Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
JoVE Journal Immunology and Infection

Immunology and Infection

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Published: November 7, 2018 doi: 10.3791/58200
Automatic Translation
1, 1, 1, 1, 1
1State Key Laboratory of Diarrhea Disease Detection, Zhuhai International Travel Healthcare Center

Summary

Salmonella spp./Shigella spp. are common pathogens attributed to diarrhea. Here, we describe a high-throughput platform for the screening of Salmonella spp./Shigella spp. using real-time PCR combined with guided culture.

Abstract

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella spp./Shigella spp. The gold standard method for the detection of Salmonella spp./Shigella spp. is direct culture but this is labor-intensive and time-consuming. Here, we describe a high-throughput platform for Salmonella spp./Shigella spp. screening, using real-time polymerase chain reaction (PCR) combined with guided culture. There are two major stages: real-time PCR and the guided culture. For the first stage (real-time PCR), we explain each step of the method: sample collection, pre-enrichment, DNA extraction and real-time PCR. If the real-time PCR result is positive, then the second stage (guided culture) is performed: selective culture, biochemical identification and serological characterization. We also illustrate representative results generated from it. The protocol described here would be a valuable platform for the rapid, specific, sensitive and high-throughput screening of Salmonella spp./Shigella spp.

Introduction

Diarrhea is still a common health issue with a high incidence rate globally1,2. Though the mortality is relatively low, some patients show various symptoms for weeks (such as loose and watery stools, an urgency to go to the bathroom), which make the socioeconomic impact very high3,4. More seriously, some patients may even develop irritable bowel syndrome if left untreated5. There are various kinds of bacteria, viruses and parasites that can cause diarrhea6. Salmonella spp./Shigella spp. are among the most common bacteria for the transmission of acute gastroenteritis7,8,9,10,11. Therefore, many counties have issued laws or regulations for regular Salmonella spp./Shigella spp. screening among people who would handle food and water. For example, the Chinese government have issued laws for obligatory Salmonella spp./Shigella spp. screening once a year.

The gold standard method for Salmonella spp./Shigella spp. detection is bacteria culture. Through bacteria culture and successive biochemical identification and serological characterization, we can identify the species of bacteria, which could facilitate disease outbreak management and antimicrobial profiling to aid the treatment of patients12. It could also help trace the source of infection during the Salmonella spp./Shigella spp. outbreak13. However, this method is labor-intensive (requiring manual operation) and time-consuming (taking several days), especially for the testing of large numbers of samples7. Moreover, viable but non-culturable (VBNC) Salmonella spp./Shigella spp.may exist in some stool samples14. In view of these drawbacks, many laboratories have tried to develop new techniques for the detection of Salmonella spp./Shigella spp.15,16,17,18,19,20,21,22,23,24,25. All these methods use the nuclear acid amplification test (NAAT), among which the polymerase chain reaction (PCR) is the most common. One major limitation of these NAAT based methods is that dead bacteria, even bacterial debris containing incomplete genomic DNA, could show positive results26, which could largely influence the accurate diagnosis of disease. Blanco et al. showed that molecular assay is highly sensitive, not only to viable Salmonella in cultures, but also to partial genomes and dead or unviable bacteria from past infections or contamination26. Therefore, new technology should be developed.

Here, we described a novel method that combines the NAAT based method and culturing. As shown in Figure 1, this new method applies real-time PCR screening first and then positive samples are sent for bacteria culture and identification.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

The protocol follows the guidelines set by the human research ethics committee of Zhuhai International Travel Healthcare Center. Please use standard sterile operation during the experiment.

1. Culture Media Composition and Preparation

  1. Prepare Nutrient Broth: Dissolve 1% peptone, 0.3% beef extract, 0.5% sodium chloride, 0.1% glucose in H2O, adjust pH to 7.5 and autoclave it in 121 °C for 15 min.
  2. Prepare Selenite Cystine medium: Dissolve 0.5% peptone, 0.4% lactose, 1%Na2HCO3, 0.4% sodium hydrogen selenite, 0.001% L-Cystine in H2O, adjust pH to 7.0 and boil it for 5 min.
  3. Prepare the Xylose, Lysine, Deoxycholate agar (XLD) plate: Dissolve 0.3% yeast extract, 0.5% L-lysine, 0.375% xylose, 0.75% lactose, 0.75% sucrose, 0.5% sodium chloride, 0.008% phenol red, 0.68% sodium thiosulfate, 0.08% ammonium ferric citrate, 0.25% sodium deoxycholate, 1.5% agar in H2O, and adjust pH to 7.4. Then boil it for 5 min and pour it into 90 mm plates.
  4. Prepare the Salmonella chromogenic agar plate: Dissolve 1.5% agar, 0.7% peptone and yeast extract, 1.29% selective reagent in H2O. Then boil it for 5 min and pour it into 90 mm plates.
  5. Prepare the Nutrient agar plate: Dissolve 1% peptone, 0.3% beef extract, 0.5% sodium chloride, 1.5% agar in H2O, and adjust pH to 7.3. Then autoclave it in 121 °C for 15 min and pour it into 90 mm plates.
  6. Prepare the MacConkey agar (MAC) plate: Dissolve 2% peptone, 1% lactose, 0.5% sodium chloride, 0.5% OX Bile Salt, 0.0025% Neutral Red, 1.5% agar, 0.0001% crystal violet in H2O, and adjust pH to 7.2. Then autoclave it in 115 °C for 20 min and pour it into 90 mm plates.

2. Real-time PCR

  1. Sample collection
    1. Insert an anal swab into the patient's anus 3-5 cm deep, and rotate it 360° around.
    2. Put the anal swab into a sterile collection tube. Mark sample ID.
    3. Send the sample to laboratory as soon as possible.
      NOTE: Samples could be stored at 4 °C for no more than 24 h.
  2. Pre-enrichment
    1. Add 3 mL of Nutrient Broth into each sample in the collection tube.
    2. Incubate at 36 °C for 6 h in an incubator.
  3. Sample mixing (optional)
    1. Collect 100 µL of each pre-enrichment culture and mix 8-10 samples of 1 specimen into a 1.5 mL tube if there are more than 10 samples.
    2. Mark properly.
  4. DNA extraction
    1. Centrifuge the pre-enrichment culture at 800 x g for 2 min to allow large particles to settle down, and transfer the supernatant to a new tube and centrifuge at 12,000 x g for 5 min. Discard the supernatant by aspiration.
    2. Add 100 µL of DNA extraction solution (0.01 M pH 8.0 Tris-EDTA, 0.01% Nonidet P 40 (NP40)) to the pellet. Vortex vigorously for 1 min.
    3. Boil at 100 °C for 5 min on a dry bath.
    4. Centrifuge at 12,000 x g for 5 min. Collect the supernatant using a new tube, which will be the template for the succeeding real-time PCR analysis.
  5. Real-time PCR
    1. Setup the reaction mixture as follow: for each sample, add 12.5 µL of 2x reaction mixture, 0.4 µM of each primer, 0.2 µM of each probe (sequences in Table 1)27, 5 µL of the template as prepared in step 2.4.4, and use ddH2O to add up to 25 µL total volume.
    2. Setup the cycling program as follow: 95 °C for 3 min, followed by 40 cycles of 95 °C for 15 s, 55 °C for 30 s, 72 °C for 34 s. Collect fluorescent signals from 6-carboxy-fluorescein (FAM) and Hexachlorofluorescein (HEX) channels at the elongation step (72 °C) automatically by the fluorescent real-time PCR machine.
    3. Perform real-time PCR on a fluorescent real-time PCR machine, according to instructions of the instrument.
    4. Go to Step 4 directly and issue negative reports if negative results occur on the FAM/HEX channels, which means that samples are negative for Salmonella spp./Shigella spp.
    5. Go to step 3.1 and/or 3.2 if positive results occur on the HEX and/or FAM channels, which means that the sample may be positive for Salmonella spp. and/or Shigella spp., respectively.
      NOTE: If sample mixing has been performed in step 2.3, then real-time PCR on individual samples which made up the positive one should be performed to screen out the real positive sample.

3. Guided Culture

  1. Salmonella spp. PCR positive sample
    1. Selective culture in medium
      1. Add 100 µL of pre-enrichment culture into 5 mL of Selenite Cystine medium in a test tube. Incubate at 36 °C for 18–24 h in an incubator.
    2. Separating culture on plate
      1. Collect one loop of the culture with a micro-loop and spread onto a XLD plate or Salmonella chromogenic agar plate. Incubate at 36 °C for 18-24 h in an incubator.
    3. Biochemical identification
      1. Select suspicious colony on XLD plate (pink colony with/without dark heart; dark colony; yellow colony with/without dark heart) or Salmonella chromogenic agar plate (purple or prunosus colony, smooth and round) (Figure 2).
      2. Subject suspicious colony for biochemical identification on automated microbial identification system, according to instructions of the instrument.
    4. Serological characterization
      1. O antigen characterization
        1. Add one drop of the O antigen polyvalent sera onto a clean slide.
        2. Collect one loop of the colony with a micro-loop and grind in the sera.
        3. Go to step 3.1.4.1.4 if it looks like flowing sand, which means that the colony is reactive to the sera (Figure 3). Otherwise, go to step 3.1.4.1.5.
        4. Use O antigen monovalent sera to repeat steps 3.1.4.1.1 to 3.1.4.1.3 until the specific O antigen is characterized.
        5. Use Vi sera to repeat steps 3.1.4.1.1 to 3.1.4.1.3. Collect those Vi sera reactive colonies in a tube and boil at 100 °C for 5 min in a dry bath. Centrifuge at 12,000 x g for 5 min. Collect the pellet and repeat steps 3.1.4.1.1 to 3.1.4.1.4 until specific O antigen is characterized.
      2. H antigen characterization
        1. Add one drop of the H antigen polyvalent sera onto a clean slide.
        2. Collect one loop of the colony with a micro-loop and grind in the sera.
        3. Go to step 3.1.4.2.4 if it looks like flowing sand, which means that the colony is reactive to the sera.
        4. Use H antigen monovalent sera to repeat steps 3.1.4.2.1 to 3.1.4.2.3 until specific H antigen is characterized.
          NOTE: Sometimes serum induction may be needed to characterize the second phase H antigen. If so, then the following optional steps should be performed.
        5. (Optional) Add one drop of specific H antigen sera onto Nutrient agar plate. Wait until all the sera are absorbed.
        6. (Optional) Collect one loop of the colony with a micro-loop and spread onto the plate where specific H antigen sera are absorbed. Incubate at 36 °C for 18-24 h in an incubator.
        7. (Optional) Use H antigen monovalent sera to repeat steps 3.1.4.2.1 to 3.1.4.2.3 until second phase H antigen is characterized.
        8. Go to step 4.
  2. Shigella spp. PCR positive sample
    1. Separating culture on plate
      1. Collect one loop of the pre-enrichment culture with a micro-loop and spread onto a XLD plate or MAC plate. Incubate at 36 °C for 18–24 h in an incubator.
    2. Biochemical identification
      1. Collect suspicious colony on XLD plate (smooth, round, transparent and red colony) or MAC plate (smooth, round, transparent and colorless colony with 2-3 mm in diameter; Shigella sonnei may be bigger and turn to light pink as the elongation of incubation time) (Figure 4).
      2. Subject suspicious colony for biochemical identification on automated microbial identification system, according to instructions of the instrument.
    3. Serological characterization
      1. Add one drop of the Shigella spp. polyvalent sera onto a clean slide.
      2. Collect one loop of the colony with a micro-loop and grind in the sera.
      3. Go to step 3.2.3.4 if it looks like flowing sand, which means that the colony is reactive to the sera.
      4. Use Shigella spp. monovalent sera to repeat steps 3.2.3.1 to 3.2.3.3 until specific Shigella spp. is characterized.
      5. Go to step 4.

4. Report

  1. Issue positive or negative reports according to the above results.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

The protocol was applied for the screening of Salmonella spp./Shigella spp. in anal stool samples from people who would handle food and water.

In the real-time PCR step, as shown in Figure 5A, there was a successful amplification in HEX channel, which meant that the mixed sample was positive for Salmonella spp. Then a further real-time PCR was conducted on individual samples which made up the positive one. As shown in Figure 5B, sample 2 was positive. Therefore, sample 2 was chosen for the guided culture of Salmonella spp. In Figure 5C, there was a successful amplification in the FAM channel, which meant that the mixed sample was positive for Shigella spp. Then a further real-time PCR was conducted and sample 10 was found to be positive (Figure 5D). Therefore, sample 10 was chosen for the guided culture of Shigella spp.

In the guided culture of Salmonella spp., there were pink colonies and purple colonies on XLD plate and Salmonella chromogenic agar plate, separately, as shown in Figure 2. Then these colonies were subjected to biochemical identification on automated microbial identification system. Results showed that it was Salmonella spp., with species unknown. Therefore, serological characterization was performed (Figure 3) and it was reactive to O4, O12, Hb, H1,2. According to the White-Kauffmann-Le Minor scheme, sample 2 was finally reported as positive for Salmonella paratyphi B. While for the guided culture of Shigella spp., there were pink red and colorless colonies on XLD plate and MAC plate, separately, as shown in Figure 4. Then these colonies were also subjected to biochemical identification on automated microbial identification system. Results showed that it was Shigella sonnei. To confirm its specific serotype, serological characterization was performed (Figure 3) and it was reactive to sonnei phase II. Therefore, sample 10 was finally reported as positive for Shigella sonnei phase II.

Figure 1
Figure 1: The diagram of the protocol. Two major steps were shown and separated by dash line. Please click here to view a larger version of this figure.

Figure 2
Figure 2: Representative culture results of Salmonella spp. on XLD plate and Salmonella chromogenic agar plate. On XLD plate, there were pink colonies with/without dark heart, while on Salmonella chromogenic agar plate, there were purple colonies. Please click here to view a larger version of this figure.

Figure 3
Figure 3: Representative serological characterization result. If the colony was reactive to the sera, it looked like flowing sand (left). Otherwise, it was turbid (right). Please click here to view a larger version of this figure.

Figure 4
Figure 4: Representative culture results of Shigella spp. on XLD plate and MAC plate. On XLD plate, there were red colonies, while on MAC plate, there were transparent and colorless colonies. Please click here to view a larger version of this figure.

Figure 5
Figure 5: Representative real-time PCR results. (A) HEX channel for mix samples. (B) HEX channel for individual samples. (C) FAM channel for mix samples. (D) FAM channel for individual samples. PC: positive control. NC: negative control. Please click here to view a larger version of this figure.

Pathogen Name Sequence(5'-3')
Salmonella Sal-F
Sal-R
Sal-probe		 gctcatattaattccggcatttac
caggtcaatagccagaaagg
HEX-ataagtaatccaatccgaaatgcctgcgt-Eclipse
Shigella Shi-F
Shi-R
Shi-probe		 ccgggataaagtcagaactc
cagtggagagctgaagtttc
FAM-aggccaggtagacttctatctcatccac-Eclipse

Table 1: Primers and probes used. The name and sequences of the primers and probes were provided.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Since Salmonella spp./Shigella spp. are often associated with food poisoning and fecal-oral transmission of acute gastroenteritis28,29 and the routine method is either labor-intensive or time-consuming7, we describe a high-throughput platform for the Salmonella spp./Shigella spp. screening, using real-time PCR combined with guided culture.

There are several steps that need consideration to maximize the capability of this platform. The first one is the pre-enrichment step of samples in Nutrient Broth (step 2.2). Though no pre-enrichment step is needed for stool samples collected from those patients with obvious symptoms, such as diarrhea, etc., a general 6 h pre-enrichment step is still needed for anal swab samples, when collected during the pre-employment physical examination for people who would handle food and water, as those people were mainly healthy or at least asymptomatic adults. If the protocol was only applied for the detection of Salmonella spp., then pre-enrichment could be conducted in Selenite Cystine medium in order to increase the sensitivity. The second critical step is the identification of suspicious colonies (step 3.1.3.1 and 3.2.2.1). There are many interfering background flora in the stool samples that may mask the detection and isolation of target pathogens30. Therefore, the characteristic of the suspicious colonies as defined in step 3.1.3.1 and 3.2.2.1 should be kept in mind during the experiment. The third critical step is the serological characterization of Salmonella spp. As a majority of Salmonella spp. contain a second phase for H antigen31, serum induction needs to be performed. However, the serum induction is not always successful, and several rounds of induction may be needed to determine the correct second H phase.

The protocol is highly specific and sensitive as verified by our previous study27. The high specificity of the protocol is demonstrated by its ability, in which Salmonella spp./Shigella spp. could be distinguished from other related pathogens27. The lower limit of detection of the protocol is 104 CFU/mL and 103 CFU/mL for Salmonella spp. and Shigella spp., respectively27, which are comparable to previous reports7,32,33,34. As we stated above, the sensitivity of Salmonella spp. detection could be further increased by Selenite Cystine pre-enrichment if the protocol was only applied for the detection of Salmonella spp. Moreover, the protocol could increase the positive rate by two folds and decrease the workload/median turnaround time significantly27.

Similar to other NAAT assays, one major limitation of the protocol, when compared to classic bacteria culture method, is that the protocol could only identify Salmonella spp./Shigella spp., while other common diarrhea-causing bacteria are omitted7. In contrast, during classic bacteria culture, those bacteria could be identified in parallel if they existed. Another limitation of the protocol is that some of Salmonella spp./Shigella spp. could not be identified by the real-time PCR due to sequence variations27. However, if negative real-time PCR results appear for those samples from patients with obvious clinical symptoms, laboratory technicians should pay attention and may conduct other experiments to confirm the results. During a large outbreak, we may use a single sample instead of pooled samples for the first round of PCR screening.

In conclusion, the protocol provided here could serve as a valuable platform for the screening of Salmonella spp./Shigella spp.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

The authors have nothing to disclose.

Acknowledgments

This work was supported by the Science and Technology Program of Zhuhai, China (grant number 20171009E030064), the Science and Technology Program of Guangdong, China (grant number 2015A020211004) and the Science and Technology Program of General Administration of Quality Supervision, Inspection and Quarantine of the People's Republic of China (grant number 2016IK302, 2017IK224).

Materials

Name Company Catalog Number Comments
Tris Sigma 10708976001
EDTA Sigma 798681
NP40 Sigma 11332473001
ddH2O Takara 9012
PrimeSTAR HS (Premix) Takara R040Q
Nutrient Broth LandBridge CM106
Nutrient agar LandBridge CM107
Selenite Cystine medium LandBridge CM225
XLD LandBridge CM219
MAC  LandBridge CM908
Salmonella chromogenic agar CHROMagar SA130
Salmonella diagnostic serum Tianrun SAL60
Shigella diagnostic serum Tianrun SHI54
anal swab (collecting tube plus) Huachenyang
slide Mingsheng 7102
micro-loop Weierkang W511
incubator Jinghong DNP-9082
autoclave AUL SS-325
dry bath Jinghong KB-20
automated microbial identification system bioMérieux VITEK2 other equivalent system could be used
fluorescent real-time PCR machine ThermoFisher ABI7500 other equivalent machine could be used

DOWNLOAD MATERIALS LIST

References

  1. Roy, S. L., Scallan, E., Beach, M. J. The rate of acute gastrointestinal illness in developed countries. Journal of Water and Health. 4, Suppl 2 31-69 (2006).
  2. Wilking, H., et al. Acute gastrointestinal illness in adults in Germany: a population-based telephone survey. Epidemiology and Infection. 141 (11), 2365-2375 (2013).
  3. Friesema, I. H. M., Lugnér, A. K., van Duynhoven, Y. T. H. P. Costs of gastroenteritis in the Netherlands, with special attention for severe cases. European Journal of Clinical Microbiology & Infectious Diseases. 31 (8), 1895-1900 (2012).
  4. Henson, S. J., et al. Estimation of the costs of acute gastrointestinal illness in British Columbia, Canada. International Journal of Food Microbiology. 127 (1-2), 43-52 (2008).
  5. Okhuysen, P. C., Jiang, Z. D., Carlin, L., Forbes, C., DuPont, H. L. Post-diarrhea chronic intestinal symptoms and irritable bowel syndrome in North American travelers to Mexico. The American Journal of Gastroenterology. 99 (9), 1774-1778 (2004).
  6. Wongboot, W., Okada, K., Chantaroj, S., Kamjumphol, W., Hamada, S. Simultaneous detection and quantification of 19 diarrhea-related pathogens with a quantitative real-time PCR panel assay. Journal of Microbiological Methods. 151, 76-82 (2018).
  7. Van Lint, P., De Witte, E., Ursi, J. P., Van Herendael, B., Van Schaeren, J. A screening algorithm for diagnosing bacterial gastroenteritis by real-time PCR in combination with guided culture. Diagnostic Microbiology and Infectious Disease. 85 (2), 255-259 (2016).
  8. Liu, J., et al. Use of quantitative molecular diagnostic methods to identify causes of diarrhoea in children: a reanalysis of the GEMS case-control study. Lancet. 388 (10051), 1291-1301 (2016).
  9. Wang, S. M., et al. Surveillance of shigellosis by real-time PCR suggests underestimation of shigellosis prevalence by culture-based methods in a population of rural China. Journal of Infection. 61 (6), 471-475 (2010).
  10. Wikswo, M. E., Hall, A. J. Outbreaks of acute gastroenteritis transmitted by person-to-person contact--United States, 2009-2010. MMWR Surveillance Summaries. 61 (9), 1-12 (2012).
  11. Shen, H., et al. The 12 Gastrointestinal Pathogens Spectrum of Acute Infectious Diarrhea in a Sentinel Hospital, Shenzhen, China. Frontiers in Microbiology. 7, 1926 (2016).
  12. Tariq, A., et al. Molecular profiling of antimicrobial resistance and integron association of multidrug-resistant clinical isolates of Shigella species from Faisalabad, Pakistan. Canadian Journal of Microbiology. 58 (9), 1047-1054 (2012).
  13. Ferrari, R. G., Panzenhagen, P. H. N., Conte-Junior, C. A. Phenotypic and Genotypic Eligible Methods for Salmonella Typhimurium Source Tracking. Frontiers in Microbiology. 8, 2587 (2017).
  14. Oliver, J. D. The viable but nonculturable state in bacteria. The Journal of Microbiology. 43, Spec No 93-100 (2005).
  15. Rintala, A., Munukka, E., Weintraub, A., Ullberg, M., Eerola, E. Evaluation of a multiplex real-time PCR kit Amplidiag(R) Bacterial GE in the detection of bacterial pathogens from stool samples. Journal of Microbiological Methods. 128, 61-65 (2016).
  16. Wohlwend, N., Tiermann, S., Risch, L., Risch, M., Bodmer, T. Evaluation of a Multiplex Real-Time PCR Assay for Detecting Major Bacterial Enteric Pathogens in Fecal Specimens: Intestinal Inflammation and Bacterial Load Are Correlated in Campylobacter Infections. Journal of Clinical Microbiology. 54 (9), 2262-2266 (2016).
  17. Van Lint, P., et al. Evaluation of a real-time multiplex PCR for the simultaneous detection of Campylobacter jejuni, Salmonella spp., Shigella spp./EIEC, and Yersinia enterocolitica in fecal samples. Eur Journal of Clinical Microbiology Infect Dis. 34 (3), 535-542 (2015).
  18. Kamkamidze, G., et al. Rapid Identification Of The Etiological Factors Causing Diarrheal Diseases. Georgian Medical News. (258), 89-92 (2016).
  19. Li, Y. Establishment and Application of a Visual DNA Microarray for the Detection of Food-borne Pathogens. Analytical Sciences. 32 (2), 215-218 (2016).
  20. Zhuang, L., et al. Detection of Salmonella spp. by a loop-mediated isothermal amplification (LAMP) method targeting bcfD gene. Letters in Applied Microbiology. 59 (6), 658-664 (2014).
  21. Shi, X. L., et al. Rapid simultaneous detection of Salmonella and Shigella using modified molecular beacons and real-time PCR. Zhonghua Liu Xing Bing Xue Za Zhi. 27 (12), 1053-1056 (2006).
  22. Mo, Q. H., et al. Preparation of a 96-microwell plate DNA diagnostic chip for detection of foodborne bacteria and its application in an incident of food poisoning. Nan Fang Yi Ke Da Xue Xue Bao. 30 (3), 417-421 (2010).
  23. Wang, H. B., et al. Probe-free and sensitive detection of diarrhea-causing pathogens using RT-PCR combined high resolution melting analysis. Biologicals. 44 (5), 360-366 (2016).
  24. Sun, H., et al. Rapid simultaneous screening of seven clinically important enteric pathogens using a magnetic bead based DNA microarray. World Journal of Microbiology and Biotechnology. 27 (1), 163-169 (2011).
  25. Qi, W., et al. Multiplex PCR assay for rapid detection of five important pathogenic vibrios. Chinese Journal of health laboratory technology. (24), 3497-3500 (2014).
  26. Blanco, G., Diaz de Tuesta, J. A. Culture- and molecular-based detection of swine-adapted Salmonella shed by avian scavengers. Science of the Total Environment. 634, 1513-1518 (2018).
  27. Tang, X. J., Yang, Z., Chen, X. B., Tian, W. F., Tu, C. N., Wang, H. B. Verification and large scale clinical evaluation of a national standard protocol for Salmonella.spp./Shigella.spp. screening using real-time PCR combined with guided culture. Journal of Microbiological Methods. 145, 14-19 (2018).
  28. Dekker, D. M., et al. Drinking water from dug wells in rural ghana--salmonella contamination, environmental factors, and genotypes. International Journal of Environmental Research and Public Health. 12 (4), 3535-3546 (2015).
  29. Gargano, J. W., et al. Mortality from selected diseases that can be transmitted by water - United States, 2003-2009. Journal of Water and Health. 15 (3), 438-450 (2017).
  30. Kumar, R., Surendran, P. K., Thampuran, N. Evaluation of culture, ELISA and PCR assays for the detection of Salmonella in seafood. Letters in Applied Microbiology. 46 (2), 221-226 (2008).
  31. Herrera-Leon, S., et al. Blind comparison of traditional serotyping with three multiplex PCRs for the identification of Salmonella serotypes. Research in Microbiology. 158 (2), 122-127 (2007).
  32. Cunningham, S. A., et al. Three-hour molecular detection of Campylobacter, Salmonella, Yersinia, and Shigella species in feces with accuracy as high as that of culture. Journal of Clinical Microbiology. 48 (8), 2929-2933 (2010).
  33. Eriksson, E., Aspan, A. Comparison of culture, ELISA and PCR techniques for salmonella detection in faecal samples for cattle, pig and poultry. BMC Veterinary Research. 3, 21 (2007).
  34. Dutta, S., et al. Sensitivity and performance characteristics of a direct PCR with stool samples in comparison to conventional techniques for diagnosis of Shigella and enteroinvasive Escherichia coli infection in children with acute diarrhoea in Calcutta, India. Journal of Medical Microbiology. 50 (8), 667-674 (2001).

Tags

High-throughput Platform Screening Salmonella Spp. Shigella Spp. Technique NAAT Fast Method Culture Real-time PCR Screening Bacteria Culture Identification Pathogens Vibrios Staphylococcus E.Coli Visual Demonstration Nutrient Broth Incubate Centrifuge Supernatant DNA Extraction Solution Vortex Heat Reaction Mixture Cycling Program Fluorescent Real-time PCR Machine
A High-throughput Platform for the Screening of <em>Salmonella</em> spp./<em>Shigella</em> spp.
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Yang, Z., Chen, X. B., Tu, C. N.,… More

Yang, Z., Chen, X. B., Tu, C. N., Su, Y., Wang, H. B. A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.. J. Vis. Exp. (141), e58200, doi:10.3791/58200 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter