों की तुलना में, हमारे प्रोटोकॉल फेज सांद्रता की एक विस्तृत श्रृंखला के गणन की अनुमति देता है और संक्रामक और गैर संक्रामक फेज कणों के साथ और DNase उपचार के बिना अंतर कर सकते हैं । इसके अलावा, हमारे प्रोटोकॉल नमूनों की एक बड़ी संख्या को बढ़ाता है, यह और अधिक लागत प्रभावी, समय के कुशल, और उच्च प्रवाह डबल परत पट्टिका परख और अंय तरीकों की तुलना में बनाने के लिए आकर्षक है ।

सारांश में, इस प्रोटोकॉल के लिए आवेदनों की एक किस्म में फेज कणों की गणना करने के लिए अनुकूलित किया जा सकता है, इन विट्रो में और सहित vivo में, अगली पीढ़ी के अनुक्रमण में फेज पुस्तकालय डीएनए तैयारी, और पर्यावरणीय फेज संदूषण.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

यह काम PhRMA फाउंडेशन रिसर्च स्टार्टर अनुदान और राष्ट्रीय हार्ट, फेफड़े, और स्वास्थ्य अनुदान के राष्ट्रीय संस्थानों के रक्त संस्थान पुरस्कार संख्या R01HL138251 के तहत द्वारा समर्थित किया गया था ।

Materials

Name Company Catalog Number Comments
Materials and Reagents
Primers for T7 genomic DNA IDT F: CCTCTTGGGAGGAAGAGATTTG
R: TACGGGTCTCGTAGGACTTAAT
T7 Select packaging control DNA EMD Millipore 69679-1UG
MicroAmp optical 96-well reaction plate ThermoFisher Scientific N8010560
qPCR master mix--Power up SYBR Green master mix Applied biosystems A25742
MicroAmp optical adhesive film kit ThermoFisher Scientific 4313663
T7Select 415-1 Cloning Kit EMD Millipore 70015 User protocols : http://www.emdmillipore.com/US/en/product/T7Select-415-1-Cloning-Kit,EMD_BIO-70015#anchor_USP
DNase I solution ThermoFisher Scientific 90083
24-well transwell plate Corning 3472
UltraPure DNase/RNase-Free Distilled H2O Invitrogen 10977015
Phosphate Buffered Saline (1x) Corning 21040CV
Name Company Catalog Number Comments
Equipments
ViiA7 Real-Time PCR System with Fast 96-Well Block ThermoFisher Scientific 4453535
Heraeus Pico 21 Microcentrifuge ThermoFisher Scientific 75002415
Fisherbrand Digital Vortex Mixer Fisher Scientific 02-215-370
HERMO SCIENTIFIC Multi-Blok Heater ThermoFisher Scientific Model:2001
Sorvall Legend X1 Centrifuge ThermoFisher Scientific 75004220
M-20 Microplate Swinging Bucket Rotor ThermoFisher Scientific 75003624
Name Company Catalog Number Comments
Software
QuantStudio Real-time PCR software ThermoFisher Scientific v1.2
Real-time qPCR primer design IDT
OligoAnalyzer 3.1 IDT

DOWNLOAD MATERIALS LIST

References

  1. Smith, G. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science. 228, (4705), 1315-1317 (1985).
  2. Smith, G. P., Petrenko, V. A. Phage Display. Chemical Reviews. 97, (96), 391-410 (1997).
  3. Sergeeva, A., Kolonin, M. G., Molldrem, J. J., Pasqualini, R., Arap, W. Display technologies: Application for the discovery of drug and gene delivery agents. Advanced Drug Delivery Reviews. 58, (15), 1622-1654 (2006).
  4. Dias-Neto, E., et al. Next-generation phage display: Integrating and comparing available molecular tools to enable costeffective high-throughput analysis. PLoS ONE. 4, (12), 1-11 (2009).
  5. Peng, X., Nguyen, A., Ghosh, D. Quantification of M13 and T7 bacteriophages by TaqMan and SYBR green qPCR. Journal of Virological Methods. 252, (June 2017), 100-107 (2017).
  6. Khan, M. S., Pande, T., Mvan de Ven, T. G. Qualitative and quantitative detection of T7 bacteriophages using paper based sandwich ELISA. Colloids and Surfaces B: Biointerfaces. 132, 264-270 (2015).
  7. Brasino, M., Lee, J. H., Cha, J. N. Creating highly amplified enzyme-linked immunosorbent assay signals from genetically engineered bacteriophage. Analytical Biochemistry. 470, 7-13 (2014).
  8. Yu, X., Burgoon, M., Shearer, A., Gilden, D. Characterization of phage peptide interaction with antibody using phage mediated immuno-PCR. J immunol Methods. 326, (1-2), 33-40 (2007).
  9. Lehmusvuori, A., Manninen, J., Huovinen, T., Soukka, T., Lamminmäki, U. Homogenous M13 bacteriophage quantification assay using switchable lanthanide fluorescence probes. BioTechniques. 53, (5), 301-303 (2012).
  10. Schlaman, H. R. M., et al. Analysis of interactions of signaling proteins with phage-displayed ligands by fluorescence correlation spectroscopy. Journal of Biomolecular Screening. 13, (8), 766-776 (2008).
  11. Tjhung, K. F., Burnham, S., Anany, H., Griffiths, M. W., Derda, R. Rapid enumeration of phage in monodisperse emulsions. Analytical Chemistry. 86, (12), 5642-5648 (2014).
  12. Reitinger, S., Petriv, O. I., Mehr, K., Hansen, C. L., Withers, S. G. Purification and quantitation of bacteriophage M13 using desalting spin columns and digital PCR. Journal of Virological Methods. 185, (1), 171-174 (2012).
  13. T7Select Biopanning Kit. Millipore Sigma. Available from: https://www.emdmillipore.com/US/en/product/T7Select-Biopanning-Kit,EMD_BIO-70018#anchor_USP (2018).
  14. Schneider, A., Hommel, G., Blettner, M. Linear Regression Analysis. Deutsches Ärzteblatt international. 107, (44), 776-782 (2010).
  15. Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggert, J. The MIQE Guidelines: Minimun information for publication of quantitative real-time PCR experiments. Clinical Chemitry. 55, (4), 611-622 (2009).
  16. Lock, M., Alvira, M. R., Chen, S. -J., Wilson, J. M. Absolute Determination of Single-Stranded and Self-Complementary Adeno-Associated Viral Vector Genome Titers by Droplet Digital PCR. Human Gene Therapy Methods. 25, (2), 115-125 (2014).
  17. Fittipaldi, M., et al. Discrimination of infectious bacteriophage T4 virus by propidium monoazide real-time PCR. Journal of Virological Methods. 168, (1-2), 228-232 (2010).
  18. Lodder, W. J., et al. Reduction of bacteriophage MS2 by filtration and irradiation determined by culture and quantitative real-time RT-PCR. Journal of Water and Health. 11, (2), 256-266 (2013).
  19. Brown-Jaque, M., et al. Antibiotic resistance genes in phage particles isolated from human feces and induced from clinical bacterial isolates. International Journal of Antimicrobial Agents. (2017).
  20. Naveca, F. G., et al. Multiplexed reverse transcription real-time polymerase chain reaction for simultaneous detection of Mayaro, Oropouche, and oropouche-like viruses. Memorias do Instituto Oswaldo Cruz. 112, (7), 510-513 (2017).
  21. Jia, J., et al. Simultaneous detection and differentiation of human parvovirus B19 and human parvovirus 4 by an internally controlled multiplex quantitative real-time PCR. Molecular and Cellular Probes. 36, 50-57 (2017).
  22. Bliem, R., et al. A novel triplex quantitative pcr strategy for quantification of toxigenic and nontoxigenic Vibrio cholerae in aquatic environments. Applied and Environmental Microbiology. 81, (9), 3077-3085 (2015).
  23. Wan, Z., Goddard, N. L. Competition Between Conjugation and M13 Phage Infection in Escherichia coli in the Absence of Selection Pressure: A Kinetic Study. G3 Genes|Genomes|Genetics. 2, (10), 1137-1144 (2012).
T7 भोजी की मात्रात्मक पीसीआर panning से
Play Video
PDF DOI

Cite this Article

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).More

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter