Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Kwantitatieve Polymerase Chain Reaction gebaseerde Analyses van lymfkliertest intestinale Microbiota na behandeling met mondelinge antibiotica

doi: 10.3791/58481 Published: November 17, 2018

Summary

Hier bieden wij gedetailleerde protocollen voor de orale toediening van antibiotica aan muizen, verzameling van fecale monsters, DNA-extractie en kwantificering van fecale bacteriën door qPCR.

Abstract

De darmflora heeft een centrale invloed op de gezondheid van de mens. Microbiële dysbiosis wordt geassocieerd met vele gemeenschappelijke immunopathologies zoals ontstekingsdarmziekte, astma en artritis. Inzicht in de mechanismen die ten grondslag liggen aan de microbiota-immuunsysteem Overspraak is dus van cruciaal belang. Antibiotica administratie, terwijl het pathogene agens van mijnen, hulp induceert ook drastische veranderingen in de omvang en samenstelling van intestinale bacteriële gemeenschappen die een invloed op de menselijke gezondheid hebben kunnen. Behandeling met antibiotica bij muizen recapituleert de impact en de veranderingen op lange termijn in menselijke microbiota van antibiotica behandelde patiënten en maakt onderzoek van de mechanistische koppelingen tussen veranderingen in microbiële gemeenschappen en immuun cel functie. Terwijl verschillende methoden voor de behandeling met antibiotica van muizen zijn beschreven, veroorzaken sommigen van hen ernstige uitdroging en gewichtsverlies complicerende de interpretatie van de gegevens. Wij bieden hier twee protocollen voor orale antibiotica toediening die kan worden gebruikt voor langdurige behandeling van Muizen zonder grote gewicht-verlies. Deze protocollen maken gebruik van een combinatie van antibiotica die doelstelling zowel gram-positieve en gram-negatieve bacteriën en beide ad libitum in het drinkwater of mondelinge maagsonde kunnen geleverd worden. Daarnaast beschrijven we een methode voor de kwantificering van microbiële dichtheid in fecale monsters door qPCR die kan worden gebruikt voor het valideren van de doeltreffendheid van de behandeling met antibiotica. De combinatie van deze benaderingen biedt een betrouwbare methode voor het manipuleren van de intestinale microbiota en de studie van de effecten van behandeling met antibiotica bij muizen.

Introduction

De zoogdieren gastro-intestinale mucosa is een unieke omgeving gekoloniseerd door een complex mengsel van micro-organismen die een Linge relatie met de host. Het verdedigingssysteem van de intestinale mucosa bestaat uit een epitheliale laag en een overvloed van immune cellen die commensals in de darm met behoud van hun aantal en de verscheidenheid te beperken. Omgekeerd zijn commensale organismen vereist voor de ontwikkeling van een volledig functionele immuunsysteem. Terwijl de interacties tussen gastheer en commensale bacteriën normaal gunstig zijn, wordt het steeds duidelijker dat dysregulated immuunsysteem-microbiota Overspraak kan het voordeel van de ontwikkeling van chronische ontstekingsziekten, dergelijke asinflammatory darm ziekte, artritis of astma1,2.

De darmflora kan worden veranderd door verschillende factoren, maar misschien de meest drastische veranderingen worden veroorzaakt door behandeling met antibiotica die ernstig wijzigt van zowel de omvang en de samenstelling van bacteriële gemeenschappen3,4. Terwijl de voordelen van antibiotica om infecties te behandelen onbetwistbaar zijn, kunnen immuun afweer die tot nadelige effecten op de gezondheid leiden kunnen ook wijzigen door de wijzigingen van de microbiota geïnduceerd door antibiotica blootstelling bij de mens. Bijvoorbeeld, behandeling met antibiotica bij de mens is gekoppeld aan een verhoogd risico van Clostridium difficile-geïnduceerde diarree, astma en bepaalde soorten kanker3. Behandeling met antibiotica bij muizen recapituleert de impact en de lange termijn veranderingen gevonden in gut gemeenschappen van antibioticum behandelde patiënten en onderzoek van de mechanistische koppelingen tussen veranderingen in microbiële gemeenschappen en immuun cel functie heeft ingeschakeld. Verschillende verslagen hebben echter aangetoond dat toediening van antibiotica op de drinkwater ad libitum in zeer merkbaar gewichtsverlies resulteert zoals muizen van drinkwater, vermoedelijk vanwege de vieze smaak5,6 onthouden. In deze modellen kan de ernstige uitdroging gelijktijdige naar orale toediening van antibiotica dus de interpretatie van experimenten gericht op het identificeren van het effect van behandeling met antibiotica in functie immuun cel bemoeilijken.

Verschillende benaderingen kunnen worden gebruikt om te verkennen van de omvang en samenstelling van microbiële gemeenschappen in de intestinale compartiment7. Next generation sequencing technologieën waardevolle gegevens hebben verstrekt over deze zaak8, maar deze methoden relatief duur zijn en vereisen deskundige bioinformatic analyses voor interpretatie van de gegevens. Aan de andere kant, traditionele cultuur van de microbiologische methoden zorgen ervoor dat de bacteriële soorten, maar ze hebben lage gevoeligheid en een groot deel van de commensale bacteriën (met name sporenvormende anaerobe bacteriën) zijn zeer moeilijk of onmogelijk om te kweken met beschikbare methoden8. Kwantitatieve polymerase kettingreactie (qPCR) technieken worden steeds meer voor kwantificering en identificatie van fecale bacteriesoorten, gebruikt als ze een snelle en betrouwbare cultuur-onafhankelijke maatregel van totale microbiële vracht bieden. Dienovereenkomstig, qPCR methoden hebben bewezen nuttig zijn te onderzoeken van wijzigingen in de microbiota die hoort bij de leeftijd of met progressie van verschillende ziekten met inbegrip van ontstoken darm ziekte9,10. In overeenstemming met deze biedt qPCR methoden een snelle en kosteneffectieve aanpak voor het valideren van het effect van verschillende behandelingen (waaronder antibiotica) in fecale bacteriële belasting en microbiota samenstelling10,11,12.

Hier presenteren we een gedetailleerde stapsgewijze uiteenzetting van twee verschillende protocollen voor orale toediening van antibiotica muizen fecale sample collectie, DNA-extractie, opstelling van normen en kwantificering van bacteriën in fecale monsters door qPCR. Deze protocollen zorgen voor een betrouwbare methode voor het manipuleren van de intestinale microbiota in muizen en te bestuderen van de effecten van behandeling met antibiotica bij intestinale homeostase en ziekte.

Protocol

Experimenten die hier beschreven werden uitgevoerd met behulp van 6-8 weken oude wild-type (C57BL6/J) muizen in een faciliteit van specifieke pathogenen vrije (SPF onderhouden). Alle dierproeven werden goedgekeurd door de King's College London en de Francis Crick Instituut Animal Welfare en ethische beroepsinstantie en het Bureau van het Verenigd Koninkrijk-huis. Voorafgaand aan het begin van elke dierlijke procedure, ervoor zorgen dat de juiste machtigingen zijn verkregen door tussenkomst van de lokale instelling/organisatie.

1. beheer van antibiotica

Opmerking: Twee alternatieve methoden voor antibiotische behandeling worden geleverd: mondelinge maagsonde (stap 1.1) en de toediening van antibiotica via drinkwater (stap 1.2).

  1. Mondelinge maagsonde
    1. Voorraden van individuele antibiotica door hen in gesteriliseerde met autoclaaf water bij de volgende concentraties bereid: ampicilline bij 100 mg/mL, gentamicine bij 100 mg/mL neomycine bij 100 mg/mL, metronidazol bij 10 mg/mL en vancomycine bij 100 mg/mL. Filter steriliseren met behulp van een 0,45 µm filter. Aliquot en winkel bij-20 ° C.
    2. Bereid een cocktail van antibiotica door het mengen van de voorraden bereid boven. Meng 50 µL van ampicilline (5 mg/mL definitief), 50 µL van gentamicine (5 mg/mL definitief), 50 µL van neomycine (5 mg/mL final), 500 µL van metronidazol (5 mg/mL final), 25 µL van vancomycine (2,5 mg/mL final) en 325 µL van water voor een volume van 1 mL. Bereiden de cocktail fresh vóór gebruik.
    3. Laden van de antibiotica mix in een steriele 1 mL spuiten en monteren van een passende gauge maagsonde naald (20 G voor 15-20 g muizen) terwijl het elimineren van alle bubbels.
    4. Maagsonde muizen met 200 µL van antibiotica mix.
      1. Pak de huid over de schouder van de muis stevig, rekken van het hoofd en de nek naar het rechttrekken van de slokdarm. Direct de bal-tip van de voeding naald langs het dak van de mond en naar de achterkant van de keelholte. Vervolgens voorzichtig doorgeven naar beneden in de slokdarm en injecteren de 200 μl-oplossing.
    5. Beheren van de antibiotica cocktail eenmaal dagelijks voor de duur van het experiment.
  2. Antibiotica in het drinkwater
    Let op: Zorgvuldig toezicht houden op muis gewicht dagelijks voor de eerste twee weken van antibiotische administratie in het drinkwater.
    1. Bereiden van een cocktail van antibiotica door het oplossen van de volgende handelingen uit in 1 L gesteriliseerde met autoclaaf water: 1 g ampicilline (1 g/L definitief), 1 g neomycine (1 g/L definitief), metronidazol (1 g/L definitief), 0,5 g vancomycine (0,5 g/L final) en 8 sachets (0,75 g/stuk) kunstmatige 1 g zoetstof (60 g/L definitief). Schud tot het is opgelost. Bewaren bij 4 ° C.
      Opmerking: Zoetstof wordt toegevoegd aan de smaak van antibiotica te verbergen en te voorkomen dat muizen uitdroging. Terwijl verscheidene zoetstof merken werken kunnen, kan de uiteindelijke concentratie nodig afwijken voor elk specifiek merk.
    2. Vul de antibiotica cocktail in een fles water (~ 100 mL/fles) en plaats de fles op een muis-kooi.
      Opmerking: Gebruik bruine flessen of dekking van de flessen met folie om antibiotica te beschermen tegen licht.
    3. Vervang de antibiotica cocktail met verse voorraad tweemaal per week voor de duur van het experiment.

2. verzameling van fecale monsters van ontlasting, Ileum inhoud en Ileum muur

  1. Wegen en etiketteren van 2 mL gesteriliseerde met autoclaaf buizen voor sample collectie.
  2. Voor collectie van verse kruk monsters, plaatst u elke muis in een afdekking en fecale pellets verzamelen rechtstreeks vanuit de anus in de buis van een collectie.
    Opmerking: Monsters kunnen ook worden verkregen door te plaatsen muizen in een kooi schoon gesteriliseerde met autoclaaf, en verzamelen van ontlasting monsters met schone, gesteriliseerde pincet.
  3. De muizen met CO2 verstikking gevolgd door cervicale dislocatie euthanaseren.
  4. Leg een muis karkas met de buik volledig blootgesteld en spray de buikstreek met 70% ethanol.
  5. Met behulp van gesteriliseerde pincet en schaar, maken een dwarse incisie in de buik het buikvlies zonder beschadiging van elke interne weefsels bloot te stellen. Til het buikvlies en maak een incisie bloot van de darmen.
  6. Verwijder de ingewanden (van de dikke darm aan maag) met de Tang en schaar en plaats het in een steriele petrischaal.
  7. Zorgvuldig gebruik pincet te plagen van de dunne darm (SI) uit de buurt van de mesenterische slagaders en vet. Uitbreiden van de darm en plaats deze op een schone lab-veeg.
  8. Met een liniaal, meten en snijd 4 cm van het distale ileum van de SI (het dichtstbijzijnde deel aan de blindedarm). Knip en negeren de 1 cm van de darm proximale aan de blindedarm. Zal er een deel 3 cm van ileum links die zal worden gebruikt voor het verzamelen van darmbacteriën.
  9. Houd het ileum gedeelte (3 cm) boven een 2 mL steriele buis. Het verzamelen van de intestinale inhoud door direct het uitdrijven van de darm en de colleting het monster in de buis. In dit voorbeeld zal hebben bacteriën uit de inhoud van het ileum.
  10. Bereiden van een 20 mL spuit met koude fosfaatgebufferde zoutoplossing (PBS) en spoel het ileum gedeelte (gooi de doorstroomtest).
  11. Plaats het ileum gedeelte op een schone papieren handdoek en open het overlangs met een schaar.
  12. Schraap de binnenkant van de wand van het ileum met een scalpel.
  13. Het verzamelen van alle bacteriën op de scalpel door het wassen van de scalpel met 1 mL PBS over een schone centrifugebuis. Spin bij 8.000 × g gedurende 5 min pellet de bacteriën en de vloeistof wordt weggeworpen. Dit voorbeeld bevat bacteriën van de wand van het ileum.
    Opmerking: Fecale monsters van ontlasting, ileum inhoud en muur kunnen worden bevroren en opgeslagen bij-80 ° C tot gebruik.
  14. Weeg de buizen met de monsters van ontlasting en ileum inhoud en het gewicht van de lege buizen (uit stap 2.1) om te verkrijgen van de fecale gewicht in elk monster aftrekken.
  15. Extract bacteriële DNA van ontlasting, ileum inhoud en ileum muur monsters met behulp van commercieel beschikbare kits. DNA-monsters bij-20 ° C bewaren tot gebruik.

3. kwantificering van intestinale Microbiota door qPCR

Opmerking: Deze procedure omvat het genereren van een standaard (stap 3.1) en de methode voor qPCR set-up voor standaard en fecale monsters (stap 3.2)

  1. Generatie van een norm voor qPCR
    1. Polymerase-kettingreactie (PCR) gebruiken om aan te vullen van het 16S rRNA gen van de genomic DNA geëxtraheerd uit een bacteriële cultuur met behulp van de reagentia13 en PCR voorwaarden gedetailleerd in tabel 1.
    2. Uitvoeren van het PCR-product op een 1,5% agarose gel en te zuiveren van de DNA-band met behulp van een commercieel beschikbare DNA-extractie kit.
    3. Afbinden de gezuiverde DNA fragment met behulp van een klonen kit (Zie de Tabel van materialen, gebruik van een vector met antibiotica-resistentie-markers en β-galactosidase (LacZ) gen fusion voor blauw/wit kolonie selectie) en transformeren van de bevoegde DH10 E. coli volgens de instructies van de fabrikant. Plaat van de transformatie op ampicilline (100 µg/mL), X-gal (20 µg/mL) Luria Bertani (LB) agar platen (10 g/L trypton, 5 g/L gistextract, 10 g/L NaCl, 15 g/L Agar). Incubeer overnachting (O/N) bij 37 ° C.
    4. Selecteer een kolonie van enkele positive (wit) van de plaat. Het enten in 5 mL de pond-Bouillon met 100 µg/mL ampicilline en O/N Incubeer bij 37 ° C, schudden bij 250 omwentelingen per minuut.
    5. De cultuur van de O/N, isoleren en zuiveren van de plasmide met behulp van een commerciële miniprep kit volgens de instructies van de fabrikant.
      Opmerking: Het is belangrijk dat de volgorde van de plasmide invoegen in dit stadium, om ervoor te zorgen dat het plasmide slechts één exemplaar van het 16S rRNA gen bevat en om te bepalen van de lengte in basenparen (bp).
    6. Linearize het plasmide met een restrictie-enzym die het plasmide slechts eenmaal snijdt.
    7. Zuiveren de gelineariseerde plasmide met behulp van een commercieel beschikbare kit.
    8. Bepaal de concentratie van de plasmide door het meten van de absorptie bij 260 nm met behulp van een spectrofotometer.
    9. Bereken het aantal plasmide kopieën/µL van monster met behulp van de volgende formule14:
      aantal exemplaren = (bedrag * 6.022 × 1023) / (lengte * 1 × 109 * 650)
      Indien bedrag is de concentratie van de DNA verkregen in stap 3.1.8 (in ng/µL); en lengte is de totale lengte van de plasmide (met de insert) in bp. Het aantal exemplaren zal worden verkregen als kopieën/µL.
      Opmerking: Er zijn online tools op basis van de bovenstaande formule waarmee eenvoudige berekening van het aantal exemplaren van de plasmide.
    10. Aliquot en winkel de standaard zo nodig bij-20 ° C tot gebruik.
  2. qPCR Set-up voor standaard en fecale monsters
    1. Ontdooi de qPCR standaard (uit stap 3.1.10), de fecale monsters DNA (uit stap 2.15) en de qPCR reagentia (uit een commercieel beschikbare kit) op ijs.
      Opmerking: qPCR reagentia gebruikt in dit voorbeeld bevatten de SYBR Green qPCR reactie mix en voorwaartse en omgekeerde inleidingen (tabel 2).
    2. Verdun de norm in steriele DNA-gratis water in een bereik van 107 tot 102 kopieën/µL (bijvoorbeeld 1/5 seriële verdunningen van 107 tot en met 6.4 x 102 kopieën/µL). Verdun fecale monster DNA tot 1/2, 1/5, 1/10.
    3. Het maken van een master mix reactie voor het totale aantal reacties plus 1 (tabel 2).
    4. Mix-30 µL van de master mix en 5 µL van sjabloon (standard, monster of water voor de negatieve controle)
    5. Voeg 10 µL van deze mix aan elk putje in een 384-well optische qPCR plaat. Elke reactie in drievoud uitvoeren.
    6. Zegel van de qPCR plaats, kort centrifugeren en laden van de plaat op de machine van de qPCR geprogrammeerd met de volgende fietsen voorwaarden: 95 ° C gedurende 20 min gevolgd door 40 cycli van 95 ° C voor 15 s en 60 ° C gedurende 1 minuut.
    7. CT -waarden voor standaard en monsters te verkrijgen.
    8. Een standaard curve genereren door het uitzetten van de CT -waarden voor de normen versus de logaritme van het getal van de kopie van de plasmide (zoals berekend in stap 3.1.9). Uitvoeren van lineaire regressie van de standaard curve.
    9. Bereken de 16S rDNA kopie nummers voor fecale monsters door interpoleren CT -waarden (verkregen in stap 3.2.2) in de standaard curve.
      Opmerking: 16S rDNA kopie nummers voor elk monster moeten worden gecorrigeerd de verdunningsfactor van het monster (zoals opgesteld in stap 3.2.2), overweegt het eindvolume nucleïnezuren die waren geëlueerd (in stap 2.15) en de hoeveelheid van fecale monster (berekend in stap 2.14) te verkrijgen kopieën van het gen per gram ontlasting.

Representative Results

We bieden hier twee alternatieve protocollen voor orale antibiotische behandeling van muizen. Figuur 1 toont percentage van lichaamsgewicht (gerelateerd aan originele base lijndikte voor elk dier) in muizen behandeld met antibiotica, orale maagsonde (rood) of in het drinkwater (blauw) voor 10 opeenvolgende dagen. Geen merkbare afslanken vlindertje muizen die antibiotica krijgen op mondelinge maagsonde. Wanneer muizen worden behandeld met antibiotica, ad libitum in het drinkwater, ze afvallen (~ 10%) binnen de eerste paar dagen van antibiotische administratie, maar herstellen daarna normale gewichtstoename (Figuur 1). Echter ongeveer 5-10% van de muizen ontvangen van antibiotica in het drinkwater kunt bereiken > 20% verlies van het gewicht binnen de eerste week van behandeling, in welk geval ze zijn euthanized.

De kwantificering van bacteriën in fecale monsters vereist het gebruik van een adequate standaard kromme die wordt verkregen door het uitzetten van het logboek van exemplaaraantal voor de standaard (zoals berekend in stap 3.2.2) versus de CT -waarden, verkregen uit qPCR (stap 3.2.7). Figuur 2A toont een representatief voorbeeld van een standaard curve die voldoet aan de standaard curve prestaties met een R2 waarde van 0.99827, een helling van-3.09 en een efficiëntie ((-1 + 10^(-1/slope))*100) van 110%. R-2 waarden van 0,99 en PCR efficiëntie binnen het bereik van 90 tot 110% hebben de voorkeur. Binnen het lineaire bereik kunt de analyse van de regressievergelijking kwantificering van de 16S rDNA overvloed binnen de fecale monsters. Figuur 2B toont het aantal 16S rDNA kopieën in fecale kruk, SI inhoud en SI muur. In figuur 2B zijn de gegevens weergegeven als 16S rDNA kopieën/g van fecale monster voor fecale kruk en SI inhoud. Voor SI muur, worden de gegevens gepresenteerd als totaal aantal 16S rDNA afschriften verkregen bacteriën hersteld van de 3 cm van de muur SI (zoals de hoeveelheid grondstof te klein is om het verkrijgen van een precieze gewicht).

Om te beoordelen van het effect van antibiotica op de dichtheid van bacteriën in fecale monsters, muizen werden behandeld met antibiotica mondelinge maagsonde dagelijks gedurende 10 dagen (dagen 1 tot en met 10) en kruk monsters werden verzameld vóór (dag 0), op verschillende tijdstippen tijdens behandeling met antibiotica () dagen 5 en 10), en 7 dagen na het stoppen van de antibiotica administratie (dag 17; Figuur 3A). Zoals blijkt uit figuur 3B, induceert behandeling met antibiotica een sterke daling in het aantal 16S rDNA kopieën/g van ontlasting gedetecteerd op de dagen 5 en 10, terwijl de dichtheid van bacteriën in de ontlasting hersteld naar normale niveaus (vergelijkbaar met voorbehandeling) 1 week na antibiotica administratie was gestopt (dag 17).

Figure 1
Figuur 1: toediening van antibiotica. Muizen kreeg antibiotica mondelinge maagsonde (rood) of in het drinkwater (blauw) voor 10 opeenvolgende dagen. Perceel toont gewichten van muizen gedurende de looptijd van de experimenten ten opzichte van het oorspronkelijke gewicht vóór antibiotica administratie (dag 0). Gegevens worden weergegeven als gemiddelde ± SEM. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: 16S rRNA gene qPCR versterking van normen en fecale monsters. (A) lineaire regressie van standaard curve met standaard curve descriptoren. (B) berekening van gene abundanties van fecale monsters. Gegevens worden weergegeven als gemiddelde ± SEM. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: fecale bacteriën tijdens de antibioticumkuur. (A) Schematische voorstelling van het schema voor antibiotica bestuur door mondelinge maagsonde (Ab) en sample collectie zoals afgebeeld met *. (B) 16S rDNA opgehaald per gram ontlasting in kruk monsters van muizen verzameld op de aangegeven dagen. Gegevens worden weergegeven als gemiddelde ± SEM. Klik hier voor een grotere versie van dit cijfer.

Reagens Volume
DNA 8 ΜL
Buffer van 10 X 2 ΜL
dNTPs (10mM) 0.4 ΜL
Eubacteria - F primer (10 mM) 1 ΜL
Eubacteria - R primer (10 mM) 1 ΜL
Taq Polimerase 0.2 ΜL
H2O 7.4 ΜL
Totaal volume 20 ΜL
Primer sequenties
Eubacteria - F primer 5' ACTCCTACGGGAGGCAGCAGT 3'
Eubacteria - R primer 5' ATTACCGCGGCTGCTGGC 3'
Fietsen van voorwaarden
Temperatuur Tijd Cycli
94 ° C 5 min 1 x
94 ° C 30 s 30 x
60 ° C 30 s 30 x
72 ° C 1 min 30 x
72 ° C 5 min 1 x
4 ° C 1 x

Tabel 1: PCR Reagentia en voorwaarden. Deze tabel bevat de reagentia en de PCR fietsen voorwaarden te versterken 16S rRNA gen van bacteriecultuur voor generatie van een standaard te gebruiken in de qPCR testen. Primer sequenties werden oorspronkelijk gepubliceerd door Kruglov et al. 13.

Reagens Volume
SYBR Green master mix (2 x) 17.5 ΜL
Eubacteria - F primer (10 mM) 0,7 ΜL
Eubacteria - R primer (10 mM) 0,7 ΜL
H2O 11.1 ΜL

Tabel 2: master mix qPCR. De volumes weergegeven (eindvolume 35 µL) zijn voor een enkel voorbeeld moet worden uitgevoerd op drievoud (elke 10 µL) op een 384-well qPCR plaat (boekhouding voor 5 µL extra voor pipetting fout). Het bedrag kan worden opgeschaald volgens het aantal monsters dat moet worden geanalyseerd.

Discussion

Hier bieden wij experimentele protocollen voor orale toediening van antibiotica aan muizen en kwantificering van fecale bacteriën door qPCR. De combinatie van antibiotica gebruikt in de doelstellingen van dit protocol (met ampicilline, gentamicine, neomycine, metronidazol en vancomycine) zowel gram-positieve en gram-negatieve bacteriën, het aanbieden van bactericide activiteit tegen een volledig spectrum van bacteriën. Zowel mondelinge maagsonde en administratie van antibiotica in het drinkwater sterk verminderen fecale bacteriële5,6,12laden. Beide behandelingen hebben bovendien een diepgaand effect op het fenotype van de muizen als ze verschillende kenmerkende eigenschappen van kiem-vrije muizen met inbegrip van de grootte van de verminderde milt en uitgebreide blindedarm te ontwikkelen. De selectie van een bepaalde methode voor antibiotica administratie kan eventueel afhangen van de lengte van het experiment als de mondelinge maagsonde methode dagelijkse toediening van antibiotica vereist, wordt meer arbeidsintensief en eventueel veroorzaakt meer ongemak aan de dieren op de lange termijn.

Voor toediening van antibiotica in het drinkwater, moet voorzichtigheid worden gehouden met de toevoeging van de zoetstof aan de antibiotica mengsel dit is een cruciale factor om te houden van muizen tegen uitdroging. Verschillende groepen hebben aangetoond hoe toediening van antibiotica in drinkwater (zonder toevoeging van zoetstof) leidt tot zeer ernstige en snelle gewichtsverlies met alle muizen verliezen van meer dan 20% van de initiële lichaamsgewicht binnen de eerste paar dagen van het experiment5 , 6. in ons protocol, het gebruik van de zoetstof saccharine gebaseerde leek te volstaan om te maskeren de antibiotica smaak in het water en de muizen afgevallen in de eerste paar dagen na toediening van antibiotica, maar hun gewichten snel hersteld na dat ( Figuur 1). Echter in onze experimenten 5-10% van de muizen nog bereiken het menselijke eindpunt van > 20% verlies van basislijn lichaamsgewicht en moest worden euthanized. We hebben ook getest sucralose gebaseerde zoetstoffen die volledig mislukt is om muizen uitdroging te voorkomen (100% van de muizen verloren > 20% van gewicht) terwijl andere auteurs hebben soortgelijke fouten in voor zoetstoffen aspartaam gebaseerde5,6gepubliceerd. Toegevoegd aan dit, moeten de leeftijd, de genetische achtergrond en de algemene gezondheidstoestand van de muizen gebruikt voor de experimenten worden beschouwd, als zij invloed kunnen zijn op gewichtsverlies en het welzijn van de dieren tijdens de behandeling met antibiotica. Zo moet een zorgvuldige controle van muizen gewicht en algemene gezondheidstoestand worden uitgevoerd dagelijks tijdens de eerste twee weken van orale toediening van antibiotica.

qPCR methoden biedt een snelle en kosteneffectieve aanpak voor kwantificering van 16S rRNA in fecale monsters. Echter enkele beperkingen moeten worden overwogen met betrekking tot deze techniek, met inbegrip van: ik) de eis voor een betrouwbare hoge kwaliteit-norm; II) het ontwerp en de efficiëntie van de qPCR inleidingen; III) het feit dat micro-organismen kunnen verschillende moleculen van het 16S rRNA gen, dus gene kopieën kunnen niet direct gelijk aan cel telt15. Echter qPCR is een robuuste en gevoelige methode waarmee snelle analyse van fecale monsters. Deze methode kan met name handig voor het snel het valideren van het effect van verschillende behandelingen (waaronder antibiotica) in fecale bacteriële belasting zoals hier gedetailleerd worden. Bovendien, hoewel wij een protocol voor kwantificering van totale 16S rRNA, deze methode kan gemakkelijk aangepast worden (door het ontwerpen van specifieke primers16) aan inschakelen van de identificatie van individuele bacteriële taxa, waardoor zowel kwantitatieve en kwalitatieve informatie over de omvang van de microbiome en de samenstelling.

Kortom, hebben wij twee protocollen voor orale antibiotische behandeling van muizen en een qPCR gebaseerde methode te kwantificeren antibioticum-geïnduceerde veranderingen in fecale bacteriën verstrekt. Hoewel deze protocollen kunnen verder worden geoptimaliseerd en gecombineerd met andere benaderingen volgens individuele experimentele behoeften, kunnen ze dienen als snelle, rendabele en betrouwbare instrumenten voor het manipuleren van de lymfkliertest intestinale microbiota en te bestuderen van de effecten van behandeling met antibiotica bij intestinale homeostase en ziekte.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Dit werk werd gefinancierd door de Britse Medical Research Council (subsidie aan de heer P.B./L008157/1); R.J. werd ondersteund door een Marie Curie intra-beurs (H2020-MSCA-als-2015-703639); P.M.B. werd gesteund door een studententijd uit de Britse Medical Research Council en King's College London doctorale opleiding partnerschap in de Biomedische Wetenschappen (heer/N013700/1).

Materials

Name Company Catalog Number Comments
Ampicillin sodium salt Sigma-Aldrich (Merck) A9518
Neomycnin trisulfate salt hydrate Sigma-Aldrich (Merck) N1876
Metronidazole Sigma-Aldrich (Merck) M3761
Vancomycin hydrochloride Sigma-Aldrich (Merck) V2002
Gentamicin sulfate salt Sigma-Aldrich (Merck) G3632
Tryptone Sigma-Aldrich (Merck) T7293
Yeast Extract Sigma-Aldrich (Merck) Y1625
NaCL Sigma-Aldrich (Merck) S7653
Sweetener Sweet'n Low Sweet'N Low Available in the UK from Amazon.co.uk
X-Gal (5-brom-4-chloro-3-indoyl B-D-galactopyranoside) Fisher scientific 10234923
Phosphate Buffered Saline  Thermo Fisher Scientific (Gibco) 10010023
Ultrapure Agarose Thermo Fisher Scientific (Invitrogen) 16500500
RT-PCR grade water Thermo Fisher Scientific (Invitrogen) AM9935
Phusion High-Fidelity DNA Polymerase New England BioLabs M0530
Deoxynucleotide (dNTP) Solution Mix New England BioLabs N0447
iTaq Universal SYBR Green Supermix Bio-Rad 1725124 with ROX
TOPO TA cloningTM for sequencing Thermo Fisher Scientific (Invitrogen) 450030
QIAamp fast DNA Stool mini kit  Qiagen 51604
QIAprep spin Miniprep kit Qiagen 27106
QIAquick gel  extraction kit Qiagen 28704
Syringe filter 0.45 µm Fisher scientific 10460031
Swann-MortonTM Carbon steel sterile scalpel blades Fisher scientific 11792724
Syringe (1 mL) BD Plastipak 303172
Syringe (20 mL) BD Plastipak 300613
1.5 mL Crystal clear microcentriguge tube StarLab E1415-1500
2 mL Ultra high recovery microcentrifuge tube StarLab I1420-2600
Oral dosing needles 20 G x 38 mm curved (pk/3) Vet-Tech DE008A
Sterilin petri dish 50 mm  Scientific Laboratory Supplies PET2020
Absolute qPCR plate seals Thermo Fisher Scientific AB1170
MicroAmpTM optical 384-well plate  Thermo Fisher Scientific (Applied Biosystems) 4309849
ViiA7TM 7 real-time PCR system with 384-well block Thermo Fisher Scientific (Applied Biosystems) 4453536
Spectrophotometer (Nanodrop 1000) Thermo Fisher Scientific ND-1000
Labnet Prism microcentrifuge Labnet C2500
MultiGene Optimax Thermal cycler Labnet TC9610

DOWNLOAD MATERIALS LIST

References

  1. Belkaid, Y., Hand, T. W. Role of the microbiota in immunity and inflammation. Cell. 157, (1), 121-141 (2014).
  2. Hooper, L. V., Littman, D. R., Macpherson, A. J. Interactions between the microbiota and the immune system. Science. 336, (6086), 1268-1273 (2012).
  3. Ubeda, C., Pamer, E. G. Antibiotics, microbiota, and immune defense. Trends in Immunology. 33, (9), 459-466 (2012).
  4. Dethlefsen, L., Huse, S., Sogin, M. L., Relman, D. A. The pervasive effects of an antibiotic on the human gut microbiota, as revealed by deep 16S rRNA sequencing. PLoS Biology. 6, (11), e280 (2008).
  5. Reikvam, D. H., et al. Depletion of murine intestinal microbiota: effects on gut mucosa and epithelial gene expression. PLoS One. 6, (3), e17996 (2011).
  6. Hill, D. A., et al. Metagenomic analyses reveal antibiotic-induced temporal and spatial changes in intestinal microbiota with associated alterations in immune cell homeostasis. Mucosal Immunology. 3, (2), 148-158 (2010).
  7. Fraher, M. H., O'Toole, P. W., Quigley, E. M. Techniques used to characterize the gut microbiota: a guide for the clinician. Nature Reviews Gastroenterology & Hepatology. 9, (6), 312-322 (2012).
  8. Eckburg, P. B., et al. Diversity of the human intestinal microbial flora. Science. 308, (5728), 1635-1638 (2005).
  9. Sokol, H., et al. Low counts of Fecalibacterium prausnitzii in colitis microbiota. Inflammatiry Bowel Diseases. 15, (8), 1183-1189 (2009).
  10. Bartosch, S., Fite, A., Macfarlane, G. T., McMurdo, M. E. Characterization of bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbiota. Applied Environmental Microbiology. 70, (6), 3575-3581 (2004).
  11. Ubeda, C., et al. Vancomycin-resistant Enterococcus domination of intestinal microbiota is enabled by antibiotic treatment in mice and precedes bloodstream invasion in humans. Journal of Clinical Investigation. 120, (12), 4332-4341 (2010).
  12. Saez de Guinoa, J., et al. CD1d-mediated lipid presentation by CD11c(+) cells regulates intestinal homeostasis. EMBO Journal. 37, (5), (2018).
  13. Kruglov, A. A., et al. Nonredundant function of soluble LTalpha3 produced by innate lymphoid cells in intestinal homeostasis. Science. 342, (6163), 1243-1246 (2013).
  14. Wilhelm, J., Pingoud, A., Hahn, M. Real-time PCR-based method for the estimation of genome sizes. Nucleic Acids Research. 31, (10), e56 (2003).
  15. Kembel, S. W., Wu, M., Eisen, J. A., Green, J. L. Incorporating 16S gene copy number information improves estimates of microbial diversity and abundance. PLoS Computational Biology. 8, (10), e1002743 (2012).
  16. Yang, Y. W., et al. Use of 16S rRNA Gene-Targeted Group-Specific Primers for Real-Time PCR Analysis of Predominant Bacteria in Mouse Feces. Applied Environmental Microbiology. 81, (19), 6749-6756 (2015).
Kwantitatieve Polymerase Chain Reaction gebaseerde Analyses van lymfkliertest intestinale Microbiota na behandeling met mondelinge antibiotica
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Jimeno, R., Brailey, P. M., Barral, P. Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment. J. Vis. Exp. (141), e58481, doi:10.3791/58481 (2018).More

Jimeno, R., Brailey, P. M., Barral, P. Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment. J. Vis. Exp. (141), e58481, doi:10.3791/58481 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter