Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

मात्रात्मक पोलीमरेज़ चेन प्रतिक्रिया आधारित विश्लेषण Murine आंत्र Microbiota मौखिक एंटीबायोटिक उपचार के बाद

doi: 10.3791/58481 Published: November 17, 2018

Summary

यहाँ हम चूहों के लिए एंटीबायोटिक दवाओं के मौखिक प्रशासन के लिए विस्तृत प्रोटोकॉल प्रदान, मल के नमूनों का संग्रह, डीएनए निष्कर्षण और qPCR द्वारा मल बैक्टीरिया की ठहराव.

Abstract

आंत microbiota मानव स्वास्थ्य पर एक केंद्रीय प्रभाव पड़ता है । माइक्रोबियल dysbiosis ऐसे भड़काऊ आंत्र रोग, अस्थमा और गठिया के रूप में कई आम immunopathologies के साथ जुड़ा हुआ है । इस प्रकार, microbiota अंतर्निहित तंत्र को समझना-प्रतिरक्षा प्रणाली crosstalk महत्वपूर्ण महत्व का है । एंटीबायोटिक प्रशासन, जबकि रोगज़नक़ निकासी सहायता, भी आकार और आंतों बैक्टीरियल समुदायों जो मानव स्वास्थ्य पर एक प्रभाव हो सकता है की संरचना में भारी परिवर्तन लाती है । चूहों में एंटीबायोटिक उपचार recapitulates प्रभाव और एंटीबायोटिक इलाज रोगियों से मानव microbiota में दीर्घकालिक परिवर्तन, और माइक्रोबियल समुदायों और प्रतिरक्षा कोशिका समारोह में परिवर्तन के बीच यंत्रवत लिंक की जांच सक्षम बनाता है । जबकि चूहों के एंटीबायोटिक उपचार के लिए कई तरीकों का वर्णन किया गया है, उनमें से कुछ गंभीर निर्जलीकरण और वजन घटाने डेटा की व्याख्या उलझी पैदा । यहां, हम मौखिक एंटीबायोटिक प्रशासन जो बड़े वजन-नुकसान उत्प्रेरण के बिना चूहों के दीर्घकालिक उपचार के लिए इस्तेमाल किया जा सकता है के लिए दो प्रोटोकॉल प्रदान करते हैं । इन प्रोटोकॉल एंटीबायोटिक दवाओं है कि दोनों ग्राम सकारात्मक और ग्राम नकारात्मक बैक्टीरिया को लक्षित का एक संयोजन का उपयोग करें और पीने के पानी में या मौखिक gavage द्वारा या तो विज्ञापन libitum प्रदान किया जा सकता है । इसके अलावा, हम qPCR जो एंटीबायोटिक उपचार की प्रभावकारिता को मान्य करने के लिए इस्तेमाल किया जा सकता द्वारा मल नमूनों में माइक्रोबियल घनत्व के ठहराव के लिए एक विधि का वर्णन । इन तरीकों के संयोजन आंत्र microbiota के हेरफेर और चूहों में एंटीबायोटिक उपचार के प्रभाव के अध्ययन के लिए एक विश्वसनीय पद्धति प्रदान करता है ।

Introduction

स्तनधारी जठरांत्र म्यूकोसा एक अद्वितीय सूक्ष्मजीवों कि मेजबान के साथ एक mutualistic संबंध स्थापित करने का एक अत्यधिक जटिल मिश्रण द्वारा बृहदांत्र वातावरण है । आंत्र म्यूकोसा की रक्षा प्रणाली एक उपकला परत और प्रतिरक्षा कोशिकाओं के ढेर सारे है कि आंत के भीतर commensals सीमित करते हुए उनकी संख्या और विविधता के संरक्षण शामिल हैं । इसके विपरीत, खाना खानेवाला जीवों को एक पूरी तरह कार्यात्मक प्रतिरक्षा प्रणाली के विकास के लिए आवश्यक हैं । जबकि मेजबान और खाना खानेवाला बैक्टीरिया के बीच बातचीत आम तौर पर फायदेमंद होते हैं, यह तेजी से स्पष्ट होता जा रहा है कि dysregulated प्रतिरक्षा प्रणाली-microbiota crosstalk पुराने भड़काऊ रोगों के विकास के पक्ष में कर सकते हैं, ऐसे asinflammatory आंत्र रोग, गठिया या अस्थमा1,2.

आंत microbiota विभिंन कारकों से बदला जा सकता है, लेकिन शायद सबसे भारी परिवर्तन एंटीबायोटिक उपचार है कि गंभीर रूप से दोनों आकार और बैक्टीरियल समुदायों3,4की संरचना बदल द्वारा प्रेरित कर रहे हैं । जबकि संक्रमण के इलाज के लिए एंटीबायोटिक दवाओं के लाभों को संदिग्ध हैं, microbiota मनुष्यों में एंटीबायोटिक जोखिम द्वारा प्रेरित परिवर्तन भी प्रतिरक्षा सुरक्षा जो स्वास्थ्य पर हानिकारक प्रभाव के लिए नेतृत्व कर सकते है संशोधित कर सकते हैं । उदाहरण के लिए, मनुष्यों में एंटीबायोटिक उपचार क्लोस्ट्रीडियम डिफीसाइल-प्रेरित दस्त, अस्थमा और3कैंसर के कुछ प्रकार के एक बढ़ा जोखिम से जोड़ा गया है । चूहों में एंटीबायोटिक उपचार recapitulates प्रभाव और एंटीबायोटिक इलाज रोगियों के पेट समुदायों में पाया दीर्घकालिक परिवर्तन, और माइक्रोबियल समुदायों और प्रतिरक्षा सेल समारोह में परिवर्तन के बीच यंत्रवत लिंक की जांच सक्षम है । हालांकि, कई रिपोर्टों से पता चला है कि पीने के पानी पर एंटीबायोटिक दवाओं के प्रशासन libitum परिणाम बहुत ध्यान से चूहों के रूप में पीने के पानी से बचना, संभवतः अपनी बेईमानी स्वाद5,6के कारण । इस प्रकार, इन मॉडलों में गंभीर निर्जलीकरण मौखिक एंटीबायोटिक प्रशासन के लिए सहवर्ती प्रतिरक्षा कोशिका समारोह में एंटीबायोटिक उपचार के प्रभाव की पहचान करने के लिए लक्ष्य प्रयोगों की व्याख्या जटिल हो सकता है ।

कई दृष्टिकोण आंतों के डिब्बे में माइक्रोबियल समुदायों के आकार और संरचना का पता लगाने के लिए इस्तेमाल किया जा सकता है7. अगली पीढ़ी sequencing प्रौद्योगिकियों इस मामले8पर अमूल्य डेटा प्रदान की है, लेकिन इन तरीकों अपेक्षाकृत महंगे है और डेटा की व्याख्या के लिए विशेषज्ञ bioinformatic विश्लेषण की आवश्यकता होती है । दूसरी ओर, पारंपरिक सूक्ष्मजीवविज्ञानी संस्कृति के तरीकों जीवाणु प्रजातियों का पता लगाने की अनुमति है, लेकिन वे कम संवेदनशीलता है और खाना खानेवाला बैक्टीरिया का एक बड़ा अंश (विशेष रूप से anaerobes) बहुत मुश्किल या असंभव के साथ खेती करने के लिए कर रहे हैं वर्तमान में उपलब्ध विधियाँ8. मात्रात्मक पोलीमरेज़ श्रृंखला प्रतिक्रिया (qPCR) तकनीक ठहराव और मल जीवाणु प्रजातियों की पहचान के लिए तेजी से इस्तेमाल किया जा रहा है, के रूप में वे कुल माइक्रोबियल लोड के एक तेज और विश्वसनीय संस्कृति स्वतंत्र उपाय प्रदान करते हैं । तदनुसार, qPCR तरीके उम्र के साथ जुड़े microbiota में परिवर्तन या भड़काऊ आंत्र रोग9,10सहित कई रोगों की प्रगति के साथ अध्ययन करने के लिए उपयोगी साबित कर दिया है । इस के साथ लाइन में, qPCR तरीके एक तेजी से और लागत प्रभावी करने के लिए विभिन्न उपचार (एंटीबायोटिक्स सहित) मल बैक्टीरियल भार में और microbiota संरचना10,11,12के प्रभाव को मान्य करने के लिए दृष्टिकोण प्रदान करते हैं ।

यहां, हम चूहों, मल नमूना संग्रह, डीएनए निष्कर्षण, मानकों की तैयारी और qPCR द्वारा मल नमूनों में बैक्टीरिया के ठहराव के लिए दो अलग प्रोटोकॉल के एक विस्तृत कदम दर कदम खाते में उपस्थित । इन प्रोटोकॉल चूहों में आंत्र microbiota में हेरफेर करने के लिए और आंत्र homeostasis और रोग में एंटीबायोटिक उपचार के प्रभाव का अध्ययन करने के लिए एक विश्वसनीय विधि प्रदान करते हैं ।

Protocol

प्रयोग यहां वर्णित 6-8 सप्ताह पुरानी जंगली-प्रकार (C57BL6/चूहों एक विशिष्ट रोगज़नक़ मुफ्त (SPF) सुविधा में बनाए रखा का उपयोग किया गया । सभी पशु प्रयोगों राजा कॉलेज लंदन और फ्रांसिस क्रिकेटरों संस्थान पशु कल्याण और एथिकल रिव्यू बॉडी और यूनाइटेड किंगडम के घर कार्यालय द्वारा अनुमोदित किया गया । किसी भी पशु प्रक्रिया शुरू करने से पहले, सुनिश्चित करें कि उचित अनुमति स्थानीय संस्था के माध्यम से प्राप्त कर रहे है/

1. एंटीबायोटिक दवाओं के प्रशासन

नोट: एंटीबायोटिक उपचार के लिए दो वैकल्पिक तरीकों प्रदान की जाती है: ओरल gavage (चरण १.१) और पीने के पानी के माध्यम से एंटीबायोटिक दवाओं के प्रशासन (१.२ कदम) ।

  1. ओरल gavage
    1. उन्हें निम्नलिखित सांद्रता में autoclaved पानी में भंग द्वारा व्यक्तिगत एंटीबायोटिक दवाओं के शेयरों को तैयार: एम्पीसिलीन पर १०० मिलीग्राम/एमएल, Gentamicin पर १०० मिलीग्राम/एमएल, निओमायसिन पर १०० मिलीग्राम/एमएल, Metronidazole में 10 मिलीग्राम/एमएल और Vancomycin पर १०० मिलीग्राम/एमएल । एक ०.४५ µm फिल्टर का उपयोग कर बंध्याकरण फिल्टर. Aliquot और-20 डिग्री सेल्सियस पर स्टोर ।
    2. ऊपर तैयार किए गए स्टॉक्स को मिलाकर एंटीबायोटिक्स का कॉकटेल तैयार करें । 1 मिलीलीटर मिश्रण ५० एम्पीसिलीन के µ एल की एक मात्रा के लिए (5 मिलीग्राम/५० µ एल ऑफ Gentamicin (5 मिलीग्राम/एमएल फाइनल), ५० µ एल ऑफ निओमायसिन (5 एमजी/एमएल फाइनल), ५०० µ एल ऑफ Metronidazole (5 एमजी/एमएल फाइनल), 25 µ एल ऑफ Vancomycin (२.५ एमजी/एमएल फाइनल) और पानी के ३२५ µ एल. उपयोग करने से पहले कॉकटेल ताजा तैयार करें ।
    3. एक बाँझ 1 मिलीलीटर सिरिंज में एंटीबायोटिक मिश्रण लोड और किसी भी बुलबुले को नष्ट करते हुए एक उचित गेज gavage सुई (15 – 20 ग्राम चूहों के लिए 20 ग्राम) को ठीक करें ।
    4. एंटीबायोटिक मिक्स के २०० µ एल के साथ Gavage चूहों ।
      1. मजबूती से माउस कंधे पर त्वचा हड़पने, घेघा को सीधा करने के लिए सिर और गर्दन खिंचाव । सीधे मुंह की छत के साथ खिला सुई की गेंद टिप और ग्रसनी के पीछे की ओर । फिर, धीरे से इसे नीचे घेघा में पास और २०० μL समाधान सुई ।
    5. प्रयोग की अवधि के लिए एंटीबायोटिक कॉकटेल एक बार दैनिक प्रशासन ।
  2. पीने के पानी में एंटीबायोटिक्स
    सावधानी: सावधानी से पीने के पानी में एंटीबायोटिक प्रशासन के पहले दो हफ्तों के लिए दैनिक माउस वजन की निगरानी ।
    1. autoclaved पानी के 1 L में निम्नलिखित को भंग करके एंटीबायोटिक दवाओं का एक कॉकटेल तैयार करें: 1 g of एम्पीसिलीन (1 g/l final), निओमायसिन का 1 g (1 g/l final), Metronidazole का 1 g (1 g/l final), Vancomycin का ०.५ g (०.५ g/l final) और 8 पाउच (०.७५ ग्राम प्रत्येक) का कृत्रिम स्वीटनर (६० g/L अंतिम). हिला जब तक भंग । 4 डिग्री सेल्सियस पर स्टोर ।
      नोट: स्वीटनर एंटीबायोटिक दवाओं के स्वाद को छिपाने के लिए और चूहों निर्जलीकरण को रोकने के लिए जोड़ा जाता है । जबकि कई स्वीटनर ब्रांडों काम कर सकते हैं, अंतिम एकाग्रता की आवश्यकता प्रत्येक विशिष्ट ब्रांड के लिए अलग हो सकता है.
    2. एक पानी की बोतल में एंटीबायोटिक कॉकटेल भरें (~ १०० मिलीलीटर/बोतल) और एक चूहा पिंजरे पर बोतल जगह है ।
      नोट: ब्राउन बोतलों का प्रयोग करें या पंनी के साथ बोतलों को कवर करने के लिए प्रकाश से एंटीबायोटिक दवाओं की रक्षा ।
    3. प्रयोग की अवधि के लिए सप्ताह में दो बार ताजा स्टॉक के साथ एंटीबायोटिक कॉकटेल बदलें ।

2. मल, लघ्वान्त्र सामग्री, और लघ्वान्त्र दीवार से मल के नमूनों का संग्रह

  1. वजन और लेबल 2 मिलीलीटर नमूना संग्रह के लिए autoclaved ट्यूबों ।
  2. ताजा मल के नमूनों के संग्रह के लिए, एक निरोधक में प्रत्येक माउस जगह और एक संग्रह ट्यूब में गुदा से सीधे मल छर्रों इकट्ठा ।
    नोट: नमूने भी एक साफ autoclaved पिंजरे में चूहों रखकर प्राप्त किया जा सकता है, और साफ निष्फल संदंश के साथ स्टूल नमूनों का संग्रह.
  3. Euthanize के साथ चूहों को गर्भाशय ग्रीवा विस्थापन के बाद2 asphyxiation ।
  4. पेट के साथ एक चूहा लोथ करना पूरी तरह से उजागर और ७०% इथेनॉल के साथ उदर क्षेत्र स्प्रे ।
  5. निष्फल संदंश और कैंची का प्रयोग, पेट में एक अनुप्रस्थ चीरा करने के लिए किसी भी आंतरिक ऊतकों को नुकसान पहुँचाए बिना आँख. और एक चीरा बनाने के लिए आंतों को बेनकाब करने के लिए ।
  6. संदंश और कैंची के साथ आंतों (बृहदांत्र से पेट) निकालें और यह एक बाँझ पेट्री पकवान में जगह है ।
  7. सावधानी से छोटी आंत (SI) को चिढ़ाने के लिए संदंश का इस्तेमाल mesenteric धमनियों और फैट से दूर करें । आंत का विस्तार और यह एक स्वच्छ प्रयोगशाला पोंछ पर जगह है ।
  8. एक शासक के साथ, माप और SI के बाहर लघ्वान्त्र के 4 सेमी कटौती (अंधान्त्र के लिए निकटतम भाग). कट और अंधान्त्र के लिए समीपस्थ आंत के 1 सेमी त्यागें । इसमें लघ्वान्त्र का 3 सेमी हिस्सा छोड़ा जाएगा जिसका इस्तेमाल आंतों के बैक्टीरिया को इकट्ठा करने के लिए किया जाएगा ।
  9. एक 2 मिलीलीटर बाँझ ट्यूब पर लघ्वान्त्र भाग (3 सेमी) पकड़ो । आंत्र सामग्री सीधे आंत को बाहर निकालना और colleting ट्यूब में नमूना ले लीजिए । इस नमूने लघ्वान्त्र सामग्री से बैक्टीरिया होगा ।
  10. एक 20 मिलीग्राम कोल्ड फॉस्फेट बफर खारा (पंजाब) के साथ सिरिंज तैयार करें और लघ्वान्त्र भाग फ्लश (प्रवाह के माध्यम से त्यागें) ।
  11. लघ्वान्त्र भाग को एक साफ काग़ज़ तौलिया पर रखें और इसे कैंची से longitudinally खोलें ।
  12. एक स्केलपेल के साथ लघ्वान्त्र दीवार के अंदर परिमार्जन ।
  13. एक साफ केंद्रापसारक ट्यूब पर पंजाब के 1 मिलीलीटर के साथ स्केलपेल धोने से स्केलपेल पर किसी भी बैक्टीरिया इकट्ठा । 5 मिनट के लिए ८,००० × g पर स्पिन जीवाणु गोली और supernatant त्यागें । इस नमूने में लघ्वान्त्र दीवार से बैक्टीरिया शामिल होंगे ।
    नोट: मल, लघ्वान्त्र सामग्री और दीवार से मल के नमूनों और जमे हुए किया जा सकता है-८० ° c उपयोग तक में संग्रहीत ।
  14. स्टूल और लघ्वान्त्र सामग्री से नमूने युक्त ट्यूबों तौलना, और खाली ट्यूबों से वजन घटाना (२.१ कदम से) प्रत्येक नमूने में मल वजन प्राप्त करने के लिए ।
  15. स्टूल से बैक्टीरियल डीएनए निकालें, लघ्वान्त्र सामग्री और लघ्वान्त्र दीवार व्यावसायिक रूप से उपलब्ध किट का उपयोग कर नमूने । उपयोग करने तक-20 डिग्री सेल्सियस पर डीएनए नमूनों की दुकान ।

3. qPCR द्वारा आंतों के Microbiota का ठहराव

नोट: इस प्रक्रिया में एक मानक (चरण ३.१) की जनरेशन और मानक और मल नमूनों (चरण ३.२) के लिए qPCR सेट-अप के लिए विधि शामिल है

  1. qPCR के लिए एक मानक की पीढ़ी
    1. का प्रयोग करें पोलीमरेज़ चेन रिएक्शन (पीसीआर) एक बैक्टीरियल संस्कृति से निकाले जीनोमिक डीएनए से 16S rRNA जीन बढ़ाना के लिए रिएजेंट13 और पीसीआर 1 तालिकामें विस्तृत स्थितियों का उपयोग कर ।
    2. एक १.५% agarose जेल पर पीसीआर उत्पाद चलाने के लिए और डीएनए बैंड एक व्यावसायिक रूप से उपलब्ध डीएनए निष्कर्षण किट का उपयोग कर शुद्ध ।
    3. Ligate शुद्ध डीएनए एक क्लोनिंग किट का उपयोग कर टुकड़ा ( सामग्री की तालिकादेखें, एक सदिश का उपयोग एंटीबायोटिक प्रतिरोध मार्करों और β-galactosidase (LacZ) ब्लू/व्हाइट कॉलोनी चयन के लिए जीन संलयन) और रूपांतरित DH10 सक्षम ई. कोलाई निर्माता के निर्देशों का पालन । एम्पीसिलीन पर प्लेट रूपांतरण (१०० µ g/एमएल), एक्स-लड़की (20 µ g/ml) Luria Bertani (LB) आगर प्लेट्स (10 g/l Tryptone, 5 g/l खमीर निकालें, 10 g/l NaCl, 15 g/l आगर) । ३७ डिग्री सेल्सियस पर रात भर मशीन (O/
    4. थाली में से किसी एक पॉजिटिव (वाइट) कॉलोनी का चयन करें । २५० rpm पर मिलाते हुए यह 5 मिलीलीटर पौंड शोरबा में Inoculate १०० µ जी/एमएल एम्पीसिलीन और मशीन ओ/
    5. से O/N संस्कृति, अलग और शुद्ध निर्माता के निर्देशों के अनुसार एक वाणिज्यिक miniprep किट का उपयोग कर प्लाज्मिड ।
      नोट: यह इस स्तर पर प्लाज्मिड डालने अनुक्रम महत्वपूर्ण है, यह सुनिश्चित करने के लिए कि प्लाज्मिड 16S rRNA जीन की केवल एक प्रतिलिपि शामिल है और आधार-जोड़े (बीपी) में अपनी लंबाई निर्धारित करने के लिए ।
    6. Linearize एक प्रतिबंध एंजाइम जो प्लाज्मिड केवल एक बार कटौती के साथ प्लाज्मिड ।
    7. एक व्यावसायिक रूप से उपलब्ध किट का उपयोग कर रैखिक प्लाज्मिड शुद्ध ।
    8. एक spectrophotometer का उपयोग कर २६० एनएम पर अवशोषक को मापने के द्वारा प्लाज्मिड की एकाग्रता का निर्धारण ।
    9. निंन सूत्र14का उपयोग करके नमूना की प्लाज्मिड प्रतिलिपियों/µ l की संख्या परिकलित करें:
      प्रतियां की संख्या = (राशि * ६.०२२ × 1023)/(लंबाई * 1 × 109 * ६५०)
      जहां राशि डीएनए एकाग्रता चरण 3.1.8 में प्राप्त की है (एनजी/µ एल में); और लंबाई है प्लाज्मिड की कुल लंबाई (डालने के साथ) बीपी में । प्रतिलिपियों की संख् या µ l के रूप में प्राप् त की जाएगी ।
      नोट: प्लाज्मिड प्रतियों की संख्या की आसान गणना सक्षम करें कि उपरोक्त सूत्र के आधार पर ऑनलाइन उपकरण हैं ।
    10. Aliquot और आवश्यकता के रूप में मानक की दुकान-20 ° c उपयोग तक ।
  2. मानक और मल नमूनों के लिए qPCR सेट अप
    1. गल qPCR स्टैंडर्ड (स्टेप 3.1.10 से), मल के नमूनों का डीएनए (स्टेप २.१५ से) और qPCR रिएजेंट (एक व्यावसायिक रूप से उपलब्ध किट से) बर्फ पर ।
      नोट: इस उदाहरण में प्रयुक्त qPCR रिएजेंट SYBR ग्रीन qPCR रिएक्शन मिक्स और फॉरवर्ड और रिवर्स प्राइमर (तालिका 2) शामिल हैं ।
    2. एक सीमा में बाँझ डीएनए में मानक को पतला-मुक्त पानी 107 से 102 प्रतियां/µ l (जैसे, 1/5 सीरियल कमजोर पड़ने से 107 से ६.४ x 102 प्रतियां/µ l) । 1/2, 1/5, 1/10 के लिए मल नमूना डीएनए पतला
    3. प्रतिक्रियाओं की कुल संख्या के लिए एक मास्टर मिक्स प्रतिक्रिया प्लस 1 (तालिका 2) बनाओ ।
    4. मास्टर मिक्स और टेंपलेट के 5 µ एल के 30 µ एल मिश्रण (नकारात्मक नियंत्रण के लिए मानक, नमूना या पानी)
    5. एक ३८४-अच्छी तरह से ऑप्टिकल qPCR प्लेट में एक अच्छी तरह से करने के लिए इस मिश्रण के 10 µ एल जोड़ें । तपसिल में प्रत्येक प्रतिक्रिया करते हैं ।
    6. qPCR जगह सील, संक्षेप में केंद्रापसारक और qPCR मशीन पर निंनलिखित सायक्लिंग शर्तों के साथ क्रमादेशित प्लेट लोड: ९५ ° c के लिए 20 मिनट ९५ ° c के ४० चक्र के लिए 15 एस और ६० ° c 1 मिनट के लिए के बाद ।
    7. मानक और नमूनों के लिए सीटी मान प्राप्त करें ।
    8. प्लाज्मिड (चरण 3.1.9 में परिकलित के रूप में) की प्रतिलिपि संख्या का लघुगणक बनाम मानक के लिए CT मान प्लॉट करके एक मानक वक्र जनरेट करें । मानक वक्र के पंक्तिबद्ध प्रतीपगमन निष्पादित करें ।
    9. मानक वक्र में interpolating CT मान (चरण 3.2.2 में प्राप्त) द्वारा मल नमूनों के लिए 16S rDNA प्रतिलिपि संख्याओं की गणना करें ।
      नोट: 16S rDNA प्रत्येक नमूने के लिए प्रतिलिपि संख्या नमूना (चरण 3.2.2 में तैयार के रूप में) के कमजोर पड़ने फैक्टर पर विचार सही किया जाना चाहिए, अंतिम मात्रा न्यूक्लिक एसिड है कि eluted (चरण २.१५ में) थे और मल नमूना की मात्रा (२.१४ चरण में परिकलित) प्राप्त करने के लिए मल के प्रति ग्राम जीन प्रतियां ।

Representative Results

यहां हम चूहों के मौखिक एंटीबायोटिक उपचार के लिए दो वैकल्पिक प्रोटोकॉल प्रदान करते हैं । चित्रा 1 शरीर का प्रतिशत वजन से पता चलता है (प्रत्येक जानवर के लिए मूल बेस लाइन वजन से संबंधित) चूहों में या तो मौखिक gavage (लाल) या पीने के पानी में लगातार 10 दिनों के लिए (नीला) द्वारा एंटीबायोटिक दवाओं के साथ इलाज किया । कोई ध्यान देने योग्य वजन-नुकसान चूहों कि मौखिक gavage द्वारा एंटीबायोटिक दवाओं प्राप्त में पाया जाता है । हालांकि, जब चूहों को पीने के पानी में एंटीबायोटिक्स विज्ञापन libitum के साथ इलाज कर रहे हैं, वे एंटीबायोटिक प्रशासन के पहले कुछ दिनों के भीतर (~ 10%)) वजन कम है,लेकिन सामांय वजन बाद वसूली बहरहाल, पीने के पानी में एंटीबायोटिक दवाओं प्राप्त चूहों के लगभग 5-10% तक पहुंच सकते है > 20% वजन घटाने के उपचार के पहले सप्ताह के भीतर, जो मामले में वे euthanized हैं ।

मल नमूनों में बैक्टीरिया की ठहराव मानक के लिए प्रतिलिपि संख्या के लॉग की साजिश रचने द्वारा प्राप्त की है जो एक पर्याप्त मानक वक्र के उपयोग की आवश्यकता है (जैसा कि चरण 3.2.2 में गणना) सीटी qPCR से प्राप्त मूल्यों बनाम (चरण 3.2.7). चित्रा 2a एक मानक वक्र से एक प्रतिनिधि उदाहरण है जो मानक वक्र प्रदर्शन मानदंड से ०.९९८२७ के एक आर2 मूल्य,-३.०९ और एक दक्षता ((-1 + 10 ^ (-1/ढलान)) * 100) ११०% की एक ढाल से पता चलता है । आर2 ०.९९ के मूल्यों और पीसीआर ९० की सीमा के भीतर क्षमता ११०% पसंद कर रहे हैं । रेखीय श्रेणी के भीतर, प्रतीपगमन विश्लेषण समीकरण ठहराव 16S rDNA बहुतायत के भीतर मल नमूनों में सक्षम बनाता है । चित्रा बी सी मल, एसआई सामग्री और एसआई दीवार में 16S rDNA प्रतियां की संख्या से पता चलता है । चित्रा बी में डेटा 16S rDNA के रूप में दिखाया जाता है/मल और SI सामग्री के लिए मल के नमूने की प्रतियां । si दीवार के लिए, डेटा si दीवार के 3 सेमी से बरामद बैक्टीरिया से प्राप्त 16S rDNA प्रतियां की कुल संख्या के रूप में प्रस्तुत कर रहे हैं (के रूप में शुरू सामग्री की मात्रा भी एक सटीक वजन प्राप्त करने के लिए छोटा है).

मल के नमूनों में बैक्टीरिया के घनत्व पर एंटीबायोटिक दवाओं के प्रभाव का मूल्यांकन करने के लिए, चूहों एंटीबायोटिक उपचार के दौरान विभिन्न समय अंकों में (0 दिन) से पहले एकत्र किए गए थे, 10 दिनों (दिन 1 से 10) और मल के नमूनों के लिए दैनिक मौखिक gavage द्वारा इलाज किया गया ( 5 दिन और 10), और 7 दिनों के बाद एंटीबायोटिक प्रशासन रोक (17 दिन; चित्र 3ए) । के रूप में चित्र 3 बीमें दिखाया गया है, एंटीबायोटिक उपचार 5 और 10 दिनों में पता चला मल के 16S rDNA प्रतियां/जी की संख्या में एक मजबूत कमी लाती है, जबकि मल में बैक्टीरिया का घनत्व सामांय स्तर को बरामद (पूर्व उपचार के लिए तुलनीय) 1 सप्ताह के बाद एंटीबायोटिक प्रशासन (दिन 17) रोक दिया गया था ।

Figure 1
चित्रा 1: एंटीबायोटिक दवाओं के प्रशासन । चूहों या तो मौखिक gavage (लाल) द्वारा या पीने के पानी में लगातार 10 दिनों के लिए (नीला) एंटीबायोटिक दवाओं प्राप्त किया । प्लाट एंटीबायोटिक प्रशासन (दिन 0) से पहले मूल वजन के सापेक्ष प्रयोगों की अवधि के दौरान चूहों के वजन से पता चलता है । डाटा मतलब ± SEM के रूप में दिखाया जाता है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण देखने के लिए

Figure 2
चित्रा 2:16S rRNA जीन qPCR प्रवर्धन मानकों और मल नमूनों की । () मानक वक्र वर्णनकर्ता के साथ मानक वक्र के रैखिक प्रतिगमन । () मल नमूनों से जीन बहुतायत की गणना. डाटा मतलब ± SEM के रूप में दिखाया जाता है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण देखने के लिए

Figure 3
चित्रा 3: एंटीबायोटिक उपचार के दौरान मल बैक्टीरिया । () मौखिक gavage (Ab) द्वारा एंटीबायोटिक प्रशासन के लिए अनुसूची की योजनाबद्ध और नमूना संग्रह के रूप में * के साथ चित्रित किया । () संकेतित दिनों में एकत्र चूहों से मल नमूनों में मल के प्रति ग्राम 16S rDNA प्रतियां. डाटा मतलब ± SEM के रूप में दिखाया जाता है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण देखने के लिए

अभिकर्मक वॉल्यूम
डीएनए 8 µ l
10x बफर 2 µ l
dNTPs (10 मिमी) ०.४ µ l
Eubacteria-एफ प्राइमर (10 मिमी) 1 µ l
Eubacteria-आर प्राइमर (10 मिमी) 1 µ l
Taq Polimerase ०.२ µ l
एच ७.४ µ l
कुल मात्रा 20 µ l
प्राइमरी जुगाड़
Eubacteria-एफ प्राइमर 5 ' ACTCCTACGGGAGGCAGCAGT 3 '
Eubacteria-आर प्राइमर 5 ' ATTACCGCGGCTGCTGGC 3 '
सायक्लिंग शर्तें
तापमान समय चक्र
९४ ° c 5 min 1x
९४ ° c 30 एस 30एक्स
६० ° c 30 एस 30एक्स
७२ ° c 1 min 30एक्स
७२ ° c 5 min 1x
4 ° c 1x

तालिका 1: पीसीआर रिएजेंट और शर्तें । यह टेबल रिएजेंट और पीसीआर साइकलिंग शर्तों को qPCR की परख में उपयोग करने के लिए एक मानक की पीढ़ी के लिए बैक्टीरियल कल्चर से 16S rRNA जीन बढ़ाना प्रदान करता है । प्राइमर दृश्यों मूलतः Kruglov एट अल द्वारा प्रकाशित किया गया । 13.

अभिकर्मक वॉल्यूम
SYBR ग्रीन मास्टर मिक्स (2x) १७.५ µ l
Eubacteria-एफ प्राइमर (10 मिमी) ०.७ µ l
Eubacteria-आर प्राइमर (10 मिमी) ०.७ µ l
एच ११.१ µ l

तालिका 2: qPCR मास्टर मिक्स । दिखाया (अंतिम मात्रा ३५ µ एल) एक नमूना के लिए कर रहे है तपसिल पर चलाने के लिए (10 µ l प्रत्येक) पर एक ३८४-अच्छी तरह से qPCR प्लेट (µ त्रुटि के लिए अतिरिक्त 5 pipetting एल के लिए लेखांकन). नमूनों की संख्या के अनुसार राशि को विश्लेषित किया जा सकता है ।

Discussion

यहां हम चूहों और qPCR द्वारा मल बैक्टीरिया की ठहराव के लिए एंटीबायोटिक दवाओं के मौखिक प्रशासन के लिए प्रयोगात्मक प्रोटोकॉल प्रदान करते हैं । इस प्रोटोकॉल में इस्तेमाल किया एंटीबायोटिक दवाओं के संयोजन (युक्त एम्पीसिलीन, gentamicin, निओमायसिन, metronidazole और vancomycin) दोनों ग्राम सकारात्मक और ग्राम नकारात्मक बैक्टीरिया, बैक्टीरिया की एक पूरी स्पेक्ट्रम के खिलाफ जीवाणुनाशक गतिविधि की पेशकश लक्ष्य । पीने के पानी में एंटीबायोटिक दवाओं के दोनों मौखिक gavage और प्रशासन बहुत मल बैक्टीरियल लोड5,6,12कमी । इसके अलावा, दोनों उपचार चूहों के phenotype पर एक गहरा प्रभाव के रूप में वे कम तिल्ली आकार और बढ़े हुए अंधान्त्र सहित रोगाणु मुक्त चूहों की विशिष्ट कई विशेषताओं का विकास है । एंटीबायोटिक प्रशासन के लिए एक विशेष विधि का चयन संभवतः मौखिक gavage विधि के रूप में प्रयोग की लंबाई पर निर्भर कर सकते है एंटीबायोटिक दवाओं के दैनिक प्रशासन की आवश्यकता है, और अधिक श्रम गहन जा रहा है और संभवतः के लिए और अधिक असुविधा के कारण लंबी दौड़ में पशु ।

पीने के पानी में एंटीबायोटिक दवाओं के प्रशासन के लिए, सावधानी एंटीबायोटिक मिश्रण करने के लिए स्वीटनर के अलावा के साथ लिया जाना चाहिए के रूप में इस निर्जलीकरण से चूहों रखने के लिए एक महत्वपूर्ण कारक है । कई समूहों से पता चला है कि कैसे पीने के पानी में एंटीबायोटिक दवाओं के प्रशासन (स्वीटनर के अलावा बिना) बहुत गंभीर और तेजी से वजन-सभी चूहों के साथ कम करने की ओर जाता है प्रारंभिक शरीर के वजन के 20% से अधिक प्रयोग5 के पहले कुछ दिनों के भीतर खोने , 6. हमारे प्रोटोकॉल में, सैक्रीन आधारित मिठास का उपयोग करने के लिए पर्याप्त पानी में एंटीबायोटिक स्वाद मुखौटा और चूहों एंटीबायोटिक प्रशासन के बाद पहले कुछ दिनों में वजन कम लग रहा था, लेकिन उनके वजन के बाद जल्दी से बरामद ( चित्रा 1) । बहरहाल, हमारे प्रयोगों में 5-10% चूहों की अभी भी मानव अंत बिंदु तक पहुँचने > 20% आधारभूत शरीर के वजन के नुकसान और euthanized होने की जरूरत. हम भी sucralose आधारित स्वीटनर्स का परीक्षण किया है जो पूरी तरह से चूहों निर्जलीकरण को रोकने में विफल रहा है (१००% के चूहों खो > 20% वजन का) जबकि अन्य लेखकों aspartame आधारित मिठास5,6के लिए समान विफलताओं प्रकाशित किया है. इस के लिए जोड़ा गया, उंर, आनुवंशिक पृष्ठभूमि और प्रयोगों के लिए इस्तेमाल किया चूहों की सामांय स्वास्थ्य स्थिति पर विचार किया जाना चाहिए, क्योंकि वे एंटीबायोटिक उपचार के दौरान वजन घटाने और पशुओं की भलाई को प्रभावित कर सकते हैं । इस प्रकार, चूहों वजन और सामांय स्वास्थ्य स्थिति की सावधान निगरानी मौखिक एंटीबायोटिक प्रशासन के पहले दो हफ्तों के दौरान दैनिक प्रदर्शन किया जाना चाहिए ।

qPCR तरीकों मल नमूनों में 16S rRNA के ठहराव के लिए एक तेजी से और लागत प्रभावी दृष्टिकोण प्रदान करते हैं । हालांकि, कुछ सीमाओं सहित इस तकनीक के बारे में विचार किया जाना चाहिए: i) एक विश्वसनीय उच्च गुणवत्ता मानक के लिए आवश्यकता; ii) डिजाइन और qPCR प्राइमरों की दक्षता; iii) तथ्य यह है कि सूक्ष्मजीवों 16S rRNA जीन के विभिंन प्रतिलिपि संख्या हो सकती है, इस प्रकार जीन प्रतियां सीधे बराबर नहीं सेल गणना15हो सकता है । बहरहाल, qPCR एक मजबूत और संवेदनशील विधि है जो मल के नमूनों के तेजी से विश्लेषण में सक्षम बनाता है । इस विधि के लिए विशेष रूप से उपयोगी हो सकता है जल्दी से (एंटीबायोटिक दवाओं सहित) विभिंन उपचार के प्रभाव के रूप में यहां विस्तृत मल बैक्टीरियल भार में मांय । इसके अलावा, हालांकि हम कुल 16S rRNA के ठहराव के लिए एक प्रोटोकॉल प्रदान करते हैं, इस विधि को आसानी से अनुकूलित किया जा सकता है (विशिष्ट प्राइमर16डिजाइन करके) व्यक्तिगत बैक्टीरियल taxa की पहचान को सक्षम करने के लिए, इस प्रकार दोनों मात्रात्मक और प्रदान microbiome आकार और संरचना के बारे में गुणात्मक जानकारी ।

संक्षेप में, हम चूहों के मौखिक एंटीबायोटिक उपचार के लिए दो प्रोटोकॉल प्रदान की है और एक qPCR आधारित विधि मल बैक्टीरिया में एंटीबायोटिक प्रेरित परिवर्तन यों तो । हालांकि इन प्रोटोकॉल और अनुकूलित किया जा सकता है और व्यक्तिगत प्रयोगात्मक आवश्यकताओं के अनुसार अंय दृष्टिकोण के साथ संयुक्त, वे जल्दी के रूप में सेवा कर सकते हैं, लागत प्रभावी और विश्वसनीय उपकरण murine आंत्र microbiota में हेरफेर करने के लिए और प्रभाव का अध्ययन करने के लिए आंत्र homeostasis और रोग में एंटीबायोटिक उपचार के ।

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

इस काम के लिए ब्रिटेन के चिकित्सा अनुसंधान परिषद द्वारा वित्त पोषित किया गया (पीईबी श्री के लिए अनुदान/L008157/ R.J. एक मैरी क्यूरी इंट्रा यूरोपीय फैलोशिप (H2020-MSCA-IF-2015-703639) द्वारा समर्थित किया गया था; P.M.B. ब्रिटेन चिकित्सा अनुसंधान परिषद और किंग कॉलेज लंदन डॉक्टरेट प्रशिक्षण जैव चिकित्सा विज्ञान में भागीदारी से एक छात्र द्वारा समर्थित किया गया था (श्री/N013700/

Materials

Name Company Catalog Number Comments
Ampicillin sodium salt Sigma-Aldrich (Merck) A9518
Neomycnin trisulfate salt hydrate Sigma-Aldrich (Merck) N1876
Metronidazole Sigma-Aldrich (Merck) M3761
Vancomycin hydrochloride Sigma-Aldrich (Merck) V2002
Gentamicin sulfate salt Sigma-Aldrich (Merck) G3632
Tryptone Sigma-Aldrich (Merck) T7293
Yeast Extract Sigma-Aldrich (Merck) Y1625
NaCL Sigma-Aldrich (Merck) S7653
Sweetener Sweet'n Low Sweet'N Low Available in the UK from Amazon.co.uk
X-Gal (5-brom-4-chloro-3-indoyl B-D-galactopyranoside) Fisher scientific 10234923
Phosphate Buffered Saline  Thermo Fisher Scientific (Gibco) 10010023
Ultrapure Agarose Thermo Fisher Scientific (Invitrogen) 16500500
RT-PCR grade water Thermo Fisher Scientific (Invitrogen) AM9935
Phusion High-Fidelity DNA Polymerase New England BioLabs M0530
Deoxynucleotide (dNTP) Solution Mix New England BioLabs N0447
iTaq Universal SYBR Green Supermix Bio-Rad 1725124 with ROX
TOPO TA cloningTM for sequencing Thermo Fisher Scientific (Invitrogen) 450030
QIAamp fast DNA Stool mini kit  Qiagen 51604
QIAprep spin Miniprep kit Qiagen 27106
QIAquick gel  extraction kit Qiagen 28704
Syringe filter 0.45 µm Fisher scientific 10460031
Swann-MortonTM Carbon steel sterile scalpel blades Fisher scientific 11792724
Syringe (1 mL) BD Plastipak 303172
Syringe (20 mL) BD Plastipak 300613
1.5 mL Crystal clear microcentriguge tube StarLab E1415-1500
2 mL Ultra high recovery microcentrifuge tube StarLab I1420-2600
Oral dosing needles 20 G x 38 mm curved (pk/3) Vet-Tech DE008A
Sterilin petri dish 50 mm  Scientific Laboratory Supplies PET2020
Absolute qPCR plate seals Thermo Fisher Scientific AB1170
MicroAmpTM optical 384-well plate  Thermo Fisher Scientific (Applied Biosystems) 4309849
ViiA7TM 7 real-time PCR system with 384-well block Thermo Fisher Scientific (Applied Biosystems) 4453536
Spectrophotometer (Nanodrop 1000) Thermo Fisher Scientific ND-1000
Labnet Prism microcentrifuge Labnet C2500
MultiGene Optimax Thermal cycler Labnet TC9610

DOWNLOAD MATERIALS LIST

References

  1. Belkaid, Y., Hand, T. W. Role of the microbiota in immunity and inflammation. Cell. 157, (1), 121-141 (2014).
  2. Hooper, L. V., Littman, D. R., Macpherson, A. J. Interactions between the microbiota and the immune system. Science. 336, (6086), 1268-1273 (2012).
  3. Ubeda, C., Pamer, E. G. Antibiotics, microbiota, and immune defense. Trends in Immunology. 33, (9), 459-466 (2012).
  4. Dethlefsen, L., Huse, S., Sogin, M. L., Relman, D. A. The pervasive effects of an antibiotic on the human gut microbiota, as revealed by deep 16S rRNA sequencing. PLoS Biology. 6, (11), e280 (2008).
  5. Reikvam, D. H., et al. Depletion of murine intestinal microbiota: effects on gut mucosa and epithelial gene expression. PLoS One. 6, (3), e17996 (2011).
  6. Hill, D. A., et al. Metagenomic analyses reveal antibiotic-induced temporal and spatial changes in intestinal microbiota with associated alterations in immune cell homeostasis. Mucosal Immunology. 3, (2), 148-158 (2010).
  7. Fraher, M. H., O'Toole, P. W., Quigley, E. M. Techniques used to characterize the gut microbiota: a guide for the clinician. Nature Reviews Gastroenterology & Hepatology. 9, (6), 312-322 (2012).
  8. Eckburg, P. B., et al. Diversity of the human intestinal microbial flora. Science. 308, (5728), 1635-1638 (2005).
  9. Sokol, H., et al. Low counts of Fecalibacterium prausnitzii in colitis microbiota. Inflammatiry Bowel Diseases. 15, (8), 1183-1189 (2009).
  10. Bartosch, S., Fite, A., Macfarlane, G. T., McMurdo, M. E. Characterization of bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbiota. Applied Environmental Microbiology. 70, (6), 3575-3581 (2004).
  11. Ubeda, C., et al. Vancomycin-resistant Enterococcus domination of intestinal microbiota is enabled by antibiotic treatment in mice and precedes bloodstream invasion in humans. Journal of Clinical Investigation. 120, (12), 4332-4341 (2010).
  12. Saez de Guinoa, J., et al. CD1d-mediated lipid presentation by CD11c(+) cells regulates intestinal homeostasis. EMBO Journal. 37, (5), (2018).
  13. Kruglov, A. A., et al. Nonredundant function of soluble LTalpha3 produced by innate lymphoid cells in intestinal homeostasis. Science. 342, (6163), 1243-1246 (2013).
  14. Wilhelm, J., Pingoud, A., Hahn, M. Real-time PCR-based method for the estimation of genome sizes. Nucleic Acids Research. 31, (10), e56 (2003).
  15. Kembel, S. W., Wu, M., Eisen, J. A., Green, J. L. Incorporating 16S gene copy number information improves estimates of microbial diversity and abundance. PLoS Computational Biology. 8, (10), e1002743 (2012).
  16. Yang, Y. W., et al. Use of 16S rRNA Gene-Targeted Group-Specific Primers for Real-Time PCR Analysis of Predominant Bacteria in Mouse Feces. Applied Environmental Microbiology. 81, (19), 6749-6756 (2015).
मात्रात्मक पोलीमरेज़ चेन प्रतिक्रिया आधारित विश्लेषण Murine आंत्र Microbiota मौखिक एंटीबायोटिक उपचार के बाद
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Jimeno, R., Brailey, P. M., Barral, P. Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment. J. Vis. Exp. (141), e58481, doi:10.3791/58481 (2018).More

Jimeno, R., Brailey, P. M., Barral, P. Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment. J. Vis. Exp. (141), e58481, doi:10.3791/58481 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter