Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Biopanning에서 t 7 살 균 소의 양이 많은 PCR

doi: 10.3791/58165 Published: September 27, 2018

Summary

재현, 정확 하 고 시간이 효율적인 정량 PCR (정량) 방법 살 균 소 T7 열거 하는 여기에 설명 되어 있습니다. 프로토콜에는 살 균 소 게놈 DNA 준비, PCR 반응 준비, 정량 자전거 조건, 및 정량 데이터 분석 명확 하 게 설명합니다.

Abstract

이 프로토콜 T7 페이지 페이지 선택 실험 (즉, "biopanning")에서 열거 하 양이 많은 PCR (정량)의 사용을 설명 합니다. 정량은 DNA, 계량에 형광 기반의 접근 그리고 여기, 살 균 소 게놈 살 균 소 입자에 대 한 프록시로 계량에 적응. 이 프로토콜에서 추가적인 DNA 정화 없이 높은 온도 난방을 사용 하 여 손쉬운 살 균 소 DNA 준비 방법을 설명 합니다. 메서드를 사용 하면 열 처리 페이지의 작은 볼륨 및 정량 반응의 작은 볼륨에만 필요합니다. 정량은 높은 처리량 및 빠르고, 처리 하 고 다른 페이지 열거 방법에 2-4 헤 비교에에서 반응의 96 잘 접시에서 데이터를 가져올 수, 정량 시간 효율적입니다. 여기, 정량은 낭 성 섬유 증 같은 점액 모델 생체 외에서 biopanning에서 식별 T7 페이지를 열거 하는 데 사용 됩니다. 정량 방법 척도 biopanning의 다른 종류를 포함 하 여 다른 실험에서 T7 페이지를 확장할 수 있습니다 (., 단백질 바인딩, vivo에서 움직일 수 살 균 소 심사) 및 기타 소스 (예: 시스템 또는 체액). 요약 하자면,이 프로토콜 DNA 캡슐화 바이러스 척도를 수정할 수 있습니다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

살 균 소 (살 균 소) 디스플레이 기술, 1985 년, 조지 스미스에 의해 개발은 대상 또는 세포 막, 질병 항 원, 세포 세포 또는 특정 수용 체에 대 한 펩 티 드 또는 단백질 ligands를 식별 하는 강력한, 높은 처리량 접근 장기 고 지난 2 년간1,2조직. 여기, polypeptides 또는 단일 체인 항 체의 임의의 라이브러리 페이지 (일반적으로 M13 또는 T7)의 외 투 단백질에 표시 되 고 특정 ligands 고정된 단백질에 생체 외에서 또는 vivo에서 이동에서 확인할 수 있습니다. 반복 선택 과정을 통해 생물 시스템입니다. 다음, ligands 질병3,4의 진단 및 치료에 대 한 이미징 또는 치료 에이전트와 결합 될 수 있습니다. 그것은 정확 하 게 biopanning의 여러 단계 중 페이지를 열거 하는 중요 한: (1) 계량 기판에 바인딩할 페이지 (2) 하 고 선택의 각 라운드 농축 인지 확인 하려면 페이지를 계량 (살 균 소 농축 나타냅니다 biopanned 살 균 소 선호도 대상에 대 한)입니다. 정량화, 더블 레이어 패 분석 결과, 현재 금 표준에는 여러 과제가; 그것은 지루한, 성가신, 잠재적으로 많은 수의 샘플에 대 한 부정 확 한입니다. 따라서, 우리의 그룹 T7, M13 살 균 소 입자 biopanning5에서 열거 하는 민감한, 재현 하 고, 정확 하 고 효율적인 시간 정량적 중 합 효소 연쇄 반응 (정량) 방법을 개발 했습니다.

정량 Pcr T7 및 M13 페이지를 정확 하 게 계량 하는 매력적이 고 실현 가능한 방법 이다. 때문에 각 개별 살 균 소 입자 (dsDNA 또는 ssDNA) 게놈 DNA의 복사본을 하나 포함할 수 있습니다, 한 살 균 소 게놈은 한 살 균 소 입자; 살 균 소 게놈의 수를 측정, 페이지의 수를 정할 수 있다. 정량, 형광 기자 중 염료 비 특히 살 균 소 게놈 DNA 바인딩 또는 PCR 증폭, 동안 시퀀스 특정 뇌관 그리고 형광을 통해 구체적으로 신호 증폭의 각 라운드 증가. 형광 신호 그 라운드/사이클 확대의 임계값에 도달 하는 때 임계값 주기 (Ct)으로 유명 하다. 참조 살 균 소 DNA의 알려진된 농도 표준 곡선을 설정할 Ct 값에 대 한 구성 됩니다. DNA 샘플의 Ct 값으로 표준 곡선을 사용 하 여 페이지의 농도 보간됩니다 수 있습니다.

동안 수많은 전략 이전 개발 되었고 페이지 biopanning에서 척도를 광범위 하 게 사용, 그들 각각의 구체적인 과제는. 가장 인기 있는 하 고 기존의 방법은 더블 레이어 패 분석 결과입니다. 여기, 호스트 박테리아 감염 페이지 직렬 희석에 준비 된, 고체 agar 기판에 도금 및 천;와 겹쳐 페이지 수 플 라크 형성 (즉, 플 라크 형성 단위 또는 pfu) 한 천 배지에서의 열거 됩니다. 상 패 분석 결과 이며 민감한 하지만 지루한, 시간이 정확 하지 않은, 특히 많은 예제와 높은 농도5. 또한, 효소 연결 된 immunosorbent 분석 실험 (ELISA) T7, M13 살 균 소 입자6,7,8열거 적응 되었습니다. 여기, 페이지 다른 희석에 묶여있다 고 고체 기판 (즉, 한 미 판), 살 균 소 특정 항 체를 탐지 캡처하고 기자 (예를 들어, 효소 민감한 비 기판, fluorophores)를 사용 하 여 검색 현재 살 균 소 입자의 수를 결정 합니다. 샘플의 정보 (예를 들어, 형광, 흡 광도) 알려진된 농도에서 살 균 소 표준에 대 한 알 수 없는 농도 척도를 사용할 수 있습니다. 살 균 소 기반 ELISAs 개발 되었습니다 하지만 그들은 잠재적인 제한 다른. 한 그룹 개발 종이 기반 샌드위치 ELISA를 7 배나 (10-1029 pfu/mL); 부 량 범위 그러나,이 방법은 항 체 코팅의 여러 단계를 필요한 그리고8분석 결과 대 한 전체 하루에 최대 했다. 우리의 그룹 또한 M13 살 균 소 입자를 계량 하는 ELISA 방법 개발 했지만 10의 덜 민감한 감지 범위6  1011 pfu/mL5. M13 열거 하 전환 란타넘족 형광 프로브를 개발 하 고 20 분; 내 부 량 데이터를 얻을 수 있습니다. 그러나,이 분석 결과 10의 좁은 동적 범위 1012 pfu/mL99 . 한 그룹 솔루션, M13 살 균 소 입자를 열거할 원자 힘 현미경 검사 법을 사용 하지만이 고급 전자 현미경 필요 농도10의 좁은 범위 내에서 일했다. 또 다른 연구 형광 M13 및 T4 기자 페이지를 트랩 및 형광 방울; 수로 페이지를 단 분산 유화 제 사용 그러나,이 접근은 또한 10에서 좁은 부 량 범위 전시 106 pfu/mL112 . 드롭릿 디지털 PCR M13 페이지를 계량 하는 데 사용 되었습니다, 동안이 접근은 전염 성 및 비 전염 성 살 균 소 입자12의 번호를 수 없습니다.

우리의 그룹 최근 정량 방법을 열거 하는 두 개의 서로 다른 형광 기자 염료5를 사용 하 여 혈액-뇌 장벽 세포 모델에 대 한 biopanning에서 식별 T7 및 M13 페이지를 개발 했습니다. 상기 정량화 방법에 비해 정량 방법 개발 되었고 높은 처리량 및 수많은 샘플을 계량 시간 효율적인 DNase와 전염 성 및 비 전염 성 페이지 구분 나 전처리의 수는 살 균 소 샘플입니다. 중요 한 것은,이 이렇게 수 reproducibly 고 정확 하 게 계량 M13 및 T7 biopanning 샘플에서 살 균 소. 살 균 소 정량의 지역에 있는 연구원은 초보자 안내, 여기 우리가 T7 살 균 소 입자 시스테인 제한 된 라이브러리 (CX7C)에서 한 체 외에 낭 성 섬유 증 (CF) 점액 장벽에 대 한 패닝 열거 하는 상세한 정량 방법을 설명 합니다. 이 작품에서 정량 방법 살 균 소 입자와 물, 토양, 및 체액을 포함 하 여 다른 소스에서 biopanning의 다른 종류에서 계량을 확장할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. 뇌관 디자인 및 T7 살 균 소 게놈 DNA에 대 한 분석

  1. T7 살 균 소 게놈 DNA의 확대를 위한 뇌관 디자인.
    참고: F (앞으로)와 R (반전) 뇌관 ( 재료의 표참조) T7 DNA 순서를 증폭 라이브러리 변수 영역 (그림 1) 상류에 위치.
  2. 용융 온도 (Tm), 백분율 GC 내용 (GC %), 뇌관 이합체, 머리 핀 형성 및 PCR 적합성 (그림 1)를 포함 한 뇌관의 매개 변수를 평가 하는 적절 한 뇌관 분석기를 선택 하십시오.
  3. 뇌관 oligonucleotides (oligos), 주문 그리고 도착 시 DNase과 RNase 무료 울트라 순수 물 1.5 mL 원심 분리기 튜브, 100 µ M 재고 농도 확인 하 고 몇 달 동안-20 ° C에서 저장에 동결 건조 된 oligos resuspend.
  4. 100 µ M 뇌관의 여러 aliquots (각 1.5 mL 튜브에 약 50 µ L)을 확인 합니다.
    참고:이 단계는 자주 freeze-thaw 주기를 방지 하기 위해 사용 됩니다.

2. t 7 살 균 소 게놈 DNA의 정량화에 대 한 표준 준비

  1. 직렬로 0.1 µ g / µ L (1.0 x 108 fg / µ L) 참조 T7 살 균 소 DNA를 희석 (구입, 0.1 µ g / µ L의 알려진된 농도에 자료 참조) 10 1.0 x 10에서6 100 fg / µ L 울트라 순수 H2O 0.2 mL PCR 튜브에 x 1.0. 20 µ L (그림 2)의 총 볼륨의 각 농도 준비 합니다.
  2. 소용돌이 PCR 튜브 희석의 각 단계에서 철저 하 게 혼합 되도록 합니다. 또한, 다음 희석에 DNA 샘플을 추가할 때 팁을 변경 합니다.
    참고: 그것은 정량 실험의 모든 일괄 처리에 대 한 표준 곡선에 대 한 DNA 표준의 새로운 솔루션을 준비 하 고 좋습니다.
  3. 방정식 1 (아래)를 사용 하 여 변환할 T7 페이지 참조에 대 한 DNA 농도 fg / µ L에서 게놈 복사본 (gc) /µL (그림 2).
  4. T7 gc / µ L에서 살 균 소 DNA 농도 =
    Equation 1(1)
    참고: bp: 기본 쌍; 참조 T7 genomic DNA는 37314 혈압.

3. 살 균 소 샘플 전에 정량 Pcr 반응 준비의 전처리

  1. (옵션 1) 피펫으로 20 µ L 한 T7 클론 (살 균 소)의 낭 성 섬유 증 (CF) 생체 외에서 에 대 한 biopanning에서 선택-1.5 mL 원심 분리기 튜브로 점액 모델 처럼. 1.25 단위의 DNase 추가 나 (0.5 µ L) 각 20 µ L 샘플을.
    참고: T7 페이지 시스테인 제한 heptapeptide 라이브러리 (CX7C)은 15 분 동안 24-잘 막 삽입 ( 재료의 표참조)에 코팅 하는 CF 같은 점액에 대 한 biopanned. 자세한 내용은 결과 섹션에서 제공 됩니다. T7 클론이 eluate에서 정량 샘플 준비를 위해 선택 되었다.
    1. 옵션 2: 피펫으로 200 µ L는 t 7의 1.5 mL 튜브에 복제 하 고 5 단위의 DNase 추가 나
      (2 µ L) 각 샘플을.
      참고:이 단계에서 선택 하는 살 균 소 견본의 볼륨 biopanning에서 수집 된 볼륨에 따라 달라 집니다. Biopanned 살 균 소의 정량에는 프로토콜의 포커스를 실행 하는 동안 단계 biopanning T7 페이지의 사용자 프로토콜에 자세한 키트 ( 재료의 표참조)13.
  2. T7 페이지 샘플 튜브 (3.1 단계)을 닫습니다 그리고 온수 건조 목욕 (즉, 열 블록)에 10 분 동안 37 ° C에서 그들을 품 어.
  3. 튜브 (3.2 단계)에서 열된 건조 목욕 (그림 3A)에서 15 분 100 ° C에서 품 어.
    주의: 증발 및 응축 열 단계 동안 발생, 이후 1.5 mL 원심 분리기 튜브 완전히 덮인 있는지 확인 합니다.
  4. 10 미 믹스 10 s, 및 18,534 x g 10에서 스핀 터치 활성화 모드와 동 믹서에 튜브를 삽입 하 여 페이지 설정에 대 한 18,534 x g 에서 3.3 단계에서 열 처리 페이지를 회전 s 다시.
    참고:가 열된 살 균 소 샘플 잘 혼합 되도록 스핀-믹스-스핀 사이클이입니다.
  5. 밤새 실험 벤치 또는 냉장고에서 4 ° C에서 저장소에 그들을 떠나는 하 여 실 온 (RT)에서 샘플 튜브를 식혀.
    참고: 실험은이 단계에는 일시 중지 될 수 있습니다.

4. 정량 Pcr 반응 준비

참고: 한 PCR 반응 한 샘플입니다. 각 PCR 반응 포함 5 µ L 정량 마스터의 믹스 (자료 참조), 5 µ M 뇌관 쌍 믹스의 1 µ L, H2O 2 µ L, 2 µ L 열 처리 T7 페이지 샘플의. 다중 PCR 반응에 대 한 살 균 소 샘플을 제외 하 고 모든 시 약 한 1.5 mL 튜브에 혼합 됩니다. 각 시에는 프리 믹스의 볼륨 정량에 대 한 살 균 소 견본의 수에 따라 달라 집니다.

  1. 알 수 없는 농도의 10 biopanned 페이지 샘플 및 3 중에서 표준 농도의 7 샘플에 대 한 정량 프리 믹스를 준비 합니다. 그 결과, 51 총 샘플 및 따라서 51 정량 반응 (즉, 샘플 당 하나의 반응) 있다. 51 반응에 대 한 255 µ L 정량 마스터 믹스 (51 x 5 µ L), 뇌관 (51 x 1 µ L)의 51 µ L 및 H2O의 102 µ L의 (2 µ L x 51)의 프리 믹스를 준비 합니다.
    참고: 그것 aliquoting 96 잘 정량 플레이트의 각 음에 PCR 혼합 하는 동안 볼륨 손실에 대 한 보상을 몇 가지 추가 PCR 반응 준비 하 고 좋습니다.
  2. Aliquot 8 µ L 51 우물 (즉, 51 정량 반응)의 총에 대 한 정량 96 잘 접시의 각 음에 PCR 프리 믹스의. Aliquoting 중 팁을 변경할 필요가 있다.
  3. 열 처리 T7 페이지 샘플 (단계 3.4)의 2 µ L 또는 T7 페이지 참조 DNA (단계 2.1) 각 잘 (그림 3B);를 추가합니다 교차 오염을 방지 하기 위해 잘에 다른 DNA 샘플을 추가할 때 팁을 변경 합니다. 또한, 정량 프리 믹스 (즉, 8 µ L PCR 섞으로은)의 표면 아래에 2 µ L DNA 샘플 분배.
  4. 접착 필름으로 정량 접시를 봉인.
    참고:이 단계는 중요 한 정량 접시의 유형에 관계 없이. 권장된 키트를 사용 하 여 완전히; 접시를 봉인 그렇지 않으면, 모든 봉인 지역 접시에 PCR 동안 볼륨 손실 하면 사이클링.
  5. 형광 photobleaching를 최소화 하기 위해 알루미늄 호 일 정량 플레이트 랩 고 정량 장비에 그것을 실행.

5입니다. 정량 사이클링 조건

참고: 정량 자전거 조건 설정 했다 특정 정량 장비에 ( 재료의 표참조).

  1. 정량 Pcr 장비에서 정량 96 잘 접시를 실행 합니다. 장비, 다음과 같은 실험 조건 (그림 3C)를 설정 하는 메뉴에서 설정을 선택 합니다.
  2. 사이클링 다음과 같이 10 µ L의 샘플 볼륨에 대 한 조건 설정: 2 분 50 ° C에서 하나 주기 2 분 동안 95 ° C에서 하나 주기 다음의 40 주기 (15 95 ° C s, 1 분 동안 60 ° C). 용융 곡선 설정 후, 실행: 15 s, 1 분 동안 60 ° C 및 95 ° C 15 s 95 ° C의 1 개 주기.
  3. 6 단계에 설명 된 대로 데이터를 분석을 진행 합니다.

6. 정량 원시 데이터를 분석 하 고 변환 정량에서 Ct 값 gc / µ L을 t 7 살 균 소에 대 한

  1. 원시 정량 데이터를 분석 하 고 원시 데이터 (그림 4)의 독특한 플롯을 분석 하 여 데이터 품질을 평가 합니다.
    참고: 증폭 플롯, multicomponent 줄거리 및 용융 곡선 작 키 특성을 정량의 데이터 품질을 검사할 플롯 됩니다.
  2. 표준 곡선 (2.1 단계)의 각 농도에서 triplicate 샘플에서 평균 임계값 주기 (Ct) 값 계산 합니다.
    1. 평균 Ct (Y)에 대 한 로그 (gc / µ L) (X) Y 선형 곡선을 플롯 kX + b = (k는 선형 곡선의 기울기, b는 절편).
    2. 계산 하는 선형 계수14 R2 (R2 가 되어야 합니다 > 0.99).
  3. 사용 하는 표준 곡선 Y = kX + b gc / µ L (그림 5)에서 biopanning 샘플 (즉, 페이지 CF 같은 점액에 대 한 선택) T7 페이지의 수를 계산 하.
    참고: k 표준 곡선의 기울기 이다.
  4. 증폭 효율을 계산 하는 다음 수식으로
    Equation 2(2)
    참고: k 참조 DNA 정량에서 생성 된 표준 곡선의 기울기 이다. 증폭 효율의 이상적인 범위 90-110%입니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

정량 Pcr 뇌관 디자인 다른 뇌관 디자인 도구를 사용할 수 있습니다. 일반적으로, 뇌관 디자인 프로그램은 그들의 자신의 내장 알고리즘을 계산 하 고 뇌관, 예를 들어, GC %, Tm, 뇌관 이합체 또는 머리 핀 형성 의 중요 매개 변수 일반적으로, 주요 기준은 다른 유사 뇌관 설계 도구, 및 뇌관 그들의 지침에 따라 설계할 수 있습니다. 뇌관 폭발 뇌관의 특이성을 확인을 사용할 수 있습니다. 1 개의 뇌관 쌍 게놈 DNA를 그림 1에 나와 t 7의 변수 영역의 상류를 대상. 살 균 소 샘플에서 biopanning, 절대 알 수 없는 농도 결정 하기 위해 정량화 접근-표준 곡선 정량화-살 균 소 게놈 DNA 복사본을 열거 하 선정 되었다. T7 살 균 소 DNA를 참조 (참조 자료) 알려진된 농도에서 0.1 µ g / µ L 직렬 1.0 x 10에서 희석은0 ~ 1.0 x 106 fg / µ L. 방정식 1는 사용 변환은 t 7 살 균 소 DNA 농도 fg / µ L 게놈 사본 (gc)에서 / µ L; 참조 T7 살 균 소 DNA 농도 했다 2.66 x 10 x 107 gc / µ L (그림 2) 2.66에1 .

표준 곡선에 대 한 참조 DNA의 희석을 준비 후 한 선택한 CX7C T7 페이지 정량 (그림 3A) 위해 준비 되었다. 간단히, 선택한 페이지의 biopanning를 설명 하기 위해: 109 pfu T7 CX7C 살 균 소 x 4.2의 초기 농도 꼭대기 위에 추가 되었다 구획 (기증자)는 Transwell의 접시 ( 테이블의 자료참조) 포함 100 µ L CF 같은 점액의과 600 µ L 인산의 염 분을 버퍼링 (PBS, 테이블의 자료를 참조) basolateral 구획 (수신기)에서 실 온 (25 ° C)에서 15 분 동안 incubated 했다 고. 15 분 후 수신기에서 eluate 수집; eluate에서 CX7C T7 클론이 정량으로 측정할 수 선정 됐다. 정량 Pcr 반응 준비 그림 3B와 같이 필요한 시 약 (예를 들어, 정량 마스터 믹스, 프라이 머, H2O)와 얼음에서 수행 되었다. 정량 Pcr 순환 조건 ( 테이블의 자료, 그림 3C참조)는 샘플을 실행 하려면 정량 thermocycler에 설치 되었다.

실행 정량 후 증폭 줄거리, 용융 곡선 음모와 multicomponent 음모 (그림 4)는 소프트웨어를 사용 하 여 원시 데이터를 분석 했다 ( 재료의 표참조). 증폭 줄거리는의 성공 또는 실패 각 샘플의 PCR 증폭을 나타냅니다. Multicomponent 작 증폭 및 증폭 주기 전체에 걸쳐 형광 신호 (기자 염료 SYBR와 백그라운드를 이용한 염료)의 선물. 용융 곡선 줄거리는 이후 각 PCR 제품에는 하나의 고유한 용융 온도 (Tm) 뇌관의 특이성을 확인 하는 데 사용 됩니다.

후에 정량 원시 데이터 품질의 평가, 표준 곡선 참조 DNA에서에서 생성 된: Ct 값 (Y) 로그 gc / µ L (농도 변환 그림 5에 표시 된); 여기, 그것은 Y =-3.5188 X + 35.09 (R2= 0.999) (그림 5A 와 5B). 증폭 효율 92.4%로 계산 되었다. 표준 곡선 보간의 Ct 값에 따라 희석된 T7 페이지 CX7C 복제의 알 수 없는 농도를 사용 되었다. 모든 참조 샘플 및 살 균 소 샘플 3 중, 실행 했다 그리고 그들의 평균 Ct 값 gc / µ L (그림 5)에서 DNA 농도 계산 하는 데 사용 했다. T7 클론의 초기 재고 솔루션은 안정성과 반복성 T7 페이지5의 열거에 대 한 정량의 유효성을 검사 하 연속적으로 희석 된다. 각 희석에서 샘플 3 중에서 준비 되었다. 더블 레이어 패 분석 결과 T7 희석;의 농도 결정 하기 위해 참조 하는 방법으로 사용 되었다 방법 설명 했다 이전5. 그림 6, 정량에서 대표적인 결과에 표시 됩니다 패 분석 결과에 비해 시험된 범위 10 101 7 gc / µ L Titers 또는 정량 정량에서 페이지 수가 더블 레이어 패 분석 결과에서 보다 높은 했다. 정량 방법의 반복성 10에서 농도 대 한 차이 (CV)의 계수에 의해 표시 됩니다 107 gc / µ L을1 . 결과 표 1;에 표시 했다 CV %2.85-27.2%에서 ranged.

Figure 1
그림 1: T7-415 살 균 소 DNA 벡터와 키 매개 변수 분석을 위한 설계 뇌관 뇌관 디자인. 올리고 디자인 도구는 여러 T7-415 살 균 소 DNA 위한 뇌관 쌍을 디자인에 사용 되었다. 한 세트는 뇌관, 예를 들어, Tm, GC %, 뇌관 이합체 및 헤어핀 형성의 키 매개 변수 유효성 검사 후 선정 됐다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2: 표준 곡선 준비 및 단위 변환의 살 균 소 T7 DNA 참조. 직렬 10 희석 0.1 µ g / µ L t 7 살 균 소 DNA에 대 한 참조 표준 곡선에서에서 만들어졌다. 방정식 1 fg / µ L에서 gc DNA 농도 변환 하는 데 사용 했다 / µ L. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3: 페이지 샘플 처리, 정량 Pcr 반응 준비 및 실행 정량. DNase 나 청소용된 T7 페이지 샘플 그대로 살 균 소 입자 (A);에서 T7 DNA 출시 15 분 100 ° C에가 열 했다 프로토콜에 설명 된 대로 정량 혼합 준비 되었다. 모든 준비 얼음 (B);에서 수행 되었다 정량 Pcr 장비와 호환 하는 소프트웨어 (C)는 PCR 주기 실행 자전거 조건 설정, 수집, 및 원시 데이터를 분석에 사용 되었다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 4
그림 4: 정량 원시 데이터의 독특한 플롯. 증폭 플롯, multicomponent 음모와 용융 곡선 음모 한 T7 페이지 CX7C 복제 생체 외에서 CF 같은 점액 장벽에 대 한 biopanning에서의 정량 원시 데이터에서 인수 했다. Multicomponent 작의에서 (ROX) 수동 참조 염료 염료 분자를 PCR 증폭에 참여 하지 않는 음모에 증폭 신호가 표시 됩니다 정량 마스터 혼합에 포함입니다. SYBR 정량 마스터 믹스에서 SYBR 녹색 염료 분자는 형광 신호를 증폭 하 고 정량 동안 부패 한다 제공할 것 이다 자전거. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 5
그림 5: gc / µ L t 7 살 균 소 입자의 계산에 정량의 원시 데이터의 분석. 임계값 (Ct) 값 DNA (Y) gc / µ L (X) 표준 곡선 (AB)를에서 참조 DNA의 알려진된 농도의 로그 변환에 대 한 플롯은 T7 페이지 참조의 표준 곡선의 주기. 표준 곡선 Ct 값에 따라 페이지 샘플의 알 수 없는 농도의 X (로그 gc / µ L) 값을 계산 하는 데 사용 되었습니다. (C) T7 gc / µ L에서 살 균 소 농도 계산할 수 있다. 또한, 정량 Pcr 증폭 효율의 계산 제공 됩니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 6
그림 6: 체 외에 CF 같은 점액 장벽에 대 한 biopanning에서 열거 한 T7 정량 Pcr의 민감도 재현성 결과 복제. T7 CX7C 살 균 소 클론이 biopanning 실험에서 선정 되었다 직렬 농도 범위에 희석 (10 나타내는 E1-E7으로 101 7) 정량 및 더블 레이어 패 분석 결과 대 한 3 중에서. 정량 및 더블 레이어 패 분석 결과 각 희석에 T7 페이지 복제의 농도 측정에 사용 되었다. 데이터는 각 치료 그룹에 대 한 각 규모에 표준 편차 (SD)와 평균 값에 표시 했다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

반복성
농도 (gc / µ L) %에 이력서 데이터
10 1 27.2
10 2 7.65
10 3 2.85
10 4 15.7
10 5 15.6
10 6 5.03
10 7 4.71

표 1: 하나의 T7 페이지 CX7C 복제에 대 한 정량 방법의 반복성. Intra-변화 10의 부 량 규모에서 시험 되었다1 107 gc / µ L T7 클론 DNA, 편차 (CV)의 계수에 대 한 정량 방법의 반복성을 표현 하는 말은 표준 편차의 비율으로 계산 되었다. CVs는 시험된 농도에서 2.85-27.2%의 범위에서 계산 했다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

우리 살 균 소 게놈 DNA5, 계량을 정량 방법을 개발 하 고 우리가 여기 설명 T7 페이지 CF 같은 점액 장벽에 대 한 선정을 열거 하는 정량 방법을 적응. 간행물의 양적 실시간 PCR 실험 (MIQE) 지침에 대 한 최소 정보 개발 T7 페이지15의 열거에 대 한 정량 방법의 유효성을 검사 하 적응 했다. 우리는 biopanning 실험에서 페이지 척도를 개발 하는 프로토콜은 시간 효율적, 안정적이 고 경제적인 방법입니다. 정량 샘플 준비를 위해 우리의 프로토콜만 살 균 소 솔루션의 높은 온도 치료 (100 ° C, 15 분)을 사용 하 고 살 균 소 DNA 추출 및 정화 단계 기존의 전략11,17,에 비해 요구 하지 않았다 18. 또한, 살 균 소 입자, 더 정확 하 게 열거할 DNase 캡슐화 비 살 균 소 DNA18,,1920를 제거 하 고 열 처리 이전 페이지 솔루션에 추가 되었습니다. 살 균 소 솔루션에 비 캡슐화, 잔여 DNA 페이지 확대 및 살 균 소 입자의 저하 중 캡슐화의 부족으로 발생할 수 있습니다. 결과적으로, 그들의 게놈 DNA를 사용 하 여 그대로 살 균 소 입자의 수는 정확 하 게 계량, DNase 사전 치료는 살 균 소 게놈 사본의 artifactually 높은 값을 방지 하기 위해 중요 한.

개발 및 페이지를 정확 하 게 계량을 정량의 사용에 많은 고려 사항 있다. 정량 데이터의 프로토콜에 걸쳐 발생할 수 있으며 다음 고려해 야 정확한 열거형을 달성 하기 위해. 그것은 고 열 처리로 살 균 소 세포를 확인 하 고 샘플 농도 증발 및 응축 물 때문에 이후의 변동 방지 하기 위해 밀폐 된 조건에서 살 균 소 샘플 튜브를 유지 해야 합니다. PCR 반응의 총 볼륨 작은 이며 보정된 pipets 샘플 준비 과정의 각 단계에서 신뢰할 수 있는 pipetting 기술. 사이클링 정량, 동안 안정적인 온도 제어 기능 정확한 정량 데이터에 필요한 이며 열 cycler 정량 악기에서의 일상적인 보정 필요. 변화를 제어 하려면 대체 단계 프로토콜에서 설명 했다. 연산자 pipetting 낮은 볼륨의 경우, 총 PCR 반응 20 또는 25 µ L에 확장할 수 있습니다. 문제 해결을 위한 상기 단계 외 프로토콜 표준 DNA15,21,,2223의 내부 제어를 필요합니다. 절대 정량화 방법으로 표준 곡선의 선형 계수는 살 균 소 열거형 데이터의 정확도를 결정합니다. 샘플 실행에는 내부 통제 DNA를 사용 하 여 샘플 준비와 정량 Pcr 장비에서 변화를 최소화할 수 있습니다.

앞에서 설명한 페이지 정량화 방법에 비해, 우리의 프로토콜 광범위 살 균 소 농도의 열거를 허용 하 고 전염 성 및 비 전염 성 살 균 소 입자와 DNase 치료 없이 분화 할 수 있다. 또한, 우리의 프로토콜은 샘플, 더블 레이어 패 분석 결과 다른 방법에 비해 더 많은 비용, 시간 효율적이 고 높은 처리량을 만들기의 많은 수를 측정에 대 한 매력입니다.

요약 하자면,이 프로토콜 차세대 시퀀싱, 그리고 환경 살 균 소에 생체 외에서 그리고 vivo에서 biopanning, 살 균 소 도서관 DNA 준비를 포함 하는 응용 프로그램의 다양 한에서 살 균 소 입자를 열거에 적용할 수 있습니다. 오염입니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 없다.

Acknowledgments

이 작품은 PhRMA 기초 연구 동기 부여에 의해 지원 되었다 고 국가 심 혼, 폐, 혈액 연구소 건강의 국가 학회의 보너스 번호 R01HL138251에서 부여 합니다.

Materials

Name Company Catalog Number Comments
Materials and Reagents
Primers for T7 genomic DNA IDT F: CCTCTTGGGAGGAAGAGATTTG
R: TACGGGTCTCGTAGGACTTAAT
T7 Select packaging control DNA EMD Millipore 69679-1UG
MicroAmp optical 96-well reaction plate ThermoFisher Scientific N8010560
qPCR master mix--Power up SYBR Green master mix Applied biosystems A25742
MicroAmp optical adhesive film kit ThermoFisher Scientific 4313663
T7Select 415-1 Cloning Kit EMD Millipore 70015 User protocols : http://www.emdmillipore.com/US/en/product/T7Select-415-1-Cloning-Kit,EMD_BIO-70015#anchor_USP
DNase I solution ThermoFisher Scientific 90083
24-well transwell plate Corning 3472
UltraPure DNase/RNase-Free Distilled H2O Invitrogen 10977015
Phosphate Buffered Saline (1x) Corning 21040CV
Name Company Catalog Number Comments
Equipments
ViiA7 Real-Time PCR System with Fast 96-Well Block ThermoFisher Scientific 4453535
Heraeus Pico 21 Microcentrifuge ThermoFisher Scientific 75002415
Fisherbrand Digital Vortex Mixer Fisher Scientific 02-215-370
HERMO SCIENTIFIC Multi-Blok Heater ThermoFisher Scientific Model:2001
Sorvall Legend X1 Centrifuge ThermoFisher Scientific 75004220
M-20 Microplate Swinging Bucket Rotor ThermoFisher Scientific 75003624
Name Company Catalog Number Comments
Software
QuantStudio Real-time PCR software ThermoFisher Scientific v1.2
Real-time qPCR primer design IDT
OligoAnalyzer 3.1 IDT

DOWNLOAD MATERIALS LIST

References

  1. Smith, G. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science. 228, (4705), 1315-1317 (1985).
  2. Smith, G. P., Petrenko, V. A. Phage Display. Chemical Reviews. 97, (96), 391-410 (1997).
  3. Sergeeva, A., Kolonin, M. G., Molldrem, J. J., Pasqualini, R., Arap, W. Display technologies: Application for the discovery of drug and gene delivery agents. Advanced Drug Delivery Reviews. 58, (15), 1622-1654 (2006).
  4. Dias-Neto, E., et al. Next-generation phage display: Integrating and comparing available molecular tools to enable costeffective high-throughput analysis. PLoS ONE. 4, (12), 1-11 (2009).
  5. Peng, X., Nguyen, A., Ghosh, D. Quantification of M13 and T7 bacteriophages by TaqMan and SYBR green qPCR. Journal of Virological Methods. 252, (June 2017), 100-107 (2017).
  6. Khan, M. S., Pande, T., Mvan de Ven, T. G. Qualitative and quantitative detection of T7 bacteriophages using paper based sandwich ELISA. Colloids and Surfaces B: Biointerfaces. 132, 264-270 (2015).
  7. Brasino, M., Lee, J. H., Cha, J. N. Creating highly amplified enzyme-linked immunosorbent assay signals from genetically engineered bacteriophage. Analytical Biochemistry. 470, 7-13 (2014).
  8. Yu, X., Burgoon, M., Shearer, A., Gilden, D. Characterization of phage peptide interaction with antibody using phage mediated immuno-PCR. J immunol Methods. 326, (1-2), 33-40 (2007).
  9. Lehmusvuori, A., Manninen, J., Huovinen, T., Soukka, T., Lamminmäki, U. Homogenous M13 bacteriophage quantification assay using switchable lanthanide fluorescence probes. BioTechniques. 53, (5), 301-303 (2012).
  10. Schlaman, H. R. M., et al. Analysis of interactions of signaling proteins with phage-displayed ligands by fluorescence correlation spectroscopy. Journal of Biomolecular Screening. 13, (8), 766-776 (2008).
  11. Tjhung, K. F., Burnham, S., Anany, H., Griffiths, M. W., Derda, R. Rapid enumeration of phage in monodisperse emulsions. Analytical Chemistry. 86, (12), 5642-5648 (2014).
  12. Reitinger, S., Petriv, O. I., Mehr, K., Hansen, C. L., Withers, S. G. Purification and quantitation of bacteriophage M13 using desalting spin columns and digital PCR. Journal of Virological Methods. 185, (1), 171-174 (2012).
  13. T7Select Biopanning Kit. Millipore Sigma. Available from: https://www.emdmillipore.com/US/en/product/T7Select-Biopanning-Kit,EMD_BIO-70018#anchor_USP (2018).
  14. Schneider, A., Hommel, G., Blettner, M. Linear Regression Analysis. Deutsches Ärzteblatt international. 107, (44), 776-782 (2010).
  15. Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggert, J. The MIQE Guidelines: Minimun information for publication of quantitative real-time PCR experiments. Clinical Chemitry. 55, (4), 611-622 (2009).
  16. Lock, M., Alvira, M. R., Chen, S. -J., Wilson, J. M. Absolute Determination of Single-Stranded and Self-Complementary Adeno-Associated Viral Vector Genome Titers by Droplet Digital PCR. Human Gene Therapy Methods. 25, (2), 115-125 (2014).
  17. Fittipaldi, M., et al. Discrimination of infectious bacteriophage T4 virus by propidium monoazide real-time PCR. Journal of Virological Methods. 168, (1-2), 228-232 (2010).
  18. Lodder, W. J., et al. Reduction of bacteriophage MS2 by filtration and irradiation determined by culture and quantitative real-time RT-PCR. Journal of Water and Health. 11, (2), 256-266 (2013).
  19. Brown-Jaque, M., et al. Antibiotic resistance genes in phage particles isolated from human feces and induced from clinical bacterial isolates. International Journal of Antimicrobial Agents. (2017).
  20. Naveca, F. G., et al. Multiplexed reverse transcription real-time polymerase chain reaction for simultaneous detection of Mayaro, Oropouche, and oropouche-like viruses. Memorias do Instituto Oswaldo Cruz. 112, (7), 510-513 (2017).
  21. Jia, J., et al. Simultaneous detection and differentiation of human parvovirus B19 and human parvovirus 4 by an internally controlled multiplex quantitative real-time PCR. Molecular and Cellular Probes. 36, 50-57 (2017).
  22. Bliem, R., et al. A novel triplex quantitative pcr strategy for quantification of toxigenic and nontoxigenic Vibrio cholerae in aquatic environments. Applied and Environmental Microbiology. 81, (9), 3077-3085 (2015).
  23. Wan, Z., Goddard, N. L. Competition Between Conjugation and M13 Phage Infection in Escherichia coli in the Absence of Selection Pressure: A Kinetic Study. G3 Genes|Genomes|Genetics. 2, (10), 1137-1144 (2012).
Biopanning에서 t 7 살 균 소의 양이 많은 PCR
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).More

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter