Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Modifiera baculoviridae uttryck vektorer att producera utsöndras växtproteiner i insekt celler

doi: 10.3791/58283 Published: August 20, 2018

Summary

Här presenterar vi protokoll för att utnyttja insekt cell baculoviridae protein uttryck systemet och för att producera stora mängder utsöndras växtproteiner för protein kristallisering. En baculoviridae uttryck vektor har modifierats med antingen GP67 eller insekt hemolin signal peptiden för växt proteinuttryck sekretion i insekt celler.

Abstract

Det har varit en utmaning för forskarna att uttrycka rekombinant sekretoriska eukaryota proteiner för strukturella och biokemiska studier. Systemets baculoviridae-medierad insekt cell uttryck är ett av de system som används för att uttrycka rekombinant eukaryota sekretoriska proteiner med vissa post-translationella modifieringar. De sekretoriska proteinerna behöver att dirigeras via den sekretoriska vägar för protein glycosylation, disulfide obligationer bildandet och andra post-translationella modifieringar. För att förbättra det befintliga insekt cell uttrycket av sekretoriska växtproteiner, ändras en baculoviridae uttryck vektor genom tillägg av antingen en GP67 eller en hemolin signal peptid sekvens mellan arrangören och multipel-kloning platser. Detta nydesignade modifierade vector systemet produceras framgångsrikt en hög avkastning av löslig rekombinant utsöndrade receptor växtproteiner av Arabidopsis thaliana. Två av de uttryckta växtproteiner, de extracellulära domänerna av Arabidopsis TDR och PRK3 plasma membranreceptorer, var kristalliserad för röntgen kristallografiska studier. Modifierade vector systemet är ett bättre verktyg som kan potentiellt användas för uttrycket av rekombinant sekretoriska proteiner i djurriket samt.

Introduction

Det är absolut nödvändigt för ett forskningslaboratorium vara kapabel att producera stora mängder homogen rekombinanta proteiner för biokemiska och biofysiska karakteriseringar, särskilt för röntgen kristallografiska studier. Det finns många väletablerade heterologa uttryck system till exempel Escherichia coli, jäst, insekt celler, däggdjursceller, växtceller, etc. bland dem, systemets baculoviridae-medierad insekt cell uttryck är en av mest vanligt förekommande tekniker för att producera stora mängder strukturellt vikta stora rekombinanta eukaryota proteiner för protein kristallisering1.

Uttryck vektorerna av baculoviridae uttryck systemet är konstruerade för att innehålla en stark polyhedrin eller P10 arrangören att producera en hög avkastning av rekombinant intracellulära proteiner2,3. För att göra en rekombinant baculoviridae, klonas genen av intresse i en insekt vektor som innehåller det polyhedrin (polh) locus av Autographa californica multi-nucleopolyhedroviral genomet. Den resulterande konstruktionen sedan sekvenseras och dess rätta öppen läsning ram (ORF) är verifierade. Den rätta bygga sedan införs i insekt värdcellen genom processen att transfection. Gen av intresse infogas i det virala genomet av homolog rekombination. Denna händelse resulterar i produktion av rekombinant virala arvsmassan, som sedan replikerar att producera rekombinant ympade virus partiklar1.

Insekt celler som oftast används i uttryck systemet är Sf9 och hög fem (Hi5) celler. Sf9 celler är en klonal isolatet av Sf21, härrör från Spodoptera frugiperda, Pupp äggstockscancer celler och Hi5 celler är en klonal isolatet härrör från föräldrarnas Trichoplusia ni cystor cell linje TN-3684,5. Samtidig transfections, virus förstärkning och plack analyser genomförs Sf9 celler, medan Hi5 celler väljs vanligtvis att producera större mängder av rekombinanta proteiner6. Det är värt att notera att Hi5 cellerna inte är lämpliga för generering och förstärkning av virus avkommor på grund av deras tendens att producera muterade virus. Traditionellt, anses en temperatur mellan 25-30 ° C vara bra för odling av insekt celler. Det har dock rapporterats att 27-28 ° C är den optimala temperaturen för insekt cell tillväxt och infektion7,8.

Införandet av en stark signal sekvens före genen behövs av hög uttryck för utsöndras proteinerna. Sekvensen signal skulle effektivt vägleda det översatta rekombinant proteinet i endoplasmatiska retiklet för protein sekretion och post-translationella modifieringar behövs för korrekt vikning och stabilisering3. Signalen peptid sekvenser, har såsom baculoviridae omsluta protein GP64/67, honungsbinas melittin och andra, valt att underlätta uttrycket av sekretoriska rekombinanta proteiner i baculoviridae-medierade uttryck system3. Införandet av signal peptiden av GP67 har visat sig förbättra uttryck avkastningen av ett utsöndrade rekombinant protein, i jämförelse med med den inneboende signal peptiden av mål genen9. Hemolin är ett hemolymph protein av giant silk moth Hyalophora Kekropia, inducerad på bakterier infektion10. På grund av den relativt höga inducerad uttryck, kan signal peptid sekvensen av genen användas att medla sekretion uttrycket av rekombinanta proteiner i den baculoviridae-insektscellsystemet.

I A. thaliana Tracheary Element differentiering hämmande faktor Receptor (TDR) och Pollen Receptor tyrosinkinashämmare 3 (PRK3) båda hör till växtfamiljen leucin-rika upprepa Receptor-liknande Kinase (LRR-RLK) av proteiner11,12 . För att studera struktur och funktion av denna familj av receptorn växtproteiner, samt att underlätta de strukturella och biokemisk karakteriseringen av andra utsöndras växtproteiner, har den baculoviridae insektscellsystemet-uttryck ändrats till förbättra protein kvalitet och produktion avkastning. De extracellulära domänerna av både TDR och PRK3 har framgångsrikt uttryckts med två modifierade uttryck vektorer i den baculoviridae insektscellsystemet-uttryck. Båda de extracellulära domänerna av TDR och PRK3 proteiner har varit kristalliseras. Denna artikel rapporterar uttryck och rening av stora mängder rekombinant utsöndrade växtproteiner med två modifierade baculoviridae uttryck vektorer genom att införliva antingen en GP67 eller en hemolin signal sekvens mellan arrangören och flera kloning platser.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Obs: En insekt cell/baculoviridae systemet med modifierade uttryck vektorer för sekretoriska växt proteinuttryck och kristallisation används.

1. ändring av en baculoviridae uttryck vektor med GP67 Signal peptiden för växt proteinuttryck sekretion

  1. Syntetisera en DNA-fragment som innehåller en 5' BglII skärande webbplats13, sekvensen GP67 sekretion signal och en multi-kloning webbplats med NotI, BamHI, mina, StuI, SalI, SpeI, XbaI, PstI och XhoI (figur 1A).
    Obs: Eftersom både BglII och BamHI rötas DNA resulterade i samma självhäftande ändarna, linearized vektorn kan ligera till det smälta DNA-fragmentet medan både BglII och BamHI platser i sekvensen glödgad ligering kommer vara muterade till en sekvens som inte är cleavable av antingen BglII eller BamHI14.
  2. Digest 4 µg av DNA med BglII och XhoI, och 4 µg ett uttryck vektor DNA med BamHI och XhoI14. Blanda 10 enheter av varje restriktionsenzym med DNA i en 1 x koncentration reaktion buffert (50 mM kalium acetat, 20 mM Tris-acetat, 10 mM magnesium acetat och 100 µg/mL BSA, pH 7,9 vid 25 ° C) och inkubera blandningen vid 37 ° C i 4 h.
    1. Rena det exciderad DNA-fragmentet och linearized vektorn DNA av en DNA gel utvinning kit15.
  3. Blanda 100 ng linearized vektorns DNA med 400 ng av smält DNA fragment i en 10-µL ligering reaktionsblandningen innehåller 1 x T4 DNA-ligase reaktion buffert (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP och 10 mM DTT, pH 7,5 vid 25 ° C) och 5 enheter av T4 DNA Ligase. Inkubera reaktionsblandningen vid 16 ° C i 16 h.
  4. Omvandla 5 µL av ligering blandningen till 100 µL av DH5α behöriga celler efter ett standard omvandling protokoll och välj de resulterande kolonierna på en ampicillin-LB agar plattan16. Plocka upp 5-10 kolonier och växa varje koloni i 2 mL LB medium innehållande 100 µg/mL ampicillin vid 220 rpm och 37 ° C i en skakande inkubator för 16 h.
  5. Extrahera varje plasmid DNA med DNA miniprep kit17 och bekräfta klonerna av DNA-sekvensering med en primer AGTATTTTACTGTTTTCGTAACAG.
  6. A. thaliana TDR genen PCR-Förstärk och fragment kodning restprodukter 30-642 från en syntetisk TDR-gen konstruera (vidarebefordra primer: CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, reverse primer: GC GGATCC CTA GTG GTG ATG GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC). Förstärka DNA för 30 cykler i en DNA-polymerase reaktion buffert innehållande en 0,5 mM dNTP mix, 0,2 µM grundfärg, 0.1 µg av DNA-templat, 0,4 mM MgCl2och 1 reaktion enhet den DNA-polymeras.
    1. Anvisningar om PCR-cykel, ange den inledande denaturering vid 95 ° C i 30 s, och sedan 30 cykler av denaturering vid 95 ° C under 30 s, glödgning vid 55 ° C i 30 s och förlängning vid 72 ° C i 1 min, med en sista förlängning vid 72 ° C i 5 min.
  7. Smälta både PCR-fragmentet och modifierade vektorn med NotI och BamHI begränsning Amiiiiin enzymer. Ligera gen fragmentet med linearized vektorn. Blanda 100 ng linearized vektorns DNA med 400 ng av smält DNA fragment i en 10-µL ligering reaktionsblandningen innehåller T4 DNA-ligase reaktion buffert och 5 enheter av T4 DNA-ligase. Inkubera reaktionsblandningen vid 16 ° C i 16 h.
  8. Omvandla 5 µL av ligering blandningen till 100 µL av DH5α behöriga celler efter ett standard omvandling protokoll och välj de resulterande kolonierna på en ampicillin-LB agar plattan16. Bekräfta rätt klonerna av DNA-sekvensering.

2. ändring av en baculoviridae uttryck vektor med insekt Hemolin Signal peptiden för växt proteinuttryck sekretion

  1. Syntetisera en DNA-fragment som innehåller en 5' BglII skärande webbplats13, sekvensen insekt hemolin sekretion signal och en multi-kloning webbplats med NotI, BamHI, mina, StuI, SalI, SpeI, XbaI, PstI och XhoI (figur 1B).
  2. Digest 4 µg av DNA med BglII och XhoI, och 4 µg ett uttryck vektor DNA med BamHI och XhoI14. Blanda 10 enheter av varje restriktionsenzym med DNA i en 1 x koncentration reaktion buffert (50 mM kalium acetat, 20 mM Tris-acetat, 10 mM magnesium acetat och 100 µg/mL BSA, pH 7,9 vid 25 ° C) och inkubera blandningen vid 37 ° C i 4 h.
    1. Rena det exciderad DNA-fragmentet och linearized vektorn DNA av en DNA gel utvinning kit15.
  3. Blanda 100 ng linearized vektorns DNA med 400 ng av smält DNA fragment i en 10-µL ligering reaktionsblandningen innehåller 1 x T4 DNA-ligase reaktion buffert (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP och 10 mM DTT, pH 7,5 vid 25 ° C) och 5 enheter av T4 DNA Ligase. Inkubera reaktionsblandningen vid 16 ° C i 16 h.
  4. Omvandla 5 µL av ligering blandningen till 100 µL av DH5α behöriga celler och välj kolonierna på en agarplatta för ampicillin-LB. Plocka upp 5-10 kolonier och växa varje koloni i 2 mL LB medium innehållande 100 µg/mL ampicillin vid 220 rpm och 37 ° C i en skakande inkubator för 16 h.
  5. Extrahera plasmid DNA med DNA miniprep kit17 och bekräfta klonerna av DNA-sekvensering med en primer AGTATTTTACTGTTTTCGTAACAG.
  6. PCR-Förstärk A. thaliana Pollen Receptor tyrosinkinashämmare 3 (PRK3) genen fragment kodning rester 20-237 från en syntetisk PRK3 gen konstruktion (vidarebefordra primer: CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, reverse primer: CGC GGATCC CTA GTG GTG ATG GTG GTG GTG TGAAGGTTTCTCATCGCATTCTATATTC). Förstärka DNA för 30 cykler i en DNA-polymerase reaktion buffert innehållande en 0,5 mM dNTP mix, 0,2 µM grundfärg, 0.1 µg av DNA-templat, 0,4 mM MgCl2och 1 reaktion enhet den DNA-polymeras.
    1. Anvisningar om PCR-cykel, ange den inledande denaturering vid 95 ° C i 30 s, och sedan 30 cykler av denaturering vid 95 ° C under 30 s, glödgning vid 55 ° C i 30 s och förlängning på 72 ° C under 30 s inom varje cykel och slutliga förlängningen vid 72 ° C i 5 min.
  7. Smälta både PCR-fragmentet och modifierade vektorn med NotI och BamHI begränsning Amiiiiin enzymer. Ligera gen fragmentet med linearized vektorn. Blanda 100 ng linearized vektorns DNA med 400 ng av smält DNA fragment i en 10-µL ligering reaktionsblandningen innehåller T4 DNA-ligase reaktion buffert och 5 enheter av T4 DNA-ligase. Inkubera reaktionsblandningen vid 16 ° C i 16 h.
  8. Omvandla 5 µL av ligering blandningen till 100 µL av DH5α behöriga celler efter ett standard omvandling protokoll och välj de resulterande kolonierna på en ampicillin-LB agar plattan16. Bekräfta rätt klonerna av DNA-sekvensering.

3. produktion och förstärkning av baculoviridae konstruerar härbärgerat rekombinant Protein uttryck kassett

  1. Använd 100 ng av konstruera plasmiden att omvandla 40 µL av DH10Bac behöriga celler efter protokollet av baculoviridae uttryck system1. Inkubera omvandling plattorna vid 37 ° C för 48 h.
  2. Plocka upp två vita kolonier från varje omvandling platta, Inokulera varje koloni i 2 mL LB medium innehållande 50 µg/mL kanamycin, 7 µg/mL gentamicin och 10 µg/mL tetracyklin. Följa protokollet av baculoviridae uttryck system1 extrahera och verifierar bacmid DNA. Alikvotens varje DNA i två rör med 20 µL varje, och förvara rören vid-20 ° C.
    Observera: Följande steg kräver en aseptisk operation.
  3. Väx en enskiktslager av Sf9 celler i kultur media med 10% fetalt bovint serum (FBS) och 100 µg/mL (eller 100 IE/ml) penicillin-streptomycin antibiotika vid 27 ° C till 80% sammanflödet i en 6-bra platta. Beräkna procentandelen av sammanflödet baserat på andelen täckt område på vävnadsodling plattan.
  4. Förbered följande lösningar i två sterila 1,5 mL centrifugrör.
    1. Rör 1: För varje transfection, späd 20 µL av bacmid DNA i 100 µL av unsupplemented Sf9 cellodlingsmedium utan antibiotika. Blanda utspädning försiktigt genom att bläddra till sidan av röret.
    2. Rör 2: För varje transfection, späd 8 µL av lipid transfection reagens i 100 µL av unsupplemented Sf9 cellodlingsmedium utan antibiotika. Blanda utspädningen av pipettering upp och ner för 6 x.
  5. Kombinera de två lösningarna, blanda dem försiktigt genom pipettering långsamt upp och ner för 3 x och inkubera dem i 20-40 min i rumstemperatur.
  6. Tvätta varje brunn den Sf9 enskiktslager celler 2 x med 3 mL unsupplemented Sf9 cellodlingsmedium utan antibiotika. För varje transfection, tillsätt 0,8 mL unsupplemented Sf9 cellodlingsmedium utan antibiotika till varje tub som innehåller den lipid-DNA. Blanda innehållet i rören försiktigt genom pipettering långsamt upp och ner för 3 x. Aspirera wash media från plattorna och overlay av prov med transfection blandningen.
  7. Efter tillägg av transfection blandningen, inkubera transfekterade plattan för 5 h på 27 ° C. Ersätta transfection media med den kompletta Sf9 cellodlingsmedium som innehåller 10% FBS och 100 µg/mL (eller 100 IE/ml) penicillin-streptomycin antibiotika. Inkubera transfekterade plattan vid 27 ° C i 4 d.
  8. Skörd och förstärka den rekombinanta baculoviridae.
    1. Samla in supernatanten av infekterade plattan i ett sterilt 15 mL koniska rör efter 4 d inkubation. Snurra supernatanten vid 1010 x g i 5 min att ta bort cellfragment. Kassera pelleten och Dekantera supernatanten till en ren röret och lagra den på 4 ° C i upp till 1 år.
      Obs: Detta är P0 viruset. Det kan vara aliquoted och lagras vid-80 ° C under en längre tid.
    2. För att förstärka varje rekombinanta virus, växa en enskiktslager av Sf9 celler på en 150-mm platta till 80% sammanflödet. Sug ut media från plattan, tillsätt 2 mL av P0 viruset till de celler anhängare till plattan och inkubera plattan för 1 h i en 27 ° C inkubator. Rock på plattan varje 15 min för att blanda medlet med celler.
      1. Tillsätt 25 mL av komplett Graces media som innehåller 10% FBS och 100 µg/mL (eller 100 IE/ml) penicillin-streptomycin antibiotika. Inkubera plattan för 3 d i en 27 ° C inkubator att erhålla P1 passage viruset.
    3. Samla in supernatanten av infekterade plattan i ett sterilt 50 mL koniska rör och spinn på 1010 x g i 5 min att ta bort cellfragment. Dekantera supernatanten till en ren röret och lagra den på 4 ° C i upp till 1 år.
      Obs: P1 viruset kan vara aliquoted och lagras vid-80 ° C under en längre tid.
    4. För att förstärka viruset från P1 till P2 passage, växa en enskiktslager av Sf9 celler på en 150-mm platta till 90% sammanflödet, aspirera massmedia av plattan, tillsätt 2 mL av P1 viruset till plattan och inkubera det 1 h i en 27 ° C inkubator.
    5. Upprepa steg 3.8.2 och 3.8.3 att erhålla P2 och P3 passagerna av virus. Förvara inte P3 viruset för mer än 2 månader.

4. proteinuttryck, rening med NiNTA och kristallisering

  1. Kultur 1 L Hi5 insekt celler i kultur media med 100 µg/mL (eller 100 IE/ml) penicillin-streptomycin antibiotika till en densitet på 2 x 10-6 vid 100 rpm i en shaker med 27 ° C i inkubatorn. Snurra ner cellerna vid 570 x g i 5 min, Dekantera supernatanten, resuspendera cellerna i 20 mL nyligen producerade P3 viruset och förvara det i rumstemperatur för 1 h. skaka försiktigt snurra flaskan för att resuspendera cellerna 1 x varje 15 min.
  2. Överföra cellerna till 1 L av odlingssubstrat med 100 µg/mL (eller 100 IE/ml) penicillin-streptomycin antibiotika, odla cellerna vid 100 rpm i en 27 ° C inkubator shaker för 72 h. spinn ner cellerna vid 1 010 x g i 5 min och samla in supernatanten.
  3. Använd pH-indikator remsor att justera pH av supernatanten till 8.0 genom att lägga till antingen 0.1 M HCl eller 0,1 M NaOH och lägga till bindande buffert på en slutlig koncentration, som innehåller 20 mM Tris buffert med pH 8,0, 100 mM NaCl, och 5 mM Imidazol. Lägga till en viss mängd NiNTA harts (10-40 mL) baserat på den beräknade avkastningen av uttryckt hans-taggade rekombinant protein.
    1. Blanda lösningen på magnetiska uppståndelse med låg hastighet vid 4 ° C för 1 h. tvätt harts och eluera bundna proteinet efter den standard NiNTA rening protokoll18.
  4. Omfattas av renat protein jonbyte och gel filtrering kromatografi, liksom andra protein reningsmetoder, ge ett homogent prov.
    Obs: För de TDR ectodomain, 20 mM Tris, pH 8, 100 mM NaCl användes som gel filtrering buffert. För den PRK3 ectodomain, 20 mM bis-Tris, användes pH 6, 100 mM NaCl som Rekommenderad gel filtrering bufferten.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Som visas i figur 1, användes två modifierade pFastBac1 baculoviridae uttryck vektorer att uttrycka utsöndras proteinerna med antingen i GP67 eller hemolin signal sekvensen för att ersätta den inneboende signal sekvensen av målgenen. Den virala GP67 och insekt hemolin gener har visat sig ha hög sekretion nivåer i cellerna. Fusionsproteinerna med endera av dessa två signal sekvenser förväntas har kraftigt förbättrat sekretion nivåer. Identiska flera kloning platser (MCS) var konstruerad i dessa två modifierade vektorer. En NotI plats placerades medvetet på mest 5'-sidan av MCS, eftersom NotI har en åtta-nukleotidsekvensen i stället för de vanligaste sex-nukleotidsekvensen i många andra begränsning platser. Som sådan, är en NotI webbplats mindre närvarande i generna som mål än de flesta andra begränsning webbplatser, att göra begränsningen matsmältningen och kloning av de flesta målgener mer genomförbart i jämförelse med med andra begränsning sites. Kloning målgenen mellan NotI och en nedströms begränsning plats införs endast tre aminosyra rester, GGR, föregår målgenen.

Den pBac1-GP67 och pBac1-Hem har framgångsrikt använts för att uttrycka de extracellulära domänerna av A. thaliana receptorer TDR och PRK3, respektive (figur 2). Efter de rekombinanta proteinerna var renas genom NiNTA använder en engineering C-terminal 6-histidin tagg, var genomsnittliga protein avkastningen konsekvent runt 20 mg/L av Hi5 celler. Renhet av varje protein är nära eller högre än 50%, undersökt med SDS-PAGE och Coomassie färgning.

De rekombinanta proteinerna extracellulära domäner av TDR och PRK3 var ytterligare renas genom storlek utslagning kromatografi (figur 2). Det renat proteinet var koncentrerad till 5 mg/mL och sedan genomgå en kristallisering screening. De villkor, som gett preliminära kristaller av varje protein, var optimerad tills proteinkristaller med en storlek som är större än 20 µm observerades (figur 3). De kristallen strukturerna av både proteiner har varit rapporterade11,12.

Figure 1
Figur 1: kartor över de modifierade pFastBac1 vektorerna. De DNA-sekvenser som visas i dessa paneler infogades nedströms polyhedrin arrangören pFastBac1 vektorns att inneha sekvensen signal peptid och flera kloning platser (MCS) för målgener. Båda vektorer innehåller samma MCS. (A) denna panel visar en sekvens av kloning platser nedströms polyhedrin arrangören i pBac1-GP67 vektorn. Den översatta GP67 signal peptid aminosyrasekvensen är färgade i rött. Varje unik begränsning plats i MCS är understruket, med namnet på webbplatsen märkt ovan. (B) denna panel visar en sekvens av kloning platser nedströms polyhedrin arrangören i pBac1-Hem vektorn. Översatt hemolin signal peptid aminosyresekvensen är färgade i rött. Varje unik begränsning plats i MCS är understruket, med namnet på webbplatsen märkt ovan. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: proteinuttryck med de modifierade pFastBac1 vektorerna i den baculoviridae-insektscellsystemet. (A), ectodomain av TDR var uttryckt i Hi5 insekt celler, renas genom nickel affinitet och storlek utslagning kromatografi (S), och löst på SDS-PAGE gel. Nickel kådan var tvättas en gång med en buffert som innehåller 5 mM Imidazol (1 tvätt) och en andra gång med 20 mM Imidazol (tvätta 2). (B) Detta är en SDS-PAGE analys visar uttrycket och nickel affinitet rening (NiNTA), liksom storlek utslagning kromatografi av den PRK3 ectodomain. Molekylvikt (MW) markörer med motsvarande storlekar är märkta. De röda pilarna i varje panel beteckna uttrycken och den beräknade storleken på rekombinant TDR och PRK3 ectodomain proteiner. Flera band naturer av uttryckta proteinerna är sannolikt på grund av heterogena glycosylation. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: Proteinkristaller extracellulära domäner av Arabidopsis thaliana TDR och PRK3. (A) denna panel visar protein kristallerna av de extracellulära domänerna av A. thaliana TDR. (B) i denna panel visas proteinkristaller extracellulära domäner av A. thaliana PRK3. En skalstapeln visas under varje bild. Klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Beroende på skillnaderna i storlek och stabilitet av tusentals proteiner närvarande i de biologiska systemen, är det ofta empiriska för en forskning laboratorium för att bestämma vilket heterologa uttryck system har väljas för uttrycket av ett specifikt protein. Systemets E. coli uttryck är ofta det första valet för proteinuttryck på grund av den korta livslängd av bakterier, låg kostnad av kultur media och relativt lätt att skala upp19. För uttrycket av stora eukaryota proteiner med storlekar mer än 60 kDa, dock med den E. coli resulterar system ofta i olösliga proteiner i inkludering kroppen eller aggregering20. För uttrycket av dessa svårt proteiner och andra utsöndras proteiner, kan de baculoviridae insektscellsystemet-uttryck vara fördelaktigare än den E coli. Speciellt när uttrycker utsöndrade eukaryota proteiner, kunde denna modifierade baculoviridae-uttryck insektscellsystemet vara ett förstahandsval.

Många utsöndrade eukaryota proteiner, inklusive utsöndras växtproteiner, behöver komplexa glycosylation, disulfid bildandet och andra post-translationella modifieringar under protein vikning och sekretion21. E. coli system har inte det cellulära maskineriet att bearbeta komplexa ändringar krävs för många av de eukaryota proteiner22. Jäst har ett relativt mer avancerade glycosylation system än E. coli23. Av uttryck för utsöndras proteinerna i högre eukaryota arter och växter presenterar den baculoviridae-insektscellsystemet emellertid en betydande fördel. Eftersom glycosylation påverkar proteinveckning och stabilitet24, många av de utsöndrade rekombinanta proteinerna uttrycks i E. coli och jäst systemen har en låg avkastning och tenderar att aggregera, förmodligen på grund av felaktig proteinveckning. Baculoviridae-insekt systemet har ändrats för att förbättra protein glycosylation, vilket gör det ett idealiskt system för uttrycket av utsöndrade eukaryota proteiner25. I denna studie signal både GP67 och hemolin peptider har framgångsrikt använts för att vägleda sekretion uttrycket av två receptor växtproteiner för protein kristallisering. Med dessa studier i åtanke dock valet av antingen signal-peptid är ett avgörande steg, och den behöver mer systematisk jämförande studier med en uppsättning av målgener från olika organismer.

Idén att använda både GP67 och hemolin signal peptider för att öka utsöndringen proteinuttryck drevs av hög uttryck avkastningarna av både gener. Om de protein sekretion och posttranslationell modifiering maskiner uttryck värdens är överbelastade med de uttryckta rekombinanta proteinerna, kan de utsöndrade rekombinanta proteinerna dock inte ha lämpliga ändringar, särskilt glycosylation. Båda modifierade vektorer har använts framgångsrikt uttrycka många växt sekretoriska proteiner11,12,26, varav många tenderar att aggregat, vilket förmodligen beror på felaktig eller otillräcklig glycosylation. Därför för uttrycket av dessa svårt proteiner, både starka och svaga signal peptid sekvenser har testas och kvaliteten på de uttryckta rekombinanta proteinerna behöver jämföras. Tänk på att en svag signal peptid sekvens kommer att sänka den totala avkastningen av proteinet; dock kan det ge sekretion maskinen uttryck värdens tillräcklig kapacitet för att bearbeta protein sekretion och ändringar.

Förutom att uttrycket av heterologa utsöndrade proteiner i insekt celler, har de däggdjursceller och växt cellsystem uttryck använts framgångsrikt i överuttryck av rekombinant däggdjur och vegetabiliska proteiner, respektive27, 28,29. I jämförelse med de heterologa system, nära endogena uttrycket villkora av antingen däggdjurs eller växt utsöndras proteinerna kommer att ha de nästan infödd modifiering maskinerier i de mottagande cellerna att ge väl vikta proteiner. Förbehållet att använda nära-native uttryck systemet är att de uttryckt rekombinanta proteinerna kan störa den fysiologiska funktionen av cellerna, vilket potentiellt kan ha negativa effekter på den slutliga uttryck avkastningen av proteiner.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Detta arbete stöds av de nya fakultetsmedel start från North Carolina State University för Guozhou Xu.

Materials

Name Company Catalog Number Comments
Incubator shaker VWR Model Excella E25 27 oC
Incubator VWR Model 2005 27 oC
Centrifuge BECKMAN Model J-6 with a swing bucket rotor
Herculase II Fusion DNA Polymerase Agilent 600677-51 For PCR amplification of DNA
Thermal Cycler BIO-RAD Model C1000 Touch For PCR amplification of DNA
Incubator shaker New Brunswick Scientific Model I 24 For growing baceria culture
Customer DNA synthesis GENSCRIPT
BamHI (HF) New England Biolabs R3136S Restriction Endonuclease
BglII New England Biolabs R0144S Restriction Endonuclease
NotI (HF) New England Biolabs R3189S Restriction Endonuclease
XhoI New England Biolabs R0146S Restriction Endonuclease
T4 DNA ligase New England Biolabs M0202T DNA ligation
QIAquick Gel Extraction Kit Qiagen 28704 DNA purification from Agorase gel
QIAprep Spin Miniprep Kit Qiagen 27104 Plasmid DNA purification from bacteria culture
Agarose Thermo Fisher Scientific 15510-019 For DNA gel electropherosis
MAX Efficiency DH5α competen cell Invitrogen 18-258-012 For transformation of DNA ligation mixture
Lennox L LB Broth Research Product International Corp. L24066-5000.0 For making bacteria culture
Ampicillin sodium salt Thermo Fisher Scientific 11593-019 Antibiotics
Kanamycin Sulfate Thermo Fisher Scientific 15160-054 Antibiotics
Tetracycline Thermo Fisher Scientific 64-75-5 Antibiotics
Gentamicin Thermo Fisher Scientific 15710-064 Antibiotics
MAX Efficiency DH10Bac competent cells Thermo Fisher Scientific 10361-012 For making bacmid DNA
S.O.C. Medium Thermo Fisher Scientific 15544-034 For DNA transformation
CellFECTIN II Reagent Thermo Fisher Scientific 10362-101 Insect cell transfection reagent
Bac-to-Bac Expression System Thermo Fisher Scientific 10359-016 Baculovirus-insect cells expression kit
Bluo-gal Thermo Fisher Scientific 15519-028 For isolation of recominant Bacmid DNA
IPTG Thermo Fisher Scientific 15529-019 For isolation of recominant Bacmid DNA
pFastBac1 Thermo Fisher Scientific 10360014 Baculorirus expression vector
Sf9 cells Thermo Fisher Scientific 11496015 Sf9 monolayer cells
Hi5 cells Thermo Fisher Scientific B85502 High Five insect cells
Grace’s insect medium, unsupplemented Thermo Fisher Scientific 11595030 Sf9 cell transfection minimum medium
Grace’s insect medium, supplemented Thermo Fisher Scientific 11605102 Sf9 monolayer cell culture complete medium
Sf-900 II SFM Thermo Fisher Scientific 10902104 Sf9 suspension cell culture medium without FBS
Express Five SFM Thermo Fisher Scientific 10486025 Hi5 cell culture medium
Penicillin-Streptomycin Thermo Fisher Scientific 15140122 100 ml (10,000 I.U./ml)
L-Glutamine (200 mM) Thermo Fisher Scientific 25030081 100 ml
FBS Certified Thermo Fisher Scientific 16000-044 500 ml
6-well plates Thermo Fisher Scientific 08-772-1B Flat-bottom
150 mm plates Thermo Fisher Scientific 353025 100/case
1.5 ml Microcentrifuge Tubes USA Scientific 1415-2500 500 tubes/bag
15 ml conical screw cap centrifuge tubes USA Scientific 1475-0511 25 tubes/bag
50 ml conical screw cap centrifuge tubes USA Scientific 1500-1211 25 tubes/bag
Ni-NTA Superflow Qiagen 30430 NiNTA resin
pH-indicator strips EMD Millipore Corporation 1.09535.0001 pH 0 - 14

DOWNLOAD MATERIALS LIST

References

  1. Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. Protein production using the baculovirus-insect cell expression system. Biotechnology Progress. 30, 1-18 (2014).
  2. Khan, S., Ng, M. L., Tan, Y. J. Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system. Methods in Molecular Biology. 379, 35-50 (2007).
  3. Possee, R. D., King, L. A. Baculovirus Transfer Vectors. Methods in Molecular Biology. 1350, 51-71 (2016).
  4. Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vitro. 13, 213-217 (1977).
  5. Hink, W. F. Established insect cell line from the cabbage looper, Trichoplusia ni. Nature. 226, 466-467 (1970).
  6. Davis, T. R., et al. Comparative recombinant protein production of eight insect cell lines. In Vitro Cellular & Development Biology - Animal. 29A, 388-390 (1993).
  7. Wickham, T. J., Nemerow, G. R. Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system. Biotechnology Progress. 9, 25-30 (1993).
  8. Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion. Nature Biotechnology. 10, 1148-1150 (1992).
  9. Murphy, C. I., et al. Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides. Protein Expression and Purification. 4, 349-357 (1993).
  10. Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily. Science. 250, 1729-1732 (1990).
  11. Li, Z., Chakraborty, S., Xu, G. Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions. PLoS One. 12, e0175317 (2017).
  12. Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors. Scientific Reports. 8, 2796 (2018).
  13. Khorana, H. G. Total synthesis of a gene. Science. 203, 614-625 (1979).
  14. Bahl, C. P., Marians, K. J., Wu, R. A general method for inserting specific DNA sequences into cloning vehicles. Gene. 1, 81-92 (1976).
  15. Xu, W., Zhang, Y. Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative. Methods in Molecular Biology. 1387, 213-226 (2016).
  16. Hanahan, D. Studies on transformation of Escherichia coli with plasmids. Journal of Molecular Biology. 166, 557-580 (1983).
  17. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  18. Reddy, B. G., et al. Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC. Protein Expression and Purification. 117, 67-75 (2016).
  19. Harris, T. J., Emtage, J. S. Expression of heterologous genes in E. coli. Microbiological Sciences. 3, 28-31 (1986).
  20. Kaur, J., Kumar, A., Kaur, J. Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements. International Journal of BIological Macromolecules. 106, 803-822 (2018).
  21. Guo, Y., Yang, F., Tang, X. An Overview of Protein Secretion in Yeast and Animal Cells. Methods in Molecular Biology. 1662, 1-17 (2017).
  22. Blight, M. A., Chervaux, C., Holland, I. B. Protein secretion pathway in Escherichia coli. Current Opinion in Biotechnology. 5, 468-474 (1994).
  23. Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. Engineering of protein secretion in yeast: strategies and impact on protein production. Applied Microbiology and Biotechnology. 86, 403-417 (2010).
  24. Wormald, M. R., Dwek, R. A. Glycoproteins: glycan presentation and protein-fold stability. Structure. 7, R155-R160 (1999).
  25. Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. An Overview and History of Glyco-Engineering in Insect Expression Systems. Methods in Molecular Biology. 1321, 131-152 (2015).
  26. Li, Z., Chakraborty, S., Xu, G. X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa. Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).
  27. Aricescu, A. R., Owens, R. J. Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology. Current Opinion in Structural Biology. 23, 345-356 (2013).
  28. Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells. Plant Biotechnology Journal. 12, 402-410 (2014).
  29. Dohi, K., et al. Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells. Archives of Virology. 151, 1075-1084 (2006).
Modifiera baculoviridae uttryck vektorer att producera utsöndras växtproteiner i insekt celler
Play Video
PDF DOI

Cite this Article

Chakraborty, S., Trihemasava, K., Xu, G. Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells. J. Vis. Exp. (138), e58283, doi:10.3791/58283 (2018).More

Chakraborty, S., Trihemasava, K., Xu, G. Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells. J. Vis. Exp. (138), e58283, doi:10.3791/58283 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter