Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Une procédure d’Isolation RNA axée sur les oligonucléotides Tandem pour récupérer des Complexes protéine-ARNm eucaryotes

doi: 10.3791/58223 Published: August 18, 2018
* These authors contributed equally

Summary

Un tandem RNA isolation (TRIP) pour la récupération des complexes protéine-ARNm endogène formé décrit. Plus précisément, complexes ARN-protéine sont réticulés en vivo, polyadénylé RNAs sont isolés des extraits avec oligo (décollement) perles et ARNm particulier est capturés avec des oligonucléotides antisens RNA mis à jour le. Protéines liés à l’ARNm sont détectés par l’analyse par immunotransfert.

Abstract

Protéines de liaison à l’ARN (pratiques commerciales restrictives) jouent un rôle clé dans le contrôle post-transcriptionnelle de l’expression génique. Caractérisation biochimique des complexes protéine-ADN messagère est donc essentielle pour comprendre le règlement ARNm déduite en protéines qui interagissent ou ARN non codants. Ici, nous décrivons une procédure d’isolement de RNA de tandem (voyage) qui permet la purification des complexes de protéine ARNm endogène formé d’extraits cellulaires. Le protocole en deux étapes consiste à isoler des polyadénylé ARNm avec perles antisens oligo (décollement) et suivantes de capture d’un ARNm d’intérêt avec 3'-biotinylé 2'-O-méthylé RNA oligonucléotides antisens, qui peut ensuite être isolé avec perles de streptavidine. VOYAGE a été utilisé pour récupérer in vivo des complexes mRNA-ribonucléoprotéine (mRNP) réticulé de levure, les nématodes et les cellules humaines pour une analyse ultérieure ARN et des protéines. Ainsi, le voyage est une approche souple qui peut être adaptée à tous types de polyadénylé RNAs à travers les organismes pour étudier la réorganisation dynamique de RNPm imposées par des signaux intracellulaires ou environnementales.

Introduction

Régulation des gènes post-transcriptionnels est conduite à travers les interactions entre les protéines de liaison à l’ARN (pratiques commerciales restrictives), ARN (ncRNA) non codantes et ARNm, qui diriger le traitement, la localisation, la traduction et la décomposition de chaque relevé de notes au sein de cellules1 , 2. l’identification des pratiques commerciales restrictives et ARNnc interagissant avec les ARNm particuliers, établir ce qu’on appelle des complexes/particules ribonucléoprotéiques (RNP), est donc essentielle pour comprendre le sort des ARNm et gène contrôle d’expression. Approches complémentaires sont menées pour la caractérisation biochimique de la RNP complexes3,4: alors que l’approche « centrée sur les protéines » repose sur la purification des pratiques commerciales restrictives spécifiques, l’approche « RNA-centrique » implique la isolement des sous-populations ou RNAs individuels et l’analyse ultérieure des protéines qui interagissent ou ARN. Récemment, une approche axée sur les RNA d’identification du répertoire RBP interagissant avec polyadénylé (poly(A)) ARN5 est devenu plus en plus populaire en y incorporant une étape de réticulation lumière ultraviolette (UV) pour stabiliser la protéine-ARN avant les interactions l’isolement des ARNm, ce qui a considérablement élargi le catalogue des pratiques commerciales restrictives dans les cellules humaines6,7,8,9,10,11, Caenorhabditis elegans 12, saccharomyces cerevisiae12,13,14et autres organismes15,16,17,18, 19,20. Cependant, la cartographie des protéines et/ou ncRNA montés sur des transcriptions particulières est toujours un grand défi. À cette fin, deux approches principales sont actuellement utilisés : d’une part, RNA aptamère tags sont fusionnés à l’ARN d’intérêt pour permettre la purification d’affinité. Ainsi, les RNA aptamères lient avec une forte affinité aux aminosides, y compris la tobramycine et la streptomycine21,22,23,24, ou aux protéines, telles que la protéine de capside de la R17/MS2 phage ou bactériens streptavidine S125,26,27,28,29. Bien que cette approche s’est avérée relativement robuste et polyvalent, il exige le clonage à des fins de conception l’ARN sous enquête et donc ne peut servir à capturer des mRNAs naturel. En revanche, oligonucléotides antisens (ASOs) ont été utilisés très tôt pour la récupération et la caractérisation de fortement exprimée native RNP30,31 et l’ARN viral32. Plus récemment, ASOs ont été appliqués pour capturer longtemps non codant RNAs33,34,35 et en vitro formé RNPm36. Un des principaux facteurs limitants avec toutes les approches centrées sur le RNA sont le nombre de copies de l’ARN d’intérêt, ce qui rend la récupération des ARNm basse exprimée plus problématique. Cette limitation peut être surmontée en upscaling de la réaction ; Toutefois, cela peut conduire potentiellement à l’augmentation de l’arrière-plan.

Ici, nous décrivons notre tandem de ASO-basé récemment mise au point technique d’isolation RNA (TRIP) pour isoler des complexes protéine-ADN messagère native avec haute sélectivité37 (Figure 1). Le protocole comprend deux étapes de purification séquentielle de ASO-basé, à savoir l’isolement des ARNm poly avec oligo (décollement) disponibles dans le commerce couplé perles suivies de capture d’ARNm spécifiques utilisant spécifiquement conçu biotinylé court 2' méthoxy- RNA ASOs. Cette procédure en deux étapes aide à éliminer les protéines contaminantes et ajoute des possibilités de réglage et optimisation. Dans ce cas, voyage a été appliquée sur certains ARNm de levure, nématodes, et confirmer in vivo des cellules humaines forment des complexes de protéine-ADN messagère.

Protocol

1. conception d’oligonucléotides antisens (ASOs)

  1. Analyser la structure secondaire de l’ARNm ou un fragment de celle-ci à l’aide des outils en ligne disponibles38. Par conséquent, entrer dans la séquence de nucléotides (nt) dans la boîte vide. Dans la zone options de base, sélectionnez le Minimum d’énergie libre (MFE) et la fonction de partition et éviter les paires de bases isolées. Dans la boîte d’options de sortie, sélectionnez Interactive RNA parcelle de structure secondaire et enfin cliquez sur le bouton Continuer . Une nouvelle fenêtre s’affiche qui affiche la structure secondaire de l’ARNm d’intérêt.
  2. Sélectionnez au moins trois différents 21-24 nts de longues séquences au sein de l’ADN messagère d’intérêt, préférentiellement dans les régions manquant de structures secondaires détectables (e.g., dans des boucles non structurées) et en 3' non traduite régions (UTR).
    Remarque : Il a été observé que ASOs recuit aux séquences dans les régions 3' non traduite (UTR) exécuté mieux. Il est possible que les ribosomes liés à la séquence codante (CDS) peuvent gêner parfois le recuit d’ASOs. Asos_hfm recuit à 5' UTR n’ont pas été testés.
    1. Sélectionnez les régions avec un ratio de guanidine/cytosine près de 50 % et manque de tandem de nucléotides se répète pour éviter la formation potentielle des épingles à cheveux ou un recuit.
  3. Conception 2'-méthoxy modifié manuellement les oligonucléotides RNA portant une portion de la biotine à la 3', entièrement complémentaires aux régions sélectionnées (étape 1.2) dans la direction désirée ciblent des ARNm.
    Remarque : modifications de méthoxy-2' rendre les RNA résistantes aux ribonucléases cellulaires et augmente le duplex température, ce qui permet pour le lavage rigoureux de fusion. La portion de la biotine est nécessaire pour capturer ASOs avec streptavidine.
    1. Ajuster la température de fusion des hybrides RNA ~ 60-65 ° C et veiller à ce qu’il a une complexité séquence linguistique élevé (> 60 %) déterminées au moyen d’un outillage adapté en ligne39.
    2. Utiliser la base Local Alignment Search Tool40 pour rechercher des potentiels ASO Croix-hybridation avec autres ARNm dans le transcriptome. Sélectionnez Nucleotide BLAST, insérez les séquences dans la boîte vide et sélectionnez l’organisme d’intérêt. Garder les autres paramètres par défaut, puis cliquez sur BLAST.
      Remarque : Un alignement continu même partiel de 8-10 nts peut conduire à la Croix-hybridation et recouvrement de cet ARNm.

2. cell Culture, Irradiation aux rayons UV et cellule Lysis

Remarque : Dans ce qui suit, la procédure est décrite pour la levure S. cerevisiae, nématodes c. eleganset des cellules embryonnaires de rein humain (HEK293). Néanmoins, il peut être adapté à d’autres organismes, ainsi, bien qu’il n’était pas explicitement testé encore.

  1. S. cerevisiae
    1. La croissance de cellules de levure (e.g., souche BY4743 dérivé ; MATa/α his3Δ1/his3Δ1 leu2Δ0/leu2Δ0 LYS2/lys2Δ0 met15Δ0/remplies15 ura3Δ0/ura3Δ0 PFK2:TAP / PFK2) dans 500 mL de médias de la DPJ (extrait de levure de 1 %, 2 % de peptone, 2 % D-glucose) à 30 ° C sous agitation constante à 220 tr/mn.
    2. Recueillir les cellules en phase logarithmique (densité optique à 600 nm (OD)600 ~ 0,6) par filtration à l’aide de filtres de nylon 0,45 µm ou par centrifugation à 3 000 × g pendant 2 min à température ambiante (RT). Jeter le cheminement ou le surnageant, respectivement.
    3. Laver les cellules trois fois avec 25 mL de tampon phosphate-salin (PBS) en utilisant le filtre de nylon de 0,45 µm ou recueillir par centrifugation à 3 000 × g pendant 2 min à ta et éliminer le surnageant. Recueillir les cellules aussi rapidement que possible car le stress imposé pourrait avoir un impact sur les interactions ARN-protéine.
    4. Remettre en suspension les cellules dans 25 mL de PBS et puis versez la suspension dans une boîte de Pétri de 15 cm. Placer le plat sur la glace, enlever le couvercle et exposer les cellules trois fois avec 400 mJ cm-2 de lumière de UV 254 nm dans un UV-RETICULATION avec des pauses de 2 minutes sur la glace entre chaque cycle d’exposition avec un mélange doux.
    5. Transférer les cellules dans un tube de 50 mL et de recueillir les cellules par centrifugation à 3 000 × g pendant 3 min à 4 ° C. Jeter le surnageant et garder le diabolo.
      Remarque : Les cellules peuvent être snap congelés dans l’azote liquide et conservé à-80 ° C.
    6. Remettre en suspension les cellules dans 4 mL de tampons de lyse réfrigérés A (LB-A ; 100 mM Tris-HCl, pH 7.5, LiCl, 10 mM EDTA, 1 % 500 mM Triton X-100, 5 mM DTT, 20 U ml-1 DNase, 100 U ml-1 RNasin, remplir sans EDTA-inhibiteur de la protéase cocktail).
    7. Transférer les cellules dans deux tubes de 2 mL. Ajouter max. Volumes ⅔ de réfrigérés des perles de verre et perturbent les cellules dans un lyser les tissus à 30Hz pendant 10 min à 4 ° C.
    8. Percer un trou dans le fond du tube avec une aiguille chaude et transférer le lysat dans un tube de frais 1,5 mL par centrifugation à 600 × g pendant 30 s.
    9. Désactivez le lysat par trois centrifugations séquentielles à 4 ° C à 3 000 × g pendant 3 min, puis 5 000 × g et 10 000 × g pendant 5 min chacun.
      Remarque : Extraits peuvent être congelés dans l’azote liquide snap et conservés à-80 ° C.
  2. C. elegans
    1. La culture de Bristol N2 vers à 20 ° C sur les plaques de médium de croissance nématode (NGM) (0,3 % de NaCl, 1,7 % d’agar, 0,25 % de peptone, 1 mM CaCl2, le cholestérol de 5 µg/mL, 1 mM MgSO4, 25 mM KPO4 tampon pH 6.0) ensemencés avec la souche OP50 Escherichia coli 41 .
    2. Ajouter 5 mL de tampon de M941 (0,3 % KH2PO4, 0,6 % Na2HPO4, 0,5 % de NaCl, 1 mM MgSO4) pour chaque plaque, secouer la plaque pour remettre en suspension les vers et transférer les vers dans un tube de 15 mL. Placer 2 µL de la suspension dans une diapositive et compter les vers dans la suspension avec un microscope. Puis appliquer le facteur pour calculer le nombre de vers par plaque.
    3. Recueillir ~ 120 000 vers par centrifugation à température ambiante (400 × g, 2 min, RT) et éliminer le surnageant.
    4. Laver les vers trois fois. Par conséquent, ajouter 10 mL de tampon de M9, mélanger par inversion et recueillir les vers par centrifugation à 400 × g pendant 2 min à température ambiante.
    5. Ajouter 15 mL de tampon de M9 à la worms et le placer sur une roue rotatoire pendant 15 min à température ambiante.
    6. Transférer les vers à plaques NGM (~ 4 000 vers par plaque) et exposer à la lumière UV (254 nm) à 300 mJ cm-2 dans un UV-RETICULATION.
    7. Ajouter 5 mL de tampon de M9 directement sur la plaque et secouer la plaque pour remettre en suspension les vers dans la mémoire tampon. Transférer la suspension avec une pipette dans un tube de 15 mL et de recueillir les vers par centrifugation à 400 × g pendant 2 min à température ambiante.
    8. Remettre en suspension les vers dans 2 mL de tampon de lyse B (LB-B ; 100 mM Tris-HCl, pH 8,0, 150 mM NaCl, 1 mM EDTA, 0,75 % IGEPAL, 1 millimètre DTT, 20 U mL-1 DNase, 100 U mL-1 RNasin, remplir sans EDTA-inhibiteur de la protéase cocktail).
    9. Moudre les vers dans un mortier remplie d’azote liquide. Recueillir la poudre dans un tube de 50 mL et dégelez à température ambiante.
      Remarque : L’azote liquide doit être manipulé selon les procédures de sécurité (par exemple, une hotte et la sécurité gants fumées)
    10. Désactivez le lysat, y compris la couche de graisse par centrifugation à 14 000 x g pendant 10 min et ensuite passer la clarification lysat à travers un filtre de 0,45 μm avec une seringue.
  3. Cellules humaines en culture
    Remarque : La description qui suit est issue d’une transfection transitoire des cellules HEK293 avec pGL3-CDKN1B-3' plasmide de journaliste UTR qui exprime la 3′UTR de CDKN1B/27 en aval de la luciole luciférase gène42.
    1. Les cellules HEK293 culture dans de l’aigle de la modification de Dulbecco Medium (DMEM) contenant du glucose de 25 mM et de pyruvate de sodium 1 mM, additionné de 100 U-1 mL de pénicilline, la streptomycine de 100µg mL-1 et 10 % sérum fœtal (SVF) et incuber à 37 ° C dans un chambre humidifiée (incubateur) contenant 5 % de CO2.
    2. Semences de ~ 3 × 106 HEK293 cellules dans une culture de tissu standard 10 cm plat la veille de la transfection. Compter les cellules avec un hémocytomètre.
    3. Mélanger 2 µg du gène rapporteur (e.g., pGL3-p27-3'UTR) avec 20 µL de réactif de transfection et transfecter les cellules à confluence de 70 % (~ 7 × 106 cellules).
    4. Placer les cellules dans un incubateur à 37 ° C pendant plus de 48 h avant la récolte.
    5. Enlever le support avec une pipette sérologique et laver rapidement les cellules deux fois avec 10 mL de PBS préchauffé à 37 ° C. Enlever les PBS avec une pipette sérologique.
    6. Ajouter 6 mL de PBS au plat, placez sur la glace et ensuite exposer les cellules à la lumière UV (254 nm) à 100 mJ cm-2 dans l’UV-RETICULATION.
      Remarque : La plaque doit être conservée sur la glace pendant l’exposition de la lumière UV.
    7. Grattez les cellules (au total 10 ~7 cellules) dans du PBS et transférez dans un tube de 15 mL.
    8. Tournez en bas les cellules à 250 × g pendant 10 min à 4 ° C, puis enlever le surnageant avec une pipette.
      Remarque : Le culot cellulaire peut être snap-congelés dans l’azote liquide et conservé à-80 ° C jusqu'à l’utilisation.
    9. Remettre en suspension les cellules dans 2 mL de tampon de lyse préalablement réfrigérées (LB-A) par pipetage de haut en bas pour 5 - 6 fois, tout en gardant le tube sur la glace.
    10. Transférer le lysat avec une pipette dans un tube de 5 mL mis dans la glace.
    11. Soumettre le lysat à trois tours de la sonication, composé de 20 salves de s à 10 μm amplitude avec 30 s de refroidissement périodes sur la glace.
      Remarque : La Sonication est recommandée où il achève la lyse des cellules et des fragments de l’ADN.
    12. Transférer le lysat à tubes de 2 mL et centrifuger à 15 000 x g pendant 10 min à 4 ° C. Récupérer le surnageant (= extrait) puis transférez dans un nouveau tube. Retirer un échantillon d’analyse (5-10 %) pour davantage de protéines et l’analyse de la RNA.
      Remarque : Cette étape est cruciale pour enlever les débris de cellules restantes et peut être répétée.

3. première étape : Poly RNA Isolation

  1. Equilibrez 1 mg d’oligo (décollement)25-couplée à des billes magnétiques pour 500 µL de la mémoire tampon de lyse respectifs.
  2. Combinez 5 mg, 10 mg ou 4 mg (protéine) de S. cerevisiae, c. elegans ou extraits HEK293, respectivement, avec 1 mg d’oligo (décollement)25 -couplée à des billes magnétiques. Mélanger les échantillons vigoureusement pendant 10 min à 25 ° C dans un mélangeur.
    Remarque : Les concentrations de protéine des extraits peuvent être déterminées avec analyse de Bradford, à l’aide de l’albumine sérique bovine (BSA) comme un étalon de référence. Une agitation vigoureuse des échantillons empêche la sédimentation des perles. Afin d’évaluer la spécificité d’isolement d’ADN messagère, une expérience de contrôle peuvent être effectuée en parallèle en ajoutant un excès (20 µg) de polyadénylique acides (pA).
  3. Placer les tubes sur un support magnétique pour 10 s et enlever le surnageant. Gardez le surnageant sur glace pour les tours suivants de récupération (étape 3,7).
  4. Ajouter 500 µL de lavage tampons A (10 mM Tris-HCl, pH 7.5, 600 mM LiCl, 1 mM EDTA, 0,1 % Triton X-100) aux perles et vortexer pendant 5 s.
    Remarque : La concentration de LiCl dans les tampons de lavage peut varier. 600 mM LiCl est recommandé, mais des concentrations plus faibles ont aussi été testées (500 mM pour c. elegans, 300 mM pour HEK293).
  5. Collecter les perles avec un aimant et laver les perles deux fois avec 500 µL de tampon de lavage B (WB ; 10 mM Tris-HCl, pH 7.5, LiCl, 600 mM EDTA 1 mM).
  6. Éluer l’ARN dans 30 µL de 10 mM Tris-HCl, pH 7.5 à 80 ° C pendant 2 min en continu agitant (1 000 tr/min) dans un mixeur. Immédiatement, placer le tube dans le socle magnétique et recueillir l’éluat après 10 s. sauver les perles pour les journées supplémentaires de purification.
    Remarque : Recueillir l’éluat aussi rapidement que possible pour empêcher de reliaison potentiels des ARNm aux talons à basse température.
  7. Ajouter les perles de l’étape précédente pour le surnageant recueilli à l’étape 3.3 et répétez la capture, lavage et élution des ARNm deux fois (étapes 3,3 à 3,6). Les éluats de coups répétés sont ensuite combinés et peuvent être stockées à-80 ° C.

4. deuxième étape : capture de particulier ARNm avec 3'-biotinylé méthoxy-2' mise à jour le RNA Antisense Oligonucleotides

Remarque : Pour tester la pertinence d’ASOs, la procédure suivante peut être effectuée avec ARN total isolé de cellules.

  1. Équilibrer les 30 µL de billes magnétiques streptavidine couplé dans 1 mL de liaison, laver buffer (tampon B & W ; 10 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0. 5 mM EDTA, pH 8,0) contenant 0,1 mg mL-1Escherichia coli ARN de transfert (ARNt) sur un agitateur pendant 1 h à RT.
    1. Laver les billes trois fois avec 750 µL de tampon de B & W.
    2. Remettre en suspension les perles dans 30 µL de tampon de B & W et rester sur la glace jusqu'à utilisation.
  2. Diluer environ 35 µg de protéines totales de l’isolement de poly (a) précédente (voir 3) dans 100 µL de tampon de B & W dans un tube de 1,5 mL.
    Note : Pour tester la spécificité d’ASOs avec ARN total, ajouter 600 ng d’ARN total purifiée à 100 µL de tampon de B & W.
  3. Ajouter 200 pmol de l’ASO respectif et incuber à 70 ° C pendant 5 min.
    Remarque : La température élevée résout les structures secondaires dans l’ARN facilitant le recuit de l’ASO.
  4. Retirez de la chaleur-rame complète de l’appareil et le placer à la droite pendant 10 min refroidir lentement.
  5. Ajouter 30 µL d’équilibré billes magnétiques streptavidine couplé de l’étape 4.1 à l’échantillon.
  6. Incuber le mélange pendant 30 min à 25 ° C sous agitation constante à 950 tr/min dans un mélangeur.
    Remarque : Il est recommandé de balayer les tubes toutes les 10 min pour empêcher la sédimentation des perles.
  7. Placer les tubes sur le support magnétique, éliminer le surnageant et laver les billes trois fois avec 750 µL de tampon de B & W pré chauffé à 55 ° C.
    Remarque : La température de lavage optimal peut différer/varier légèrement entre différents ASOs. Il est recommandé d’ajuster cette condition préalable de RNA total non réticulé, exécutant l’expérience avec des extraits cellulaires.
  8. Éluer l’ARN dans 20 µL de 10 mM Tris-HCl, pH 7.5 à 90 ° C pendant 10 min avec une agitation constante à 950 tr/min dans une table de mixage. Placer les tubes dans le socle magnétique et recueillir immédiatement l’éluat.
    Remarque : Pour l’analyse des protéines, ajouter 20 µL de tampon de Laemmli × 1 aux talons et incuber à 95 ° C pendant 5 min. protéines sont surveillées par immunobuvardage suite de protocoles standard de laboratoire.

Representative Results

Nous avons développé une stratégie d’isolement RNA ASO-basé appelée voyage, pour capturer des ARNm particuliers avec leurs protéines dépendant de trois organismes différents37. Essentiellement, les complexes ARN-protéines étaient réticulé in vivo par irradiation UV des cellules à 254 nm et poly ARN ont été récupérés avec des perles magnétiques couplé disponible dans le commerce oligo (dT), puis l’ARNm d’intérêt a été isolé avec 3'-biotinylé 2-0'-méthoxy modifiée des oligonucléotides antisens de RNA (Figure 1). Nous donc conçu plusieurs 21-24 RNT modifié ASOs avec plein-complémentarité aux régions dans l’ARNm sélectionnés de levure, c. elegans et l’homme et testé leurs qualités pour récupérer l’ADN messagère d’intérêt (une liste d’amorces et ASOs est donnée en Table 1). spécificité d’ASOs individuels et l’efficacité ont été évaluées tout d’abord avec de l’ARN total non réticulé isolé de l’organisme respectif. Dans ces expériences, RNA ASOs ont été couplés aux billes paramagnétiques conjugué streptavidine et incubées avec l’ARN total non réticulé, préparé à partir de l’organisme correspondant. Après la libération d’ARNm capturées par les perles, la présence d’ARNm cible aussi bien que sans rapport avec contrôle ARNm a été suivie par transcription inverse (RT)-polymerase chain reaction (PCR)37. Nous avons remarqué que deux variables, la concentration en sel et la température de lavage tampons, a joué un rôle crucial dans l’efficacité de la capture de l’ARNm PFK2 de levure qui a été testé avec trois différents ASOs (Figure 2 a). Abaissement de la concentration en sel (NaCl) à 25 mM réduit la récupération du négatif contrôle ARNm (PFK1) à des niveaux non détectables avec ASOs tous, mais il réduit également la récupération de la désirée cibles ARNm PFK2 (10-15 % de l’apport). À l’inverse, une augmentation de la concentration de sel à un niveau physiologique (NaCl 150 mM) augmente la récupération des ARNm PFK2 jusqu'à 75 % avec l’ASO PFK2-2, supérieure à celle du contrôle PFK1 ARNm au moins 5 fois (Figure 2 a). Encore à noter les différents ASOs a montré grande variation d’ARNm efficacité de capture de cible au sel-concentrations physiologiques, mettant l’accent sur la nécessité d’une validation empirique de ASOs. La dépendance de la récupération de l’ARNm sur la température de la mémoire tampon de lavage est illustrée pour le c. elegans cep-1 et de la levure RPS20 mRNA, à l’aide de ASOs respectifs (tableau 1). Nous avons constaté que la température de lavage optimal entre 50 ° C et 55 ° C, comme en témoigne de la faible bruit de fond avec l’ARNm non apparentés et la récupération efficace des ARNm cible (Figure 2 b). À ce stade, nous tenons à souligner la possibilité d’hybridation croisée d’ASOs avec autres ARNm. Par exemple, l’ASO DNM1 est entièrement complémentaire d’une séquence dans le DNM1 séquence codante, mais il est également partiellement recuits avec ACT1 ARNm. ASOs DNM1 récupéré les deux ARNm quelle que soit la température de lavage, montrant la forte propension pour hybridation croisée (Figure 2). Enfin, nous avons utilisé les tests décrits ci-dessus et optimisations pour sélectionner trois ASOs qui sont prêtaient à la récupération des ARNm cibles respectifs de total RNA isolé de S. cerevisiae, c. elegans et des cellules humaines (Figure 2D ).

Après une sélection initiale d’adapté ASOs in vitro, nous avons exécuté voyage avec des extraits de cellules provenant de cellules/organismes UV-réticulé (Figure 1). Plus précisément, nous avons testé la récupération des trois différents ARNm de trois organismes différents : PFK2 ARNm de la levure S. cerevisiae, cep-1 de la nématode c. elegans et un journaliste ARNm (pGL3-CDKN1B-3'UTR) portant la région 3' UTR séquence d’ADN messagère CDKN1B/p27 humaine fusionnée à un journaliste de la luciférase (luc) pour une expression transitoire dans les cellules HEK293 humaines. Pour contrôler la spécificité de l’ARN, nous avons suivi la récupération de plusieurs ARNm non apparentés, et nous avons effectué des expériences de compétition par l’addition d’un excès de pA d’extraits cellulaires, qui rivalise avec la liaison des ARNm cellulaire d’oligo (décollement)25 perles au cours de la première étape de purification. Comme déjà vu avec des échantillons d’ARN totales non réticulé (Figure 2), RT-PCR a confirmé l’enrichissement des mRNAs respectifs cibler ARNm au cours du voyage, alors que plusieurs ARNm non liés à la commande n’était pas riches (Figure 3 a). En outre, ni ARNm ont été détectés sur des billes sans ASOs, indiquant les procédures appropriées de blocage qui évitent la liaison non-spécifique. Sur cette ligne, ASOs indépendants/brouillés peuvent également être utilisés comme contrôle, bien que le potentiel d’hybridation croisée avec certains ARNm et la capture présumée de protéines liées doit donc être pris en compte. Puisque les protéines dans l’éluat final pourraient difficilement être visualisées sur gel de polyacrylamide colorés à l’argent (données non présentées), la présence de protéines qui interagissent précédemment connues de mRNA a été encore évaluée par immunobuvardage. Il s’agit de Pfk2p de S. cerevisiae, qui se lie sélectivement au PFK2 ARNm dans un ribosome manière indépendante12; C. elegans GLD-1, un RBP canonique qui se lie à 3' de séquences UTR de cep-1 ARNm pour régulation traductionnelle43; et HuR, un RTB qui régule la stabilité de l’ARNm et traduction de l' ARNm de p27/CDKN1B 44. Comme prévu, toutes ces protéines ont été identifiées par analyse Western Blot (Figure 3 b) dans les éluats de voyage des ARNm respectifs.

Figure 1
Figure 1. Représentation schématique du voyage. Les protéines sont réticulés de RNA in vivo par irradiation UV. Dans la première étape (boîte à lumière verte), poly (a) ARN-protéine complexes sont récupérés avec oligo (décollement)25 perles en appliquant les conditions de lavage rigoureux pour enlever les protéines non liés. Dans la deuxième étape (boîte rose), la cible mRNP est tirée par des oligonucléotides antisens de RNA biotinylé et perles de streptavidine. La RPN purifiées est ensuite analysées par RT-PCR et immunoblot/spectrométrie de masse (MS) pour identifier les ARN et les protéines qui interagissent avec l’ADN messagère d’intérêt, respectivement. La figure a été modifiée de la précédente publication37 avec permission. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2. Isolement des mRNAs sélectionnés de l’ARN total des cellules non réticulé/à l’aide des organismes modifiés antisens RNA capture sondes. (A) l’Impact des concentrations salines sur la capture de l’efficacité de la levure PFK2 ARNm avec ASOs. ARN total de cellules de levure a été combiné avec l’OSS indiquées et lavé avec un tampon contenant la concentration spécifiée en sel (NaCl) à 55 ° C. Vert, bleus et orange lignes représentent PFK2 récupération d’ARNm avec ASOs différents tel que déterminé par RT-PCR,37: 1-PFK2 et PFK2 -2 recuisent dans la région 3' UTR, PFK2-4 dans les CD. PFK1 est un négatif contrôler des ARNm. PCR a été réalisée avec 32 cycles d’amplification et quantifié comme décrit précédemment37. (B) Fraction de c. eleganscep-1 et de la levure RPS20 ASO lié ARNm à des températures de lavage différents, représentés dans des lignes noires et rouges, respectivement. C. eleganspgk-1 et la levure ACT1 sont ARNm non ciblés (contrôle). 30 et 32 cycles PCR ont été appliquées pour la détection des levures et des ARNm de c. elegans , respectivement. (C) Représentation schématique de l’hybridation de DNM1 ASO (rouge) avec des séquences dans l’ARNm DNM1 comme hybridation croisée potentielle avec ACT1 ARNm est affichée à gauche. Un gel d’agarose, montrant les produits de réactions de RT-PCR (30 cycles) pour la détection de levure DNM1 et ACT1 mRNAs élué de perles est indiqué à droite. Entrée, ARN total ; SN, surnageant après incubation avec ASOs ; E, éluats de perles lavées à indiquent élution préalable de température (40 ° C, 50 ° C et 60 ° C). Une expérience de contrôle (Ctrl) s’est déroulée en parallèle sans ajout d’ASO. Gel d’Agarose (D) montrant les produits de RT-PCR pour la détection des ARNm capturé (à droite) de l’ARN total de levure S. cerevisiae, c. eleganset les cellules HEK293 humains (H. sapiens). Entrée, ARN total ; SN, surnageant ; E, éluats de talons. PCR a été réalisée par 30 cycles d’amplification de l’ARNm de la levure, les 32 cycles d’ARNm de c. elegans , et 28 et 30 cycles pour humain tubuline et ARNm p27 , respectivement. La figure a été modifiée de la précédente publication37 avec permission. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3. Capture des complexes protéine-ADN messagère spécifique des extraits provenant de cellules réticulé UV avec voyage. (A) d’Agarose gélifie pour la détection des ARNm (à droite) avec la RT-PCR sur capture avec oligo (décollement) et ASOs indiquées de S. cerevisiae, c. elegans et extraits de cellules humaines (H. sapiens). Entrée, ARN total de RETICULE cellules/organismes ; CTRL, contrôle sans ASO. Poly (a), concurrence avec poly (a). RT-PCR a été réalisée comme décrite37 avec 35 cycles d’amplification pour LUC, 32 cycles pour p27, et 29 cycles de tubuline. (B) l’analyse par immunotransfert des ARNm lié aux protéines anticorps indiqué (à droite). Fractions chargées sont comme suit : 0,1 %, 2,5 % et 1 % pour la levure, entrées de nématodes et humaines ; 10 %, 10 % et 5 % pour la levure, nématodes et humaines oligo (décollement) voies ; et 66 % pour toutes les voies de l’OSS. Poids moléculaire (MW) sont indiqués en kilodaltons (kDa). Figure republiée avec autorisation37. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Nom de l’apprêt Séquence Objectif Taille
Pfk2_Fwd GTGTTAAGGGTTCACATGTCG PFK2 S. cerevisiae 133 bp
Pfk2_Rev CTTCCAACCAAATGGTCAGC PFK2 S. cerevisiae 133 bp
Pfk1_Fwd GGTGATTCTCCAGGTATGAATG PFK1 S. cerevisiae 97 bp
Pfk1_Rev CTTCGTAACCTTCGTAAACAGC PFK1 S. cerevisiae 97 bp
Act1_Fwd GTCTGGATTGGTGGTTCTATC Act1 S. cerevisiae 85 bp
Act1_Rev GGACCACTTTCGTCGTATTC Act1 S. cerevisiae 85 bp
Dnm1_Fwd CTGTGTTCGATGCATCAGAC DNM1 S. cerevisiae 156 bp
Dnm1_Rev CGCACTCCAATTCTTCTCTC DNM1 S. cerevisiae 156 bp
Rps20_Fwd CGCTGAACAACACAACTTGG RPS20 S. cerevisiae 228 bp
Rps20_Rev GGAAGCAACAACAACTTCGAC RPS20 S. cerevisiae 228 bp
Cep1_Fwd CGATGAAGAGAAGTCGCTGT CEP-1 c. elegans 110 bp
Cep1_Rev ATCTGGGAACTTTTGCTTCG CEP-1 c. elegans 110 bp
Pgk1_Fwd GCGATATTTATGTCAATGATGCTTTC PGK-1 c. elegans 74 bp
Pgk1_Rev TGAGTGCTCGACTCCAACCA PGK-1 c. elegans 74 bp
Mpk1_Fwd TGCTCAGTAATCGGCCATTG MPK-1 c. elegans 74 bp
Mpk1_Rev TCCAACAACTGCCAAAATCAAA MPK-1 c. elegans 74 bp
p27_Fwd TTTAAAAATACATATCGCTGACTTCATGG P27 sapiens de H. 212 bp
p27_Rev CAAAGTTTATGTGCTACATAAAAGGTAAAAA P27 sapiens de H. 212 bp
Luc_Fwd AATGGCTCATATCGCTCCTGGAT Luciférase P. pγralis 117 bp
Luc_Rev TGGACGATGGCCTTGATCTTGTCT Luciférase P. pγralis 117 bp
Β-TUBULIN_Fwd CTGAACCACCTTGTCTCAGC Β-tubuline sapiens H. 136 bp
Β-TUBULIN_Rev AGCCAGGCATAAAGAAATGG Β-tubuline sapiens H. 136 bp
PFK2-1 ASO AAUAGAAAGUGUAAUAAAAGGUCAU 3' UTR PFK2 S. cerevisiae -
ASO PFK2-2 GUUUCAUGGGGUAGUACUUGU 3' UTR PFK2 S. cerevisiae -
ASO PFK2-4 CUUGAAGAGGAGCGUUCAUA ORF PFK2 S. cerevisiae -
DNM1 ASO UCGGUCAGUGGAGGUUCAGCGUUU ORF DNM1 S. cerevisiae -
RPS20 ASO GUCGGUAAUAGCCUUCUCAUUCUUG ORF RPS20 S. cerevisiae -
CEP-1 ASO GUGAGAAAUGCGGUGCUUUGAAA 3' UTR cep-1 c. elegans -
P27 ASO UCAUACCCCGCUCCACGUCAGUU 3' UTR p27 sapiens de H. -

Tableau 1. Les séquences oligonucléotidiques. Liste des amorces de PCR et ASOs utilisés dans ce travail, la séquence d’amorce, la gène cible et la taille du fragment attendu après amplification.

Discussion

VOYAGE permet l’analyse des protéines lié à l’ARNm spécifiques in vivo avec des moyens biochimiques. Alors que nous avons utilisé la méthode pour valider l’interaction des pratiques commerciales restrictives particuliers avec cibles ARNm de différents organismes/cellules, voyage pourrait également s’appliquer à étudier d’autres types de poly RNAs, tels que ncRNA long cytoplasmique. En outre, une analyse systématique des protéines liés et/ou RNAs avec MS ou ARN séquençage pourrait être atteint par un élargissement de la procédure. À cet égard, nos données préliminaires indiquent que 1 L de cultures de levure et au moins 100 millions de cellules HEK293 humaines pourraient fournir matière suffisante pour obtenir des données fiables de MS pour bien exprimée ARNm (résultats non publiés).

Le protocole décrit de voyage inclut l’irradiation des cellules avec la lumière UV à 254 nm aux interactions crosslink ARN-protéine. Cela permet la mise en oeuvre des conditions de lavage rigoureux au cours de la purification. Néanmoins, bien que non explicitement testés, nous tenons à noter que la réticulation est facultative et RNP actif peut aussi être récupérée avec tampons physiologiques. Toutefois, dans ce cas, le réaménagement potentiel des protéines et ARN sur l’ARN cible dans les lysats devrait être tenu compte. À l’inverse, si les UV ou autres procédures de réticulation sont appliquées (p. ex., formaldéhyde), l’intégrité de l’ARN doit être évaluée comme la dégradation de l’ARN pourrait conduire à la diminution de récupération de RNPm. En outre, UV-réticulation est plutôt inefficace (~ 5 %) et encore moins pour les protéines interagissent avec l’ARN bicaténaire, qui pourrait introduire un biais pour la détection de certaines classes de pratiques commerciales restrictives12. Enfin, irradiation aux rayons UV peut induire également des liaisons protéine-protéine et protéine-ADN qui devraient être considérés pour l’interprétation de données45,46. Par conséquent, procédures de réticulation alternatifs, par exemple avec le formaldéhyde, pourraient également être d’un intérêt particulier pour capturer de grandes assemblées de protéine sur l’ARNm.

Une caractéristique clée de voyage est en deux étapes procédure de purification ASO-basé pour récupérer RNAs particuliers, augmentant ainsi la sélectivité et diminue la probabilité de purification des contaminants. Par exemple, une préoccupation concerne ajoutant biotinylé ASOs directement aux extraits cellulaires, ce qui pourraient conduire à co purification des protéines liant la biotine. Pour éviter ce problème en voyage en mettant en place un premier cycle de purification d’ARN poly (a) à l’aide de covalence couplés oligo-(dT)25 billes magnétiques, qui permet à des conditions strictes de purification comme pour capture interactome ARN-protéine. En outre, sélection de RNA poly (a) supprime ncRNA très abondante, comme l’ARN ribosomal et ARNt et donc réduit la complexité de l’échantillon et les sources potentielles d’hybridation croisée et contamination. Dans la deuxième étape, ARNm particulier est récupérés avec biotinylé et modifiés ASOs qui recuisent avec les régions sur les objectifs de l’ARNm. Alternativement, ASOs mis à jour le pourraient également être directement de façon covalente à billes magnétiques par une amine-linker, réduire la propension à capturer des protéines de liaison de biotine. Toutefois, selon notre expérience, l’incubation de la fraction d’ARN poly (a) avec ASOs avant l’ajout de perles de streptavidine récupéré RNPm plus efficacement que l’addition directe d’ASO-couplé de perles. Éventuellement, oligos libres sont cinétiquement favorisés un meilleur accès aux séquences dans l’ARN structurée par rapport aux oligos immobilisée. Par conséquent, le couplage covalent de ASOs à perles avant l’incubation avec l’échantillon pourrait être préjudiciable pour la récupération de la cible de RNA et doit être testées empiriquement.

Un inconvénient avec les méthodes ASO basé est inefficace récupération de certains ARNm cible. Nous recommandons donc l’évaluation de plusieurs ASOs qui recuire dans différentes régions de la transcription. Plus précisément, nous proposons la conception de 2-3 ASOs qui recuisent avec des séquences dans la 3'-UTR ou les CDS de l’ARNm d’intérêt. Chaque ASO peuvent montrer une efficacité différente pour le recouvrement de la cible de mRNA respectifs et devraient être empiriquement testé (Figure 2 a, B, données non présentées). À la fin, nous avons constaté que ASOs recuit à la 3' UTR performants par rapport à celles recuit sur CD. Cela pourrait être dû à une plus grande accessibilité des sites de liaison à RTNS en raison de l’absence de traduction des ribosomes, tandis que les ribosomes peuvent gêner l’hybridation efficace au sein de la CD. Nous avons aussi connu que la combinaison de plusieurs ASOs pourrait conduire à une contamination accrue d’abondants non cibles ARNm et réduit l’efficacité du menu déroulant. Dans tous les cas, la sélectivité de l’oligos choisie peut être contrôlée par des expériences de compétition (e.g., ajout d’oligos concurrentes).

Une autre préoccupation est celle de l’hybridation croisée potentielle avec ARN non apparentés, comme nous avons observé cette hybridation même partielle avec autres ARNm peut conduire à la récupération de cet ARNm (Figure 2). Pour évaluer l’adéquation de l’ASOs conçus, nous recommandons donc de procéder initiale in vitro test avec ARN total afin d’optimiser les concentrations de sels et de la température de lavage de tampons. Dans nos mains, lavage de streptavidine couplé des billes magnétiques dans des tampons contenant 150 mM NaCl à 55 ° C exécuté mieux, mais nous recommandons des tests indépendants des conditions pour chaque ASO conçu. Remarquable, nous ont trouvé de que ASOs tous choisis parmi les expériences in vitro (Figure 2D) appropriés pour capturer les cibles ARNm respectifs d’extraits cellulaires de réticulé (Figure 3), plus justifiant la validité des en vitro tests. Outre la conception ASOs appropriées pour la capture de l’ARNm, facteurs additionnels pourraient avoir une incidence sur la sélectivité. Par conséquent, des procédures détaillées blocage avec BSA et/ou tRNA selon les spécifications de type perle peuvent empêcher liaison non-spécifique à perles. Pour réduire l’absorption non spécifique des protéines, nous recommandons également l’utilisation de tubes de Lo-lier, en particulier lorsque vous travaillez avec de faibles quantités d’échantillons.

En général, voyage peut venir en complément des approches précédemment établies pour capturer RNAs avec ASOs. Par exemple, le RNA de non-codage Xist a été isolé avec des protéines dépendant des extraits nucléaires issus de 200 millions UV réticulé cellules en utilisant un tableau de long (90-mer) biotinylé oligonucléotides d’ADN qui recouvrait la transcription complète 34,,35. Toutefois, l’approche choisie carrelage pourrait devenir problématique compte tenu le fort potentiel d’hybridation croisée avec ARN non apparentés, et il ne peut pas être utilisé pour sélectionner transcription spécifique, par exemple., alternativement épissé formes. Récemment, spécialement l’acide nucléique verrouillé (LNA) ou ADN ASO mixmers ont été de façon covalente à une résine magnétique pour récupérer in vitro de transcription ou hautement exprimé ribosomal RNA d’extraits cellulaires ; Cependant, il n’a pas été testé pour la récupération in vivo formé ARNm en protéines complexes36. À la lumière de la reconnaissance accrue du contrôle post-transcriptional gene par les pratiques commerciales restrictives et ARNnc, nous croyons que le voyage est une méthode utile pour étudier la composition et la dynamique de complexes de RNP dans les cellules des signaux intracellulaires et environnementales et son impact dans la santé et la maladie.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Nous sommes reconnaissants à m. Jonathan Hall et Mauro Zimmermann (ETH Zurich) pour la synthèse de PFK2 et cep-1 ASOs, Dr Maikel Wouters pour la conception de ASOs p27/CDKN1B et Dr Rafal Ciosk (Friedrich Miescher Institute for Biomedical Research, Basel) d’anticorps anti-GLD-1. Ce travail a été soutenu par la biotechnologie et Biological Sciences Research Council (BB/K009303/1) et un Royal Society Wolfson Research prix du mérite (WM170036) à A.P.G.

Materials

Name Company Catalog Number Comments
MaxQ 5000 Large Incubated and Refrigerated Orbital Shaker Thermo Fisher Scientific SHKE5000-8CE Floor shaker to grow yeast cells
BBD 6220 Thermo Fisher Scientific CO2 incubator to grow human cells
Sonicator Soniprep150 MSE MSS150.CX4.5 Sonicator/cell disruptor. Used to shear DNA in human cell lysates
Stratalinker 1800 Stratagene Stratalinker to expose cells to UV light at 254 nm
Tissue Lyser Qiagen RETSCH MM200 Device to mechanically disrupt yeast cells
Refrigerated Centrifuge Eppendorf 5810R Centrifuge to spin down cells, lysates
Shaking incubator, Thriller Peqlab Thermoshaker for 1.5 mL tubes
Glass beads 0.5mm Stratech Scientific Limited 11079105 Lysis of yeast cells
Nylon Filter, 0.41 μm Millipore NY4104700 Collection of yeast cells
Millex-HA Filter, 0.45 µm EMD Millipore SLHA02510 Filter to clear nematode lysate
Eppendorf LoBind microcentrifuge tubes Protein 1.5 mL Sigma-Aldrich 22431081 Minimise protein loss
2 mL microfuge tube Ambion AM12425 Yeast extract preparation and other applications
5 mL tube Thermo Fisher Scientific 129A Collection of HEK293 cell lysate
15 mL tube Sarstedt 62.547.254 Collection C. elegans
50 mL plastic tube Sarstedt 62.554.502 Collection yeast cells
DMEM, high glucose, pyruvate Thermo Fisher Scientific 41966 Media for culturing HEK293 cells
Penicillin-Streptomycin Sigma-Aldrich P4333 Used to supplement cell culture media to control bacterial contamination
Fetal Bovine Serum (FBS) Sigma-Aldrich F7524 Used to supplement cell culture media
Lipofectamine 2000 Thermo Fisher Scientific 11668027 Transfection reagent
RQ1 RNase-Free DNase Promega M6101 DNAse I to degrade DNA from cell lysate
RNasin Plus RNase Inhibitor Promega N2611 RNase inhibitor to avoid RNA degradation
cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail Roche 11836170001 Protease inhibitor cocktail to avoid protein degradation
Dynabeads Oligo (dT)25 Thermo Fisher Scientific 61011 Magnetic beads required for the first step of mRNA-protein complex purification
Dynabeads M-280 Streptavidin Thermo Fisher Scientific 11205D Magnetic beads required for the second step of mRNA-protein complex purification
E. coli tRNA Sigma-Aldrich 10109550001 transfer RNA from E. coli used for blocking streptavidin beads and avoid unsepecific interactions
Quick Start Bradford 1x Dye Reagent BioRad 5000205 To determine protein concentration within lysates, using BSA as reference
Bovine Serum Albumin Sigma A7906-100G Used to perform the standard curve that will be used as reference for protein concentration determination
mouse anti-Act1 MP Biomedicals 869100 Antibody for detection of yeast actin in Western blot (1:2,500)
mouse anti-Act1 Sigma A1978 Antibody for detection of human actin in Western blot (1:2,000)
mouse anti-HuR Santa Cruz sc-5261 Antibody for detection of HuR in Western blot (1:500)
mouse anti–CYC-1 Invitrogen 456100 Antibody for detection of Cyc-1 in Western blot (1:1,000)
peroxidase anti-peroxidase soluble complex Sigma P1291 Detection of Pfk2:TAP in Western blot (1:5,000)
HRP-conjugated sheep anti-mouse IgG Amersham NXA931 HRP-coupled secondary antibody

DOWNLOAD MATERIALS LIST

References

  1. Mitchell, S. F., Parker, R. Principles and properties of eukaryotic mRNPs. Molecular Cell. 54, (4), 547-558 (2014).
  2. Iadevaia, V., Gerber, A. P. Combinatorial Control of mRNA Fates by RNA-Binding Proteins and Non-Coding RNAs. Biomolecules. 5, (4), 2207-2222 (2015).
  3. McHugh, C. A., Russell, P., Guttman, M. Methods for comprehensive experimental identification of RNA-protein interactions. Genome Biology. 15, (1), 203 (2014).
  4. Matia-González, A. M., Gerber, A. P. Ch. 14. Fungal RNA Biology. Sesma, A., von der Haar, T. Springer. 347-370 (2014).
  5. Tsvetanova, N. G., Klass, D. M., Salzman, J., Brown, P. O. Proteome-wide search reveals unexpected RNA-binding proteins in Saccharomyces cerevisiae. PLoS One. 5, (9), (2010).
  6. Castello, A., et al. Insights into RNA biology from an atlas of mammalian mRNA-binding proteins. Cell. 149, (6), 1393-1406 (2012).
  7. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Molecular Cell. 46, (5), 674-690 (2012).
  8. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nature Protocols. 8, (3), 491-500 (2013).
  9. Liao, Y., et al. The Cardiomyocyte RNA-Binding Proteome: Links to Intermediary Metabolism and Heart Disease. Cell Reports. 16, (5), 1456-1469 (2016).
  10. Liepelt, A., et al. Identification of RNA-binding Proteins in Macrophages by Interactome Capture. Molecular Cell Proteomics. 15, (8), 2699-2714 (2016).
  11. Conrad, T., et al. Serial interactome capture of the human cell nucleus. Nature Communications. 7, 11212 (2016).
  12. Matia-Gonzalez, A. M., Laing, E. E., Gerber, A. P. Conserved mRNA-binding proteomes in eukaryotic organisms. Nature Structural and Molecular Biology. 22, (12), 1027-1033 (2015).
  13. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nature Structural and Molecular Biology. 20, (1), 127-133 (2013).
  14. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nature Communications. 6, 10127 (2015).
  15. Wessels, H. H., et al. The mRNA-bound proteome of the early fly embryo. Genome Research. 26, (7), 1000-1009 (2016).
  16. Sysoev, V. O., et al. Global changes of the RNA-bound proteome during the maternal-to-zygotic transition in Drosophila. Nature Communications. 7, 12128 (2016).
  17. Despic, V., et al. Dynamic RNA-protein interactions underlie the zebrafish maternal-to-zygotic transition. Genome Research. 27, (7), 1184-1194 (2017).
  18. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, 42 (2016).
  19. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  20. Koster, T., Marondedze, C., Meyer, K., Staiger, D. RNA-Binding Proteins Revisited - The Emerging Arabidopsis mRNA Interactome. Trends Plant Sciences. 22, (6), 512-526 (2017).
  21. Hamasaki, K., Killian, J., Cho, J., Rando, R. R. Minimal RNA constructs that specifically bind aminoglycoside antibiotics with high affinities. Biochemistry. 37, (2), 656-663 (1998).
  22. Bachler, M., Schroeder, R., von Ahsen, U. StreptoTag: a novel method for the isolation of RNA-binding proteins. RNA. 5, (11), 1509-1516 (1999).
  23. Vazquez-Pianzola, P., Urlaub, H., Rivera-Pomar, R. Proteomic analysis of reaper 5' untranslated region-interacting factors isolated by tobramycin affinity-selection reveals a role for La antigen in reaper mRNA translation. Proteomics. 5, (6), 1645-1655 (2005).
  24. Hartmuth, K., Vornlocher, H. P., Luhrmann, R. Tobramycin affinity tag purification of spliceosomes. Methods Molecular Biology. 257, 47-64 (2004).
  25. Beach, D. L., Keene, J. D. Ribotrap : targeted purification of RNA-specific RNPs from cell lysates through immunoaffinity precipitation to identify regulatory proteins and RNAs. Methods Molecular Biology. 419, 69-91 (2008).
  26. Slobodin, B., Gerst, J. E. A novel mRNA affinity purification technique for the identification of interacting proteins and transcripts in ribonucleoprotein complexes. RNA. 16, (11), 2277-2290 (2010).
  27. Slobodin, B., Gerst, J. E. RaPID: an aptamer-based mRNA affinity purification technique for the identification of RNA and protein factors present in ribonucleoprotein complexes. Methods Molecular Biology. 714, 387-406 (2011).
  28. Yoon, J. H., Gorospe, M. Identification of mRNA-Interacting Factors by MS2-TRAP (MS2-Tagged RNA Affinity Purification). Methods Molecular Biology. 1421, 15-22 (2016).
  29. Leppek, K., Stoecklin, G. An optimized streptavidin-binding RNA aptamer for purification of ribonucleoprotein complexes identifies novel ARE-binding proteins. Nucleic Acids Research. 42, (2), 13 (2014).
  30. Blencowe, B. J., Sproat, B. S., Ryder, U., Barabino, S., Lamond, A. I. Antisense probing of the human U4/U6 snRNP with biotinylated 2'-OMe RNA oligonucleotides. Cell. 59, (3), 531-539 (1989).
  31. Lingner, J., Cech, T. R. Purification of telomerase from Euplotes aediculatus: requirement of a primer 3' overhang. Proceedings of the National Academy of Sciences U S A. 93, (20), 10712-10717 (1996).
  32. Upadhyay, A., Dixit, U., Manvar, D., Chaturvedi, N., Pandey, V. N. Affinity capture and identification of host cell factors associated with hepatitis C virus (+) strand subgenomic RNA. Molecular Cell Proteomics. 12, (6), 1539-1552 (2013).
  33. Imig, J., et al. miR-CLIP capture of a miRNA targetome uncovers a lincRNA H19-miR-106a interaction. Nature Chemical Biology. 11, (2), 107-114 (2015).
  34. Chu, C., et al. Systematic discovery of Xist RNA binding proteins. Cell. 161, (2), 404-416 (2015).
  35. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  36. Rogell, B., et al. Specific RNP capture with antisense LNA/DNA mixmers. RNA. 23, (8), 1290-1302 (2017).
  37. Matia-Gonzalez, A. M., Iadevaia, V., Gerber, A. P. A versatile tandem RNA isolation procedure to capture in vivo formed mRNA-protein complexes. Methods. 93-100 (2017).
  38. Gruber, A. R., Lorenz, R., Bernhart, S. H., Neubock, R., Hofacker, I. L. The Vienna RNA websuite. Nucleic Acids Research. 36, (Web Server issue), Available from: http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi W70-W74 (2008).
  39. Kalendar, R., Khassenov, B., Ramankulov, Y., Samuilova, O., Ivanov, K. I. FastPCR: An in silico tool for fast primer and probe design and advanced sequence analysis. Genomics. 109, (3-4), Available from: http://primerdigital.com/tools/PrimerAnalyser.html 312-319 (2017).
  40. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  41. Stiernagle, T. Maintenance of C. elegans. WormBook. 1-11 (2006).
  42. Kedde, M., et al. A Pumilio-induced RNA structure switch in p27-3' UTR controls miR-221 and miR-222 accessibility. Nature Cell Biology. 12, (10), 1014-1020 (2010).
  43. Schumacher, B., et al. Translational repression of C. elegans p53 by GLD-1 regulates DNA damage-induced apoptosis. Cell. 120, (3), 357-368 (2005).
  44. Ziegeler, G., et al. Embryonic lethal abnormal vision-like HuR-dependent mRNA stability regulates post-transcriptional expression of cyclin-dependent kinase inhibitor p27Kip1. Journal of Biological Chemistry. 285, (20), 15408-15419 (2010).
  45. Itri, F., et al. Femtosecond UV-laser pulses to unveil protein-protein interactions in living cells. Cellular and Molecular Life Sciences. 73, (3), 637-648 (2016).
  46. Zhang, L., Zhang, K., Prandl, R., Schoffl, F. Detecting DNA-binding of proteins in vivo by UV-crosslinking and immunoprecipitation. Biochemical and Biophysical Research Communications. 322, (3), 705-711 (2004).
Une procédure d’Isolation RNA axée sur les oligonucléotides Tandem pour récupérer des Complexes protéine-ARNm eucaryotes
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Iadevaia, V., Matia-González, A. M., Gerber, A. P. An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes. J. Vis. Exp. (138), e58223, doi:10.3791/58223 (2018).More

Iadevaia, V., Matia-González, A. M., Gerber, A. P. An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes. J. Vis. Exp. (138), e58223, doi:10.3791/58223 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter