Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

T7 bakteriyofaj Biopanning üzerinden kantitatif PCR

doi: 10.3791/58165 Published: September 27, 2018

Summary

T7 bakteriyofaj numaralandırmak için bir tekrarlanabilir, doğru ve zamanı verimli kantitatif PCR (qPCR) yöntemi burada açıklanmıştır. Protokol açıkça fajının genomik DNA hazırlık, PCR reaksiyon hazırlama, qPCR Bisiklet koşullarını ve qPCR veri analizi açıklar.

Abstract

Bu iletişim kuralı T7 phages fajının seçimi deneyler (Yani, "biopanning") üzerinden Numaralandırılacak kantitatif PCR (qPCR) kullanımını açıklar. qPCR DNA ölçmek için bir floresan tabanlı yaklaşımdır ve faj parçacıklar için bir proxy olarak faj genleri ölçmek için adapte işte. Bu protokol için yüksek sıcaklık ısıtma olmadan ek DNA arıtma kullanılarak facile faj DNA hazırlama yöntemi açıklanmıştır. Yöntemin yalnızca küçük hacimli ısı phages ve küçük hacimli qPCR tepki gerekir. qPCR yüksek üretilen iş ve hızlı, işlemek ve diğer fajının numaralandırma yaklaşımlar 2 – 4 h. ile karşılaştırıldığında tepkileri bir 96-şey tabak veri almak mümkün, qPCR daha zaman verimli olur. Burada, qPCR biopanning karşı vitro kistik fibrozis gibi mukus modeli üzerinden tespit T7 phages numaralandırmak için kullanılır. QPCR yöntemi T7 phages biopanning diğer türleri dahil olmak üzere diğer deneyler üzerinden ölçmek için genişletilebilir (e.g., protein bağlayıcı, içinde vivo immobilize fajının tarama) ve diğer kaynaklar (Örneğin, su sistemleri veya vücut sıvıları). Özet olarak, herhangi bir DNA kapsüllenmiş virüs ölçmek için bu iletişim kuralı değiştirilebilir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bakteriyofaj (fajının) ekran teknolojisi, George Smith tarafından 1985 yılında geliştirilen peptid veya protein ligandlar hedefleri veya reseptörleri hücre zarı, hastalık antijenleri, hücre organelleri veya özel karşı tanımlamak için güçlü, yüksek-den geçerek bir yaklaşım olduğunu organ ve dokulara son yirmi yılda1,2. Burada, rasgele kütüphanelerin polipeptitler veya tek zincir antikorlar phages (genellikle M13 veya T7) kat protein üzerinde görüntülenir ve belirli ligandlar immobilize proteinler vitro veya içinde vivo karşı kaydırma tespit edilmesi Biyolojik sistemlerde bir yinelemeli seçim sürecinde. O zaman, ligandlar tanı ve tedavi hastalıkları3,4için görüntüleme veya terapötik ajanlar ile birleştiğinde olabilir. Doğru bir şekilde phages biopanning birden çok adımı sırasında numaralandırmak için önemlidir: (1) substrat için bağlamak phages ölçmek için ve (2) her turda seçim ile zenginleştirme olup olmadığını belirlemek için phages ölçmek için (fajının zenginleştirme gösterir biopanned Feyc benzeşme hedef için). Miktar, Çift katmanlı plak yöntemi, geçerli altın standart birden çok zorluklar sunar; sıkıcı, hantal ve potansiyel olarak çok sayıda örnekleri için yanlış olduğunu. Bu nedenle, bizim grup M13 ve T7 fajının parçacıklar biopanning5numaralandırmak için bir hassas, tekrarlanabilir, doğru ve zamanı verimli nicel polimeraz zincir reaksiyonu (qPCR) yöntemi geliştirmiştir.

qPCR doğru bir şekilde T7 ve M13 phages ölçmek için cazip ve uygun bir yöntemdir. Her bireysel fajının parçacık yalnızca genomik DNA (dsDNA veya ssDNA) bir kopyasını içerebilir yana bir fajının genom bir fajının parçacık için eşdeğerdir; Feyc genleri sayısı miktarının tarafından phages sayısını ölçmek mümkün olabilir. QPCR, floresan muhabir sırasında boyalar özel olarak sigara fajının genomik DNA bağlamak veya özellikle fingerprinting astar PCR güçlendirme sırasında ve floresan sinyal güçlendirme her turu ile artar. Floresans sinyal bu yuvarlak/amplifikasyon döngüsü eşik ulaştığında eşik döngüsü (Ct) belirtilmektedir. Başvuru faj DNA bilinen konsantrasyonları standart bir eğri oluşturmak için Ct değerlerine karşı çizilir. Standart eğri DNA örnekleri Ct değerleri ile kullanarak, phages konsantrasyonları değiştirilmiş.

Çok sayıda stratejileri daha önce geliştirilen ve yoğun phages biopanning üzerinden ölçmek için kullanılan iken, her biri belirli zorlukları vardır. En popüler ve geleneksel yöntem çift-tabaka plak tahlil olduğunu. Burada, bakteri seri dilutions hazırlanan phages ile enfekte, solid agar substrat kaplama ve agar ile overlaid ana bilgisayar; phages oluşan plaklar (Yani, plak oluşturan birimler veya pfu) agar plaka numarası ile numaralandırılır. Plak tahlil hassas ama sıkıcı, zaman alıcı ve yanlış, özellikle çok sayıda örnekleri ve yüksek konsantrasyonları5. Ayrıca, enzim bağlı immunosorbent deneyleri (ELISA) M13 T7 fajının parçacıklar6,7,ve8numaralandırmak için adapte edilmiştir. Burada, farklı dilutions, phages bağlı olan ve bir katı substrat (Yani, bir Mikroplaka) yakalanan, fajının özel antikorlar ile probed ve gazetecilere (Örneğin, enzim hassas chromogenic yüzeylerde, fluorophores) kullanarak tespit Feyc parçacıklar mevcut sayısını belirleyin. Veriler (Örneğin, floresan, absorbans) örneklerinin fajının standartları bilinen konsantrasyonlarda karşı bilinmeyen konsantrasyonları ölçmek için kullanılabilir. Farklı fajının tabanlı ELISAs geliştirilmiştir ancak potansiyel kısıtlamalar bulunmaktadır. Bir grubu bir kağıda dayalı sandviç ELISA yedi büyüklük (102-109 pfu/mL); yayılmış bir miktar aralığı ile geliştirilen Ancak, bu yöntem birden çok adımı antikor kaplama gerekli ve tahlil8için tüm günümü aldı. Grubumuz aynı zamanda M13 fajının parçacıklar ölçmek için bir ELISA yöntemi geliştirilmiş ancak 10 daha az duyarlı algılama aralığı vardı6 ' 1011 pfu/mL5. Değiştirilebilir lanthanide floresan problar M13 numaralandırmak için geliştirilmiştir ve miktar veri içinde 20 dk alınamadı; Ancak, bu tahlil vardır dar bir Dinamik Aralık 10 1012 pfu/mL99 . Bir grup atomik kuvvet mikroskobu M13 fajının parçacıklar çözüm numaralandırmak için kullanılan, ama bu gelişmiş elektron mikroskobu gerektirir ve sadece konsantrasyonları10dar bir Aralık içinde çalıştı. Başka bir çalışmada monodisperse emülsiyonlar floresan M13 ve T4 muhabir phages tuzak ve floresan damlacıkları tarafından phages saymak için kullanılır; Ancak, bu yaklaşım aynı zamanda bir dar miktar aralığı 10 sergilenen2 106 pfu/mL11. Damlacık dijital PCR M13 phages ölçmek için kullanılan, bulaşıcı ve bulaşıcı olmayan fajının parçacıklar12sayısı arasında ayırt etmek bu yaklaşım değiştiremiyor.

Bizim grup yakın zamanda T7 ve M13 phages biopanning iki farklı floresan muhabir boyalar5kullanarak bir kan - beyin bariyerini hücre modeli üzerinden tespit numaralandırmak için qPCR yöntemleri geliştirmiştir. Söz konusu miktar yöntemlerine göre geliştirdiğimiz qPCR yöntemleri yüksek üretilen iş ve zaman tasarruflu çok sayıda örnekleri ölçmek için ve mümkün ayırt arasında bulaşıcı ve bulaşıcı olmayan phages DNaz ile ben, ön arıtma Feyc örnekleri. Önemlisi, bu yaklaşımın M13 ve T7 bacteriophages biopanning örneklerinden tekrarlanarak ve doğru bir şekilde ölçmek. Acemi araştırmacılar fajının qPCR alanında rehberlik için burada T7 fajının parçacıkları bir sistein kýsýtlanmýþ kitaplığı (CX7C) karşı bir vitro kistik fibrozis (CF) mukus bariyer panned numaralandırmak için detaylı qPCR yöntemi açıklanmaktadır. Bu işten qPCR yöntemi fajının parçacıklar biopanning diğer türlerinden ve su, toprak ve vücut sıvıları gibi diğer kaynaklardan ölçmek için genişletilebilir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. primer tasarım ve T7 fajının genomik DNA'ın Analizi

  1. T7 fajının genomik DNA amplifikasyon için tasarım astar.
    Not: F (ileriye doğru) ve (bkz: Malzemeler tablo) R (ters) astar T7 DNA dizisi yükseltmek akıntıya karşı bulunduğu kitaplığı değişken bölge (Şekil 1).
  2. Erime sıcaklığı (Tm), yüzde GC içeriği (GC %), astar Dimer, saç tokası oluşumu ve PCR uygunluğu (Şekil 1) de dahil olmak üzere astar, parametrelerini değerlendirmek için bir uygun astar analizörü seçin.
  3. Astar oligonucleotides (oligos) sipariş ve elimize lyophilized oligos 100 µM hisse senedi konsantrasyonları bir 1,5 mL santrifüj tüpü alın ve birkaç ay için-20 ° C'de saklayın DNaz ve RNase free ultra saf su için resuspend.
  4. Birkaç aliquots (yaklaşık 50 µL her 1,5 mL tüp) 100 µM astar stokunun olun.
    Not: Bu adımı sık donma-çözülme döngüsü önlemek için kullanılır.

2. standartlar T7 fajının genomik DNA miktar için hazırlayın

  1. Seri olarak 0.1 µg/µL (1.0 x 108 fg/µL) başvuru T7 faj DNA seyreltik (satın; 0,1 µg/µL bilinen bir konsantrasyon malzemeleri görmek) 10 kat 1.0 x 106 x 100 fg/µL ultra-saf H2O ' 0.2 mL PCR tüpleri ile 1.0. 20 µL (Şekil 2) bir hacmi her konsantrasyon hazırlayın.
  2. Girdap ayrıntılı seyreltme her adımda karıştırma sağlamak için PCR tüpleri. Ayrıca ipuçları DNA örneği için aşağıdaki seyreltme eklerken değiştirin.
    Not: Bu qPCR denemenin her toplu iş için standart bir eğri DNA standartların yeni çözüm hazırlamak için tavsiye edilir.
  3. Denklem 1 (aşağıda) T7 fajının başvuru için DNA konsantrasyonları fg/µL genom kopya (gc) /µL (Şekil 2) dönüştürmek için kullanın.
  4. T7 faj DNA konsantrasyon gc/µL =
    Equation 1(1)
    Not: bp: baz çifti; T7 genomik DNA başvurudur 37314 bp.

3. ön tedavisinde fajının örnekleri önce qPCR reaksiyon hazırlık

  1. (1. seçenek) Damlalıklı 20 µL vitro kistik fibrozis (CF) karşı biopanning seçildiği bir T7 klonu (fajının)-mukus model 1.5 mL santrifüj tüpleri içine gibi. DNaz 1,25 birimleri ekleyin ben (0.5 µL) her 20 µL örnek için.
    Not: T7 fajının sistein kısıtlanmış heptapeptide kitaplığı (CX7C) biopanned 15dk için 24-şey zar ekler ( Tablo malzemelerigörmek) kaplı CF benzeri mukus karşı yapıldı. Daha fazla bilgi sonuçları bölümünde sağlanır. Bir T7 klon qPCR numune hazırlama eluate üzerinden için seçildi.
    1. Seçenek 2: Damlalıklı 200 T7 µL klon 1,5 mL tüpler içine ve 5 adet DNaz ekleyin ben
      (2 µL) her örnek için.
      Not: Bu adımda seçilen fajının örnek hacmi biopanning toplanan birimden bağlıdır. Odağı iletişim kuralının biopanned fajının qPCR üzerinde olmakla birlikte, biopanning ayrıntılı için T7 fajının Kullanıcı Protokolü adımları (bakınız Tablo reçetesi)13kit.
  2. T7 fajının örnek tüpler (adım 3.1) kap ve onları 37 ° c ısıtılmış kuru banyo (Yani, ısı blok) 10 min için kuluçkaya.
  3. Bir ısıtmalı kuru banyoda (Şekil 3A) 15 dakika 100 ° C'de (Kimden adım 3.2) tüpler kuluçkaya.
    Dikkat: buharlaşma ve yoğunlaşma Isıtma adımı sırasında meydana beri 1.5 mL santrifüj tüpleri tamamen şapkalı emin olun.
  4. Isıl phages adım 3.3 18,534 x g , 10 s. karışımı bir girdap karıştırıcı tüp yerleştirerek phages ayarla 10 s ve 18,534 x g 10 için spin için dokunmatik-harekete geçirmek modu için spin s tekrar.
    Not: Spin-mix-spin döngüsü ısıtmalı fajının örnekleri de karıştırılır emin olmaktır.
  5. Onları deney tezgah veya mağaza buzdolabında 4 ° C'de gecede terk ederek örnek tüpler, oda sıcaklığında (RT) sakin.
    Not: Bu adımda deneme duraklatılmış.

4. qPCR reaksiyonlar hazırlayın

Not: Bir PCR reaksiyon için bir örnektir. 5 her PCR reaksiyon içerir µL qPCR Master mix (malzemeleri görmek), 5 µM astar çifti Mix 1 µL, H2O 2 µL ve 2 µL ısıl T7 fajının örneği. Birden fazla PCR reaksiyonları için fajının örnek dışında tüm reaktifler bir 1,5 mL tüp premix. Premiks her reaktif hacmi qPCR için fajının örnek sayısına bağlıdır.

  1. 10 biopanned fajının örnekleri bilinmeyen konsantrasyon ve 7 nüsha standart konsantrasyonlarda örnekleri qPCR Premiks hazırlayın. Sonuç olarak, 51 Toplam örnekleri ve bu nedenle, 51 qPCR reaksiyonlar (Yani, örnek başına bir reaksiyon) vardır. 51 reaksiyonlar için 255 µL (51 x 2 µL) qPCR ana Mix (51 x 5 µL), astar (51 x 1 µL) 51 µL ve H2O 102 µL Premiks hazırlayın.
    Not: Bu bir kaç ilave PCR reaksiyonları sırasında aliquoting PCR karışımı içine her şey 96-şey qPCR plaka için hacim kaybı telafi etmek için hazırlamak için tavsiye edilir.
  2. Aliquot 8 µL PCR Premiks 96-şey qPCR plaka 51 wells (Yani, 51 qPCR reaksiyonlar) olmak üzere toplam her kuyuya. Aliquoting sırasında ipuçları değiştirmeye gerek yoktur.
  3. Her şey (Şekil 3B); 2 µL ısıl T7 fajının örnekleri (adım 3.4) veya T7 fajının başvuru DNA (adım 2.1) ekleme ipuçları farklı DNA örnekleri çapraz kontaminasyonu önlemek için kuyuya eklerken değiştirin. Ayrıca, 2 µL DNA örnekleri qPCR Premiks (Yani, 8 µL PCR Premiks içine) yüzeyinin altında dağıtmak.
  4. QPCR levha yapıştırıcı film ile kapatın.
    Not: Bu qPCR plaka türü ne olursa olsun kritik bir adımdır. Plaka tamamen mühür için önerilen setini kullanın; Aksi takdirde, plaka mühürlü olmayan bölgede PCR sırasında cilt kaybı neden olur Bisiklete binme.
  5. QPCR plaka floresan photobleaching en aza indirmek için alüminyum folyo ile sarın ve qPCR ekipman üzerinde çalışmaya devam edin.

5. qPCR Bisiklete binme koşulları

Not: qPCR Bisiklet koşullarını belirli qPCR ekipman üzerinde kurulmuştur ( Tablo malzemelerigörmek).

  1. 96-şey qPCR plaka qPCR ekipman üzerinde çalıştırın. Ekipman, aşağıdaki deneysel koşullar (Şekil 3 c) ayarlamak için menüden ayarları seçin.
  2. Koşulları aşağıdaki gibi 10 µL örnek hacmi için bisiklet ayarla: bir çevriminde 2 min 50 ° c 95 ° C'de bir döngüsü için 2 dk, ardından 40 döngüleri tarafından (95 ° C 15 s, 1 dk. için 60 ° C). Sonra çalışma eritebilir eğri ayarları: 95 ° C bir döngüsü için 15 s, 60 ° C için 1 dakika ve 95 ° C 15 s.
  3. 6. adımda açıklandığı gibi verileri çözümlemek için devam edin.

6. qPCR ham veri analiz ve qPCR T7 Bacteriophages için gc/µL için Ct değeri dönüştürmek

  1. Ham qPCR veri analiz etmek ve veri kalitesi ve ham veri (Şekil 4) karakteristik araziler analiz ederek değerlendirmek.
    Not: Amplifikasyon arsa, uygulamasının arsa ve erime eğrisi Arsa qPCR veri kalitesini doğrulamak anahtar özelliği araziler vardır.
  2. İneklemek örneklerinden standart eğri (adım 2.1) her toplama, ortalama eşik döngüsü (Ct) değerleri hesaplar.
    1. Ortalama Ct (Y) günlük (gc/µL) (X Y doğrusal eğrisi almak için) karşı komplo = kX + b (k doğrusal eğrinin eğimini, b kesme noktası).
    2. Doğrusal katsayısı14 R2 hesaplamak (R2 -meli var olmak > 0.99).
  3. Standart eğri Y kullanın = kX + b (Şekil 5) gc/µL T7 phages biopanning örneklerinde (Yani, phages CF benzeri mukus karşı seçili) sayısını hesaplamak için.
    Not: Standart eğrinin eğimini k var.
  4. Aşağıdaki denklemle amplifikasyon verimlilik hesaplamak
    Equation 2(2)
    Not: başvuru DNA qPCR oluşturulan standart eğrinin eğimini k var. İdeal amplifikasyon verimliliği % 90-110 aralığıdır.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Farklı astar tasarım araçları qPCR astar tasarlamak için kullanılabilir. Genellikle, astar tasarım programları hesaplamak ve astarlar, Örneğin, GC %, Tm, astar dimer veya saç tokası oluşumu, vb anahtar parametrelerinin genellikle doğrulamak için yerleşik kendi algoritmalar, anahtar ölçüt içinde farklı benzer astar tasarım araçları ve astar onların talimatları tasarlanabilir. Astar patlama astar özgüllük onaylamak için kullanılabilir. Bir astar genomik DNA Şekil 1' de gösterilen T7 değişken bölgesinin hedefleyen akıntıya karşı eşleyin. Feyc örnekleri biopanning, mutlak bir bilinmeyen konsantrasyonları belirlemek için miktar yaklaşım - standart eğri miktar - fajının genomik DNA kopyalarını numaralandırmak için seçildi. Referans T7 faj DNA (malzemeleri görmek) bilinen bir konsantrasyon 0.1 µg/µL seri olarak 1.0 x 10'dan düşürülmüştü0 1.0 x 106 fg / µL. Denklem 1 kullanılan dönüştürmek T7 faj DNA konsantrasyonları için fg/µL genom kopya (gc) için gelen / µL; başvuru T7 faj DNA konsantrasyonları edildi 2,66 x 10 107 gc/µL (Şekil 2) x 2,661 .

Dilutions referans DNA için standart eğri hazırladıktan sonra bir seçili CX7C T7 fajının qPCR (Şekil 3A) için hazırlanmıştır. Kısaca, seçili fajının biopanning açıklamak için: 4,2 x 109 pfu T7 CX7C fajının ilk bir konsantrasyon apikal üzerine eklenen bir Transwell kartı yuvası (donör) plaka (bkz: Malzemeler tablo) içeren 100 µL CF benzeri mukus ve 600 µL fosfat tamponlu tuz (PBS, Tablo malzemelerigörmek) demiri yerde (alıcı) ve 15 dakika (25 ° C) Oda sıcaklığında inkübe. 15 dk sonra alıcının eluate toplanan; eluate bir CX7C T7 klon qPCR tarafından sayısal üzere seçildi. qPCR reaksiyon hazırlık Şekil 3B' gösterildiği gibi gerekli reaktifler (Örneğin, qPCR ana mix, astar, H2O), buz üzerinde gerçekleştirildi. QPCR Bisiklet koşullarını bir qPCR thermocycler (bkz. Tablo malzemeleri, Şekil 3 c) örnekleri çalıştırmak için kurulmuştur.

Çalıştırmak qPCR sonra amplifikasyon arsa, erime eğrisi arsa ve uygulamasının Arsa (Şekil 4) yazılımı kullanarak ham verileri analiz edildi ( Tablo malzemelerigörmek). Amplifikasyon Arsa başarılı veya başarısız her örneğinin PCR güçlendirme gösterir. Uygulamasının Arsa amplifikasyon ve çürüme floresans sinyalinin (muhabir boya SYBR ve arka ROX boya) amplifikasyon döngüleri boyunca sunar. Erime eğrisi Arsa astar özgüllük bir benzersiz erime sıcaklığı (Tm) her PCR ürünü olduğundan doğrulamak için kullanılır.

QPCR ham veri kalitesi değerlendirme sonrasında yapılan başvuruyu DNA standart eğri oluşturuldu: Ct değerleri (Y) üzerinden günlük gc/µL ( Şekil 5' te gösterilen konsantrasyon dönüşüm); Y buradaydı =-3.5188 X + 35,09 (R20.999 =) (Şekil 5A ve 5B). Amplifikasyon verimliliği %92.4 olarak hesaplanır. Standart eğri seyreltilmiş T7 fajının CX7C klon Ct değerlerine dayalı bilinmeyen konsantrasyonları getirmek için kullanıldı. Tüm başvuru örnekleri ve faj örnekleri nüsha çalıştırılan ve ortalama Ct değerlerine gc/µL (Şekil 5) DNA toplama hesaplamak için kullanılmıştır. İlk hisse senedi çözüm T7 klonu seri olarak istikrar ve tekrarlanabilirlik için numaralandırma T7 phages5qPCR doğrulamak için düşürülmüştü. Her seyreltme örnekleri nüsha hazırlanmıştır. Çift katmanlı plak tahlil T7 dilutions konsantrasyonları belirlemek için bir başvuru yöntemi olarak kullanılan; yöntemleri açıklanan daha önce5. Şekil 6' da qPCR temsilcisi sonuçlarını 10 test mesafeden plak tahlil için karşılaştırılan gösterilir1 -107 gc / µL. titreleri veya phages üzerinden qPCR Nefelometri sayısı çift-tabaka plak tahlil daha yüksektir. QPCR yöntemi tekrarlanabilirlik farkının (MF) konsantrasyonu 10 için katsayısı temsil edilir1 ' e 107 gc/µL. Sonuçlar Tablo 1' de gösterilen; MF % 2.85-27,2'den % arasında değişiyordu.

Figure 1
Şekil 1: astar tasarım T7-415 faj DNA vektör ve anahtar parametreleri çözümlenmesi için tasarlanmış astar. Oligo tasarım araçları astar T7-415 faj DNA'sı için birden fazla çiftlerini tasarlamak için kullanılmıştır. Bir set astar, Örneğin, Tm, GC %, astar-dimer ve saç tokası oluşumu anahtar parametreleri doğrulama sonra seçildi. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Şekil 2: Standart eğri hazırlık ve T7 fajının birim dönüştürme başvuru DNA'sı. Seri 10 kat dilutions 0.1 µg/µL T7 faj DNA için referans standart bir eğri üzerinden yapıldı. Denklem 1 DNA konsantrasyonları fg/µL gc için dönüştürmek için kullanılan / µL. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3: faj örnek tedavi, qPCR tepki hazırlama ve koşmak qPCR. Ben T7 fajının örnekleri ön işleme DNaz T7 DNA sağlam fajının parçacıklar (A);'serbest bırakmak 15 dakika 100° C'de ısıtılmış qPCR karışımı iletişim kuralında tanımlandığı gibi hazırlanmıştır. Tüm hazırlıklar yapıldı buz (B); qPCR donanım ve uyumlu yazılım (C) bisiklet koşullarını kadar Grubu'nu çalıştırmak PCR döngüleri, elde etmek ve ham verileri çözümlemek için kullanılmıştır. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 4
Şekil 4: qPCR ham veri ve karakteristik araziler. Amplifikasyon arsa, uygulamasının arsa ve erime eğrisi arsa bir T7 fajının CX7C klon biopanning vitro CF benzeri mukus bariyer karşı gelen qPCR ham veri elde. Uygulamasının mezarlığına pasif başvuru boya (ROX) PCR güçlendirme katılmayan ve amplifikasyon sinyal-ecek göstermek mezarlığına qPCR ana karışımı dahil boya bir moleküldür. SYBR yeşil boya molekül qPCR ana karışımı olan SYBR, yükseltmek ve çürüme sırasında qPCR bir floresan sinyal sağlayacaktır Bisiklete binme. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 5
Şekil 5: gc/µL T7 fajının parçacıkların hesaplamak için qPCR ham veri analizini. Eşik döngüsü DNA (Y) karşı başvuru DNA gc/µL standart eğri (A ve B) almak için (X) olarak bilinen konsantrasyonları logaritmasını dönüşüm çizilen ilişkili T7 fajının referans standart eğri (Ct) değerleri. Standart eğri Ct değerlerine dayalı fajının örnekleri bilinmeyen konsantrasyonları X (günlük gc/µL) değerlerini hesaplamak için kullanılan. (C) T7 gc/µL konsantrasyonlarda fajının hesaplanabilir. Ayrıca, hesaplama qPCR amplifikasyon verimlilik sağlanır. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 6
Şekil 6: Bir T7 numaralandırmak için qPCR hassasiyet ve tekrarlanabilirlik sonuçlarını klon biopanning vitro CF benzeri mukus bariyer karşı gelen. Bir T7 CX7C fajının klon biopanning deneyden seçili seri olarak bir konsantrasyon aralığı içine seyreltilmiş (E1-E7 10 temsil etmek için gösterilen1 -107) ve qPCR ve çift katmanlı plak tahlil için nüsha. QPCR ve çift katmanlı plak tahlil T7 fajının klon her seyreltme, konsantrasyon ölçmek için kullanılmıştır. Veri her ölçekte her tedavi grubu için standart sapma (SD) ile ortalama değeri olarak gösterildi. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Tekrarlanabilirliği
Konsantrasyonu (gc/µL) CV veri %
10 1 27,2
10 2 7,65
10 3 2.85
10 4 15,7
10 5 15,6
10 6 5,03
10 7 4.7.1

Tablo 1: tekrarlanabilirlik için bir T7 fajının CX7C klon qPCR yönteminin. İntra değişkenlik miktar 10 ölçeğinde test edildi1 ' e 107 gc/µL T7 klon DNA, varyasyon (CV) katsayısı için qPCR yöntemi tekrarlanabilirlik ifade etmek demek için standart sapma oranı olarak hesaplanmıştır. CVs için test konsantrasyonları 2.85-%27,2 aralığında hesaplanan.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

QPCR yöntemleri fajının genomik DNA5ölçmek için geliştirdiğimiz ve burada açıkladığımız ve T7 phages karşı bir CF benzeri mukus bariyer seçili numaralandırmak için qPCR yöntemini benimsemiştir. Yayın, nicel gerçek zamanlı PCR deneyler (MIQE) yönergeleri için en az bilgiyi geliştirmek ve numaralandırma T7 phages15qPCR yöntemini doğrulamak için adapte. Phages biopanning deneyler üzerinden ölçmek için geliştirilmiş zaman verimli, güvenilir ve ekonomik bir yaklaşım protokolüdür. Bizim protokol qPCR numune hazırlama için yalnızca yüksek sıcaklık (100 ° C, 15 dk) fajının çözüm kullanılan ve geleneksel stratejileri11,17' yekarşılaştırıldığında faj DNA çıkarma ve arıtma adımları gerek yoktu, 18. Ayrıca, daha doğrusu fajının parçacıklar numaralandırmak için DNaz fajının çözüm sigara kapsüllenmiş faj DNA18,19,20kaldırmak için yüksek sıcaklık tedavi önce eklendi. Sigara kapsüllü, kalan DNA fajının çözümde kapsülleme fajının amplifikasyon ve/veya bozulma fajının parçacıkların sırasında eksikliği neden olabilir. Sonuç olarak, doğru bir şekilde genomik DNA'ları kullanarak bozulmamış fajının parçacıkları sayısını ölçmek için DNaz ön arıtma fajının genom kopya artifactually yüksek değerleri önlemek için çok önemlidir.

Geliştirme ve doğru bir şekilde phages ölçmek için qPCR kullanımı çok sayıda konuları vardır. QPCR veri değişimi Protokolü oluşabilir ve aşağıdaki doğru numaralandırma elde etmek için dikkate alınmalıdır. Emin olmak Feyc lizis yüksek sıcaklık tedavi ile ve faj örnek tüpler buharlaşma ve yoğunlaşma su nedeniyle örnek toplama sonraki dalgalanmalar önlemek için mühürlü koşulları tutmak önemlidir. PCR reaksiyon toplam hacmi ve küçük ayarlanmış pipets ve numune hazırlama her adımında güvenilir pipetting beceri gerektirir. Bisiklete binme qPCR sırasında güvenilir sıcaklık fonksiyonu kontrol doğru qPCR veri için gereklidir ve rutin qPCR alet termal cycler kalibrasyonu gereklidir. Varyasyon denetlemek için alternatif adımlar iletişim kuralında tarif edildi. Toplam PCR reaksiyon ortaya çıkarsa operatör düşük hacimli pipetting zorluk için 20-25 µL ölçeklendirilecektir. Sorun giderme için yukarıda belirtilen adımları yanı sıra, standart DNA15,21,22,23iç kontrol Protokolü gerektirir. Bir mutlak miktar yöntemi olarak standart eğri doğrusal katsayısı fajının numaralandırma verilerin doğruluğunu belirler. Bir iç kontrol DNA'yı kullanarak örnek vadede varyasyon numune hazırlama ve qPCR ekipman en aza indirebilirsiniz.

Yukarıda açıklanan fajının miktar yöntemlerine göre bizim protokol numaralandırma fajının konsantrasyonları geniş bir dizi sağlar ve bulaşıcı ve bulaşıcı olmayan fajının parçacıklar ve DNaz tedavi olmadan ayırt edebilir. Ayrıca, çok sayıda örnekleri, Çift katman plak tahlil ve diğer yöntemleri ile karşılaştırıldığında daha düşük maliyetli, zaman verimli ve yüksek üretilen iş yapma miktarının için çekici bizim protokolüdür.

Özet olarak, bu iletişim kuralını fajının parçacıklar içinde a değişiklik-in vitro ve in vivo biopanning, fajının Kütüphane DNA hazırlık yeni nesil sıralama ve çevre fajının gibi uygulamaları numaralandırmak için adapte edilebilir bulaşma.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

Bu eser ilaç Vakfı araştırma Starter hibe tarafından desteklenen ve ulusal kalp, akciğer ve kan Enstitüsü Ulusal Sağlık Enstitüleri Ödülü numarası R01HL138251 altında verin.

Materials

Name Company Catalog Number Comments
Materials and Reagents
Primers for T7 genomic DNA IDT F: CCTCTTGGGAGGAAGAGATTTG
R: TACGGGTCTCGTAGGACTTAAT
T7 Select packaging control DNA EMD Millipore 69679-1UG
MicroAmp optical 96-well reaction plate ThermoFisher Scientific N8010560
qPCR master mix--Power up SYBR Green master mix Applied biosystems A25742
MicroAmp optical adhesive film kit ThermoFisher Scientific 4313663
T7Select 415-1 Cloning Kit EMD Millipore 70015 User protocols : http://www.emdmillipore.com/US/en/product/T7Select-415-1-Cloning-Kit,EMD_BIO-70015#anchor_USP
DNase I solution ThermoFisher Scientific 90083
24-well transwell plate Corning 3472
UltraPure DNase/RNase-Free Distilled H2O Invitrogen 10977015
Phosphate Buffered Saline (1x) Corning 21040CV
Name Company Catalog Number Comments
Equipments
ViiA7 Real-Time PCR System with Fast 96-Well Block ThermoFisher Scientific 4453535
Heraeus Pico 21 Microcentrifuge ThermoFisher Scientific 75002415
Fisherbrand Digital Vortex Mixer Fisher Scientific 02-215-370
HERMO SCIENTIFIC Multi-Blok Heater ThermoFisher Scientific Model:2001
Sorvall Legend X1 Centrifuge ThermoFisher Scientific 75004220
M-20 Microplate Swinging Bucket Rotor ThermoFisher Scientific 75003624
Name Company Catalog Number Comments
Software
QuantStudio Real-time PCR software ThermoFisher Scientific v1.2
Real-time qPCR primer design IDT
OligoAnalyzer 3.1 IDT

DOWNLOAD MATERIALS LIST

References

  1. Smith, G. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science. 228, (4705), 1315-1317 (1985).
  2. Smith, G. P., Petrenko, V. A. Phage Display. Chemical Reviews. 97, (96), 391-410 (1997).
  3. Sergeeva, A., Kolonin, M. G., Molldrem, J. J., Pasqualini, R., Arap, W. Display technologies: Application for the discovery of drug and gene delivery agents. Advanced Drug Delivery Reviews. 58, (15), 1622-1654 (2006).
  4. Dias-Neto, E., et al. Next-generation phage display: Integrating and comparing available molecular tools to enable costeffective high-throughput analysis. PLoS ONE. 4, (12), 1-11 (2009).
  5. Peng, X., Nguyen, A., Ghosh, D. Quantification of M13 and T7 bacteriophages by TaqMan and SYBR green qPCR. Journal of Virological Methods. 252, (June 2017), 100-107 (2017).
  6. Khan, M. S., Pande, T., Mvan de Ven, T. G. Qualitative and quantitative detection of T7 bacteriophages using paper based sandwich ELISA. Colloids and Surfaces B: Biointerfaces. 132, 264-270 (2015).
  7. Brasino, M., Lee, J. H., Cha, J. N. Creating highly amplified enzyme-linked immunosorbent assay signals from genetically engineered bacteriophage. Analytical Biochemistry. 470, 7-13 (2014).
  8. Yu, X., Burgoon, M., Shearer, A., Gilden, D. Characterization of phage peptide interaction with antibody using phage mediated immuno-PCR. J immunol Methods. 326, (1-2), 33-40 (2007).
  9. Lehmusvuori, A., Manninen, J., Huovinen, T., Soukka, T., Lamminmäki, U. Homogenous M13 bacteriophage quantification assay using switchable lanthanide fluorescence probes. BioTechniques. 53, (5), 301-303 (2012).
  10. Schlaman, H. R. M., et al. Analysis of interactions of signaling proteins with phage-displayed ligands by fluorescence correlation spectroscopy. Journal of Biomolecular Screening. 13, (8), 766-776 (2008).
  11. Tjhung, K. F., Burnham, S., Anany, H., Griffiths, M. W., Derda, R. Rapid enumeration of phage in monodisperse emulsions. Analytical Chemistry. 86, (12), 5642-5648 (2014).
  12. Reitinger, S., Petriv, O. I., Mehr, K., Hansen, C. L., Withers, S. G. Purification and quantitation of bacteriophage M13 using desalting spin columns and digital PCR. Journal of Virological Methods. 185, (1), 171-174 (2012).
  13. T7Select Biopanning Kit. Millipore Sigma. Available from: https://www.emdmillipore.com/US/en/product/T7Select-Biopanning-Kit,EMD_BIO-70018#anchor_USP (2018).
  14. Schneider, A., Hommel, G., Blettner, M. Linear Regression Analysis. Deutsches Ärzteblatt international. 107, (44), 776-782 (2010).
  15. Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggert, J. The MIQE Guidelines: Minimun information for publication of quantitative real-time PCR experiments. Clinical Chemitry. 55, (4), 611-622 (2009).
  16. Lock, M., Alvira, M. R., Chen, S. -J., Wilson, J. M. Absolute Determination of Single-Stranded and Self-Complementary Adeno-Associated Viral Vector Genome Titers by Droplet Digital PCR. Human Gene Therapy Methods. 25, (2), 115-125 (2014).
  17. Fittipaldi, M., et al. Discrimination of infectious bacteriophage T4 virus by propidium monoazide real-time PCR. Journal of Virological Methods. 168, (1-2), 228-232 (2010).
  18. Lodder, W. J., et al. Reduction of bacteriophage MS2 by filtration and irradiation determined by culture and quantitative real-time RT-PCR. Journal of Water and Health. 11, (2), 256-266 (2013).
  19. Brown-Jaque, M., et al. Antibiotic resistance genes in phage particles isolated from human feces and induced from clinical bacterial isolates. International Journal of Antimicrobial Agents. (2017).
  20. Naveca, F. G., et al. Multiplexed reverse transcription real-time polymerase chain reaction for simultaneous detection of Mayaro, Oropouche, and oropouche-like viruses. Memorias do Instituto Oswaldo Cruz. 112, (7), 510-513 (2017).
  21. Jia, J., et al. Simultaneous detection and differentiation of human parvovirus B19 and human parvovirus 4 by an internally controlled multiplex quantitative real-time PCR. Molecular and Cellular Probes. 36, 50-57 (2017).
  22. Bliem, R., et al. A novel triplex quantitative pcr strategy for quantification of toxigenic and nontoxigenic Vibrio cholerae in aquatic environments. Applied and Environmental Microbiology. 81, (9), 3077-3085 (2015).
  23. Wan, Z., Goddard, N. L. Competition Between Conjugation and M13 Phage Infection in Escherichia coli in the Absence of Selection Pressure: A Kinetic Study. G3 Genes|Genomes|Genetics. 2, (10), 1137-1144 (2012).
T7 bakteriyofaj Biopanning üzerinden kantitatif PCR
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).More

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter