Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

구두 항생제 치료 후 Murine 장 Microbiota의 정량적 중 합 효소 연쇄 반응-기반 분석

doi: 10.3791/58481 Published: November 17, 2018

Summary

여기 우리가 제공 자세한 프로토콜 항생제의 구강 관리에 대 한 쥐, 배설물 샘플, DNA 추출 및 배설물 박테리아의 정량화를 정량 하 여.

Abstract

본질적인 microbiota은 인간의 건강에 중앙 영향. 미생물 dysbiosis 선 동적인 장 질병, 천식, 관절염 등 많은 일반적인 immunopathologies와 연결 됩니다. 따라서, 중요 한 중요성의 이다 누화 microbiota 면역 시스템을 기본 메커니즘을 이해. 병원 체 허가 방 조 하는 동안 항생제 관리는 또한 크기와 인간의 건강에 영향을 미칠 수 있는 장내 세균 커뮤니티의 구성에 과감 한 변화를 유도 합니다. 쥐에 항생제 치료 영향 및 항생제 치료 환자에서 인간의 microbiota에 장기적인 변화가 고 미생물 지역 사회 변화 및 면역 세포 기능 간의 기계적 링크의 조사. 쥐의 항생제 치료에 대 한 몇 가지 메서드를 설명 하는 동안 그들 중 일부는 심한 탈수와 체중 데이터의 해석을 복잡 하 게 유도. 여기, 구두 항생제 관리 주요 체중 감량을 유도 하지 않고 마우스의 장기 처리를 위해 사용 될 수 있는 두 개의 프로토콜 제공 합니다. 이러한 프로토콜 항생제의 조합을 대상으로 그람 양성 및 그람 음성 박테리아 사용 하 게 하 고 어느 광고 libitum 식용 수 또는 구강에 의해 제공 될 수 있다. 또한, 항생제 치료의 효능을 확인 하는 데 사용할 수 있는 정량 하 여 배설물 샘플에 미생물 밀도의 정량화 하는 방법을 설명 합니다. 이러한 접근의 조합 장 microbiota의 조작 및 쥐에 항생제 치료의 효과의 연구에 대 한 신뢰할 수 있는 방법론을 제공합니다.

Introduction

포유류 위장 점 막의 호스트와 함께 mutualistic 관계를 설정 하는 매우 복잡 한 혼합물에 의해 식민지 독특한 환경 이다. 장 점 막의 방어 시스템 구성 상피 층과 그들의 수 및 다양성을 유지 하면서 소장 내에서 공생을 제한 하는 면역 세포의 과다. 반대로, 공생 생물은 완전히 기능 면역 시스템의 개발에 필요한. 호스트 및 공생 박테리아 사이의 상호 작용은 일반적으로 도움이 되 고 점점 더 분명 그 dysregulated 면역 시스템 microbiota 누화 만성 염증 성 질병, asinflammatory 대 장 등의 개발을 찬성 수 있습니다. 질병, 관절염 이나 천식1,2.

본질적인 microbiota 다양 한 요인에 의해 변경 될 수 있습니다 하지만 아마도 가장 급격 한 변화는 심각 하 게 변경 하는 크기와 세균성 지역 사회3,4의 항생제 치료에 의해 유도 된다. 감염을 치료 하는 항생제의 장점은 의심, 하는 동안 인간의 항생제 노출에 의해 유도 된 microbiota 변화 건강에 해로운 영향으로 이어질 수 있는 면역 방어를 수정할 수도 있습니다. 예를 들어, 인 간에 있는 항생제 치료 Clostridium 남과 어울리지 않는의 위험 증가에 연결 되었습니다-설사, 천식 그리고 특정 유형의 암3유도. 쥐에 항생제 치료 영향 및 장기 변경 항생제 치료 환자의 창 자 커뮤니티에서 발견이 고 미생물 지역 사회 변화 및 면역 세포 기능 간의 기계적 링크의 조사를 사용할 수 있다. 그러나, 몇 가지 보고서로 쥐의 파울 맛5,6때문에 아마도 식 수에서 참 음료수 광고 libitum 에 항생제의 관리 매우 눈에 띄는 체중 감량 결과 나타났습니다. 따라서, 이러한 모델에 구두 항생제 관리를 수 반하는 심한 탈수 있습니다 복잡 하 게 면역 세포 기능에 항생제 치료의 효과 확인 하는 것을 목표로 하는 실험의 해석.

몇 가지 방법은 크기와 장 구획7미생물 커뮤니티의 구성에 사용할 수 있습니다. 하지만 차세대 시퀀싱 기술 이러한 메서드는 상대적으로 저렴이 문제8, 귀중 한 데이터 제공 하 고 데이터의 해석에 대 한 전문가 bioinformatic 분석 필요. 다른 한편으로, 전통 미생물 문화 방법 세균성 종 검출을 허용 하지만 그들은 낮은 감도 있고 공생 박테리아 (특히 anaerobes)의 큰 분수는 매우 어렵거나와 육성 현재 사용할 수 있는 방법8. 정량적 중 합 효소 연쇄 반응 (정량) 기법 사용 되고있다 점점 정량화 및 지저분한 세균성 종의 식별에 대 한 총 미생물 부하의 신속 하 고 안정적인 문화 독립적인 측정을 제공 하는 그들은. 따라서, 정량 방법 나이 또는 선 동적인 장 질병9,10를 포함 하 여 여러 질병의 진행과 관련 된 microbiota에 변화를 공부 하는 데 유용 증명. 이 맞춰 정량 메서드는 지저분한 세균성 부하 및 microbiota 구성10,,1112(항생제 등) 다양 한 치료의 효과 확인 하기 위해 신속 하 고 비용 효율적인 접근을 제공 합니다.

여기, 선물이 구두 항생제 관리에 대 한 두 가지 프로토콜의 자세한 단계별 계정 쥐, 배설물 샘플 수집, DNA 추출, 표준의 준비 및 배설물 샘플에서 박테리아의 정량화를 정량 하 여. 이러한 프로토콜 쥐에서 장 microbiota를 조작 하 고 장내 항상성 및 질병에 항생제 치료의 효과의 연구를 신뢰할 수 있는 방법을 제공 합니다.

Protocol

여기에 설명 된 실험 6-8 주 오래 된 야생-타입 (C57BL6/J) 마우스는 특정 병원 체 자유롭게 (SPF) 시설에서 유지 관리를 사용 하 여 수행 했다. 모든 동물 실험은 왕의 대학 런던 및 프랜시스 크릭 연구소 동물 복지와 윤리적 검토 기관 및 영국 홈 오피스에 의해 승인 되었다. 어떤 동물 절차를 시작 하기 전에 적절 한 권한을 지역 기관/단체를 통해 가져온 확인 하십시오.

1입니다. 항생제의 관리

참고: 항생제 치료에 대 한 두 가지 대체 방법을 제공 됩니다: 구강 (단계 1.1) 및 식 수 (1.2 단계)를 통해 항생제의 관리.

  1. 구강
    1. 다음과 같은 농도에서 압력가 마로 소독 물에 그들을 용 해 하 여 개별 항생제의 주식을 준비: 100 mg/mL에서 암 피 실린, 100 mg/mL에서 Gentamicin, 100 mg/mL에서 네오 마이 신, 10 mg/mL에 Metronidazole 및 100 mg/mL에서 Vancomycin. 필터는 0.45 μ m 필터를 사용 하 여 소독. 약 수와-20 ° c.에 게
    2. 위에 준비 하는 주식을 혼합 하 여 항생제의 칵테일을 준비 합니다. 1 mL의 볼륨에 대 한 암 피 실린 (5 mg/mL 최종)의 50 µ L, Gentamicin (5 mg/mL 최종)의 50 µ L, 네오 마이 신 (5 mg/mL 최종)의 50 µ L, Metronidazole (5 mg/mL 최종)의 500 µ L, Vancomycin (2.5 mg/mL 최종)의 25 µ L과 325 µ L의 물 혼합. 사용 하기 전에 칵테일 신선한 준비.
    3. 살 균 1 mL 주사기로 항생제 혼합을 로드 하 고 모든 거품을 제거 하는 동안 적절 한 게이지 gavage 바늘 (20 G 15-20 g 마우스)을 수정.
    4. 항생제 혼합의 200 µ L와 gavage 쥐입니다.
      1. 마우스 어깨 피부를 단단히 잡고, 머리와 목 식도을 스트레칭. 볼-지붕 입 및 인 두의 뒤쪽을 따라 먹이 바늘의 팁을 직접. 그런 다음, 부드럽게 식도로 통과 하 고 200 μ 솔루션을 주입.
    5. 실험의 기간에 대 한 항생제 칵테일 한 번을 매일 관리 합니다.
  2. 식 수에 항생제
    주의:은 신중 하 게 항생제 관리 식 수에서의 첫 2 주 동안 매일에 마우스 체중을 모니터링 합니다.
    1. 압력가 마로 소독 물 1 L에 다음을 용 해 하 여 항생제의 칵테일을 준비: 암 피 실린 (1 g/L 최종), 네오 마이 신 (1 g/L 최종)에 Metronidazole (1 g/L 최종), Vancomycin (0.5 g/L 최종) 및 인공의 8 향 낭 (각 0.75 g) 0.5 g 1 g 1 g 1 g 감미료 (60 g/L 최종)입니다. 해산 때까지 흔들어. 4 ° c.에 게
      참고: 감미료를 항생제의 맛을 숨기고 쥐 탈수를 방지 추가 됩니다. 몇 가지 감미료 브랜드 수 있습니다 작동 하는 동안 필요한 최종 농도 각 특정 브랜드에 대 한 달라질 수 있습니다.
    2. 물 병에 항생제 칵테일을 입력 (~ 100 mL/병) 마우스 케이지는 병을 놓습니다.
      참고: 갈색 병을 사용 하거나 빛에서 항생제를 보호 하기 위해 호 일 병을 커버.
    3. 실험 기간 동안 일주일에 두 번 신선한 주식으로 항생제 칵테일을 바꿉니다.

2.의 자, 회장, 내용과 회장 벽에서 배설물 샘플의 수집

  1. 무게 및 레이블 2 mL 샘플 컬렉션 압력가 관.
  2. 신선한 대변 샘플의 컬렉션에 대 한 각 마우스는 restrainer에 놓고 컬렉션 튜브의 항문에서 직접 분 변 알갱이 수집 합니다.
    참고: 샘플 또한 깨끗 한 압력가 장에 마우스를 배치 하 고 깨끗 한 소독된 집게와 대변 샘플을 수집 하 여 얻을 수 있습니다.
  3. CO2 질 식 자 궁 경관 탈 구 다음으로 쥐를 안락사.
  4. 완전히 노출 하는 복 부와 마우스 시체를 복 부 지역 70% 에탄올 스프레이.
  5. 소독된 집게와가 위를 사용, 어떤 내부 조직을 손상 하지 않고 복 노출 하 복 부에 가로 절 개를 만들. 복 들어올린 내장 노출 절 개.
  6. 집게와가 위 (위장 콜론)에서 내장을 제거 하 고 멸 균 페 트리 접시에 놓습니다.
  7. 신중 하 게 사용 하 여 집게 소장 (SI)를 애타게 mesenteric 동맥과 지방. 소장을 확장 하 고 깨끗 한 실험실 지우기에 배치.
  8. 통치자, 측정 고 시 (맹에 가까운 부분)의 말 초 회장의 4 cm를 잘라. 잘라내어 버리고 맹 근 위 소장 1 cm. 회장은 장내 박테리아를 수집 하는 데 사용할 것입니다 왼쪽의 3 cm 부분 있을 것입니다.
  9. 2 mL 무 균 튜브에 회장 부분 (3 cm)를 개최. 밀어내어 직접 장과 colleting 튜브에서 샘플 장 콘텐츠를 수집 합니다. 이 샘플은 회장 내용에서 박테리아를 있을 것 이다.
  10. 버퍼링 차가운 인산 염 (PBS)와 20 mL 주사기를 준비 하 고 플러시 회장 부분 (흐름을 통해 삭제).
  11. 깨끗 한 종이 타월에 회장 부분을 놓고가 위 경도 열.
  12. 메스와 회장 벽의 내부를 다쳤어요.
  13. 깨끗 한 원심 분리기 튜브 위에 PBS의 1 mL를 메스를 세척 하 여 메스에 어떤 박테리아를 수집 합니다. 작은 박테리아는 상쾌한 삭제를 5 분 동안 8000 × g 에서 회전 합니다. 이 샘플은 회장 벽에서 박테리아를 포함 합니다.
    참고:의 자, 회장 콘텐츠 및 벽에서 배설물 샘플 냉동 고 사용까지-80 ° C에서 저장 될 수 있습니다.
  14. 무게는 튜브의 자 및 회장 콘텐츠 샘플을 포함 하 고 각 샘플에 배설물로 무게를 (에서 2.1 단계) 빈 관에서 체중을 빼기.
  15. 자, 회장 콘텐츠 및 상용 키트를 사용 하 여 회장 벽 샘플에서 세균성 DNA를 추출 합니다. 사용까지-20 ° C에서 DNA 샘플을 저장 합니다.

3입니다. 정량에 의해 장 Microbiota의 정량화

참고:이 절차 포함 표준 (3.1 단계)의 생성 및 표준과 배설물 샘플 (3.2 단계)에 대 한 정량 설정 하는 방법

  1. 정량에 대 한 표준의 생성
    1. 연쇄 반응 (PCR)를 사용 하 여 게놈 DNA 추출 시 약13표 1에 자세히 설명 하는 PCR 조건 사용 하 여 세균성 문화에서에서 16S rRNA 유전자를 증폭 하는.
    2. 1.5 %agarose 젤에 PCR 제품을 실행 하 고 상용 DNA 추출 키트를 사용 하 여 DNA 밴드를 정화.
    3. 순화 된 DNA 조각 사용 하 여 참조 테이블의 자료, 항생제 내성 마커 및 블루/화이트 식민지 선택에 대 한 β-galactosidase (LacZ) 유전자 융해를 포함 하는 벡터를 사용 하 여 키트는 복제 선 DH10 유능한 변환 대장균 제조업체의 지침에 따라. 암 피 실린에 변환 접시 (100 µ g/mL), X-여자 (20 µ g/mL) Luria Bertani (파운드) 한 천 배지 (10 g/L Tryptone, 효 모 추출 물, 10 g/L NaCl, 15 g/L 한 천 5 g/L). 품 어 오버 나이트 (O/N) 37 ° c.
    4. 접시에서 단일 포지티브 (흰색) 식민지를 선택 합니다. 5 mL 파운드 국물 100 µ g/mL 암 피 실린 포함 된에서 예방 하 고 O/N 37 ° C, 250 rpm에서 떨고에서 품 어.
    5. O/N 문화에서 분리 하 고 제조업체의 지침에 따라 상업 miniprep 키트를 사용 하 여 플라스 미드 정화.
      참고:이 단계에서 플라스 미드 16S rRNA 유전자의 복사본을 하나만 포함 되어 있는지 확인 하 고 자료 쌍 (bp)의 길이 결정 하는 플라스 미드 삽입 순서 중요 하다.
    6. 플라스 미드를 한 번만 인하를 제한 효소로 플라스 미드 선형화
    7. 상업적으로 사용할 수 있는 키트를 사용 하 여 선형화 플라스 미드 정화.
    8. 260에서 흡 광도 측정 하 여 플라스 미드의 농도 결정 nm는 분 광 광도 계를 사용 하 여.
    9. 다음 수식14를 사용 하 여 샘플의 플라스 미드 복사본 / µ L의 수를 계산.
      복사본의 수 = (금액 * 6.022 × 1023) / (길이 * 1 × 109 * 650)
      금액이 3.1.8 (ng / µ L);에 단계에서 얻은 DNA 농도 그리고 길이 혈압에 (삽입)와 플라스 미드의 총 길이. 사본의 수 복사본 / µ L로 얻을 것 이다.
      참고: 플라스 미드 사본의 수의 쉬운 계산 수 있도록 위의 수식에 따라 온라인 도구가 있습니다.
    10. 약 수 그리고 저장소 사용까지-20 ° C에서 필요에 따라 표준.
  2. 정량 표준 및 배설물 샘플에 대 한 설정
    1. 녹여 정량 (에서 단계 3.1.10) 표준, (에서 단계 2.15) 배설물 샘플 DNA 및 얼음에 (에서 상용 키트) 정량 시 약.
      참고:이 예제에서 사용 하는 정량 Pcr 시 약 포함 SYBR 녹색 정량 Pcr 반응 혼합 및 역방향 뇌관 (표 2).
    2. 10에서 범위에서 살 균 DNA 무료 물에서 표준 희석7 102 복사본 / µ L (10에서예를 들어, 1/5 직렬 희석7 102 복사본 / µ L x 6.4). 희석 배설물 샘플 DNA를 1/2, 1/5, 1/10.
    3. 반응 플러스 1 (표 2)의 총 수에 대 한 마스터 혼합 반응을 확인 합니다.
    4. 믹스 마스터 및 서식 파일 (표준, 샘플 또는 부정적인 제어를 위한 물)의 5 µ L의 믹스 30 µ L
    5. 384 잘 광 정량 접시에 각 잘에이 혼합의 10 µ L를 추가 합니다. 3 중 각 반응을 수행 합니다.
    6. 정량 장소 인감, 간단히 원심 및 로드 자전거 다음과 프로그램 정량 Pcr 기계에 접시: 95 ° C의 40 주기 뒤 20 분 동안 95 ° C 15 s를 1 분 동안 60 ° C.
    7. 표준 및 샘플에 대 한 CT 값을 가져옵니다.
    8. (으로 단계 3.1.9에서에서 계산) 플라스 미드의 사본 숫자의 로그 대 표준에 대 한 CT 값을 플롯 하 여 표준 곡선을 생성 합니다. 표준 곡선의 직계 회귀를 수행 합니다.
    9. 표준 곡선에서 (단계 3.2.2에서에서 얻은) CT 값을 보간하여 배설물 샘플 16S rDNA 복사본 수를 계산 합니다.
      참고: 각 샘플에 대 한 16S rDNA 복사 번호 수정 해야 합니다 (으로 단계 3.2.2에서에서 준비) 샘플의 희석 비율을 고려 하 고 최종 볼륨 핵 산 (2.15 단계)에서 eluted 했다 그를 분 변 샘플 (에서 계산된 단계 2.14)의 양 유전자는 배설물의 그램 당 복사합니다.

Representative Results

여기 우리는 쥐의 경구 항생제 치료에 대 한 두 개의 대체 프로토콜을 제공합니다. 그림 1 마우스 연속 10 일 동안 항생제로 구강 (빨간색) 이나 식 수 (블루) 치료에 몸 무게 (각 동물에 대 한 원래 기본 선 두께 관련)의 비율을 보여줍니다. 아니 눈에 띄는 체중 감량은 구강으로 항생제를 수신 하는 쥐에서 발견 된다. 때 마우스 항생제 광고 libitum 식 수에서로 처리 됩니다, 그들은 체중 (~ 10%), 항생제 관리의 처음 몇 일 이내에 그러나, 복구 정상적인 체중 증가 그 후 (그림 1). 그럼에도 불구 하 고, 약 5-10% 식용 수에서 항생제를 받은 쥐의 도달할 수 > 20% 체중 감소 치료의 첫 번째 주 내에서 그들은 안락사는 어떤 경우에.

분 변 샘플에서 박테리아의 정량화는 정량 (3.2.7 단계)에서 얻은 CT 값 대 (와 단계 3.2.2에서에서 계산 된) 표준에 대 한 복사 숫자의 로그를 플롯 하 여 적절 한 표준 곡선의 사용을 해야 합니다. 그림 2A 는 R2 값이 0.99827,-3.09 및 효율을 기울기의 표준 곡선 성능 기준에 부합 하는 표준 곡선에서 대표적인 예를 보여 줍니다 ((-1 + 110%의 10^(-1/slope))*100). 0.99 및 PCR 효율 90 ~ 110%의 범위 내에서 R2 값은 기본 설정입니다. 선형 범위 내에서 회귀 분석 방정식 배설물 샘플 내에서 16S rDNA 풍부의 정량화를 수 있습니다. 그림 2B 지저분한 대변, 시 내용과 시 벽에 16S rDNA 복사본의 수를 나타냅니다. 그림 2B 에서 데이터는 지저분한 대변 및 SI 콘텐츠에 대 한 배설물 샘플의 16S rDNA 복사본/g로 표시 됩니다. 시 벽에 대 한 데이터 (수량 시작 물자의 정확한 무게를 너무 작습니다)로 시 벽의 3 cm에서 복구 하는 박테리아에서 얻은 16S rDNA의 총 수로 표시 됩니다.

분 변 샘플에서 박테리아의 밀도에 항생제의 효과 평가 하려면 마우스 했다 항생제로 치료 구강에 의해 매일 10 일 동안 (1 ~ 10 일) 전날 (0), 대변 샘플 수집 된 및 항생제 치료 (동안 서로 다른 시간 지점에서 일 5, 10), 그리고 항생제 관리 (하루 17; 중지 한 후 7 일 그림 3A)입니다. 그림 3B에서 같이, 항생제 치료 16S rDNA 복사본/g 5와 10 일 동안 정상 수준 (전처리에 비해) 후 1 주 복구 하는 배설물에 박테리아의 밀도 배설물의 수에서 강한 감소를 유도 항생제 관리 (17 일) 중지 되었습니다.

Figure 1
그림 1: 항생제의 관리. 마우스 구강 (빨간색) 이나 식 수 (블루) 10 일 연속에 대 한 항생제를 받았다. 플롯 항생제 관리 (0 일) 전에 원래 무게를 기준으로 실험 기간 내내 쥐의 가중치를 보여 줍니다. 데이터 평균 ± SEM.로 표시 됩니다 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2: 표준 및 배설물 샘플의 16S rRNA 유전자 정량 Pcr 증폭. (A) 표준 곡선 설명자 표준 곡선의 선형 회귀. (B) 유전자 나타났는데 지저분한 샘플에서 계산 합니다. 데이터 평균 ± SEM.로 표시 됩니다 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3: 배설물 박테리아 항생제 치료 중. 구강 (Ab) 및 샘플 컬렉션으로 표시 하 여 항생제 관리에 대 한 일정의 개략도 (A) *. (B) 16S rDNA 마우스 표시 일 수집에서 대변 샘플에 배설물의 그램 당 복사 합니다. 데이터 평균 ± SEM.로 표시 됩니다 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

시 약 볼륨
DNA 8 Μ L
버퍼 10 X 2 Μ L
dNTPs (10 mM) 0.4 Μ L
Eubacteria-F 뇌관 (10 mM) 1 Μ L
Eubacteria-R 뇌관 (10 mM) 1 Μ L
Taq Polimerase 0.2 Μ L
H2O 7.4 Μ L
총 볼륨 20 Μ L
뇌관 순서
Eubacteria-F 뇌관 5 ' 3' ACTCCTACGGGAGGCAGCAGT
Eubacteria-R 뇌관 5 ' 3' ATTACCGCGGCTGCTGGC
사이클링 조건
온도 시간 사이클
94 ° C 5 분 1 x
94 ° C 30 s 30 x
60 ° C 30 s 30 x
72 ° C 1 분 30 x
72 ° C 5 분 1 x
4 ° C 1 x

표 1: PCR 시 약 및 조건. 이 표에서 시 약 및 정량 분석 실험에서 사용 하는 표준의 생성에 대 한 세균성 문화에서 16S rRNA 유전자 증폭 PCR 순환 상태를 제공 합니다. 뇌관 시퀀스 Kruglov 그 외 여러분 에 의해 원래 간행 되었다 13.

시 약 볼륨
SYBR 녹색 마스터 믹스 (2 배) 17.5 Μ L
Eubacteria-F 뇌관 (10 mM) 0.7 Μ L
Eubacteria-R 뇌관 (10 mM) 0.7 Μ L
H2O 11.1 Μ L

표 2: 정량 마스터 믹스. 볼륨 표시 (최종 볼륨 35 µ L) 3 중 (10 µ L 각) 384-잘 정량 접시 (5 µ L pipetting 오류에 대 한 추가 고려)에 실행 되도록 단일 샘플에 대 한 있습니다. 양은 분석할 샘플 수에 따라 확장할 수 있습니다.

Discussion

여기 우리가 제공 실험 프로토콜 항생제의 구강 관리에 대 한 마우스 및 배설물 박테리아의 정량화를 정량 하 여. 항생제의 조합 그람 양성 및 그람 음성 박테리아, 박테리아의 전체 스펙트럼에 대 한 살 균 활동을 제공 하 고이 프로토콜 (암 피 실린, gentamicin, 네오 마이 신, metronidazole, vancomycin를 포함 하는) 대상에 사용. 구강 및 식 수에 항생제의 관리 크게 배설물 박테리아 감소 로드5,,612. 또한, 두 치료 그들은 몇 가지 특성 감소 비장의 크기 확대 맹 등 무 균 쥐의 전형적인 개발 쥐의 표현 형에 깊은 영향을 있다. 항생제 관리에 대 한 특정 메서드의 선택 가능 하 게 따라 달라질 수 있습니다 실험의 길이에 구강 방법을 필요로 더 노동 집약 되 고 가능 하 게에 더 많은 불편을 초래 하는 항생제의 매일 관리는 장기간에서 동물입니다.

식 수에 항생제의 관리에 대 한 주의 해야 합니다 촬영 항생제 혼합물에 감미료의 추가 함께이 탈수에서 생쥐를 유지 하는 중요 한 요소입니다. 몇몇 그룹 (감미료의 추가) 없이 식 수에 항생제의 관리 모든 쥐 실험5 의 처음 몇 일 이내에 초기 몸 무게의 20%를 잃고 매우 심각 하 고 급속 한 체중 감량을 리드 어떻게 나타났습니다. , 6. 우리의 프로토콜에 기반 설탕 감미료를 사용 하 여 물, 항생제 관리 후 처음 몇 일에 무게를 잃은 마우스에 항생제 맛을 마스크에 충분 한 것 같았다 하지만 그 ( 후 그들의 무게를 신속 하 게 복구 그림 1). 그럼에도 불구 하 고, 우리의 실험에서 쥐의 5-10% 아직도 도달의 인간의 끝점 > 기준선의 20% 손실 체중 및 안락사 될 하는 데 필요한. 우리는 또한 완전히 쥐 탈수를 방지 하지 못했습니다 sucralose 기반 감미료 테스트 (쥐 손실의 100% > 체중의 20%) 다른 저자는 감미료 아스파탐 기반5,6에 대 한 유사한 오류를 출판 하는 동안. 이것에 추가, 나이, 유전적 배경 및 일반적인 건강 상태는 실험을 위해 사용 하는 마우스의 고려 되어야 한다, 그들은 영향을 미칠 수-체중 및 동물 복지 항생제 치료 중으로. 따라서, 마우스 무게와 일반 건강 상태 주의 모니터링 구두 항생제 관리의 첫 2 주 동안 매일 수행 되어야 한다.

정량 방법 배설물 샘플에 16S rRNA의 정량화에 대 한 신속 하 고 비용 효율적인 접근 방식을 제공합니다. 그러나, 몇 가지 제한 사항이 포함 하 여이 기술에 대해 고려해 야 합니다: 내가) 믿을 수 있는 높은 품질 표준;에 대 한 요구 사항 ii) 설계 및 정량 Pcr 뇌관;의 효율성 3) 미생물 16S rRNA 유전자의 다른 복사본 수를 할 수 있다는 사실, 따라서 유전자 사본 수 있습니다 직접 평등 하지 셀 수15. 그럼에도 불구 하 고, 정량 배설물 샘플의 신속한 분석을 가능 하 게 강력 하 고 중요 한 방법입니다. 이 메서드는 신속 하 게 자세한 여기로 배설물의 세균 중에 다양 한 치료 (항생제 등)의 효과 확인 하기 위해 특히 유용할 수 있습니다. 또한, 우리가 16 기의 정량화에 대 한 프로토콜을 제공 rRNA,이 방법을 적용할 수 있습니다 쉽게 (특정 뇌관16여)을 양적 모두 제공 하는 개별 세균성 taxa의 식별을 가능 하 게 하 고 미생물 크기와 구성에 대 한 질적 정보입니다.

요약 하자면, 우리가 제공한 두 개의 프로토콜 마우스 및 배설물 박테리아에 항생제 유도 변화 척도를 정량 기반 방법의 경구 항생제 치료에 대 한. 이러한 프로토콜을 더 최적화 될 수 있으며 개별 실험 필요에 따라 다른 접근에와 함께, 그들은 수 역할을 빠르고 비용 효율적이 고 안정적인 도구 murine 장 microbiota를 조작 하 고 효과의 연구 장 항상성 그리고 질병에 항생제 치료.

Disclosures

저자는 공개 없다.

Acknowledgments

이 작품은 영국 의학 연구 위원회 (샌드위치 미스터/L008157/1 부여);에 의해 투자 되었다 R.J. 마리 퀴리 Intra-European 화목 (H2020-MSCA-IF-2015-703639);에 의해 지원 되었다 P.M.B. 영국 의학 연구 위원회와 생물 의학 (미스터/N013700/1)에 왕의 대학 런던 박사 훈련 파트너십에서 재학 하 여 지원 했다.

Materials

Name Company Catalog Number Comments
Ampicillin sodium salt Sigma-Aldrich (Merck) A9518
Neomycnin trisulfate salt hydrate Sigma-Aldrich (Merck) N1876
Metronidazole Sigma-Aldrich (Merck) M3761
Vancomycin hydrochloride Sigma-Aldrich (Merck) V2002
Gentamicin sulfate salt Sigma-Aldrich (Merck) G3632
Tryptone Sigma-Aldrich (Merck) T7293
Yeast Extract Sigma-Aldrich (Merck) Y1625
NaCL Sigma-Aldrich (Merck) S7653
Sweetener Sweet'n Low Sweet'N Low Available in the UK from Amazon.co.uk
X-Gal (5-brom-4-chloro-3-indoyl B-D-galactopyranoside) Fisher scientific 10234923
Phosphate Buffered Saline  Thermo Fisher Scientific (Gibco) 10010023
Ultrapure Agarose Thermo Fisher Scientific (Invitrogen) 16500500
RT-PCR grade water Thermo Fisher Scientific (Invitrogen) AM9935
Phusion High-Fidelity DNA Polymerase New England BioLabs M0530
Deoxynucleotide (dNTP) Solution Mix New England BioLabs N0447
iTaq Universal SYBR Green Supermix Bio-Rad 1725124 with ROX
TOPO TA cloningTM for sequencing Thermo Fisher Scientific (Invitrogen) 450030
QIAamp fast DNA Stool mini kit  Qiagen 51604
QIAprep spin Miniprep kit Qiagen 27106
QIAquick gel  extraction kit Qiagen 28704
Syringe filter 0.45 µm Fisher scientific 10460031
Swann-MortonTM Carbon steel sterile scalpel blades Fisher scientific 11792724
Syringe (1 mL) BD Plastipak 303172
Syringe (20 mL) BD Plastipak 300613
1.5 mL Crystal clear microcentriguge tube StarLab E1415-1500
2 mL Ultra high recovery microcentrifuge tube StarLab I1420-2600
Oral dosing needles 20 G x 38 mm curved (pk/3) Vet-Tech DE008A
Sterilin petri dish 50 mm  Scientific Laboratory Supplies PET2020
Absolute qPCR plate seals Thermo Fisher Scientific AB1170
MicroAmpTM optical 384-well plate  Thermo Fisher Scientific (Applied Biosystems) 4309849
ViiA7TM 7 real-time PCR system with 384-well block Thermo Fisher Scientific (Applied Biosystems) 4453536
Spectrophotometer (Nanodrop 1000) Thermo Fisher Scientific ND-1000
Labnet Prism microcentrifuge Labnet C2500
MultiGene Optimax Thermal cycler Labnet TC9610

DOWNLOAD MATERIALS LIST

References

  1. Belkaid, Y., Hand, T. W. Role of the microbiota in immunity and inflammation. Cell. 157, (1), 121-141 (2014).
  2. Hooper, L. V., Littman, D. R., Macpherson, A. J. Interactions between the microbiota and the immune system. Science. 336, (6086), 1268-1273 (2012).
  3. Ubeda, C., Pamer, E. G. Antibiotics, microbiota, and immune defense. Trends in Immunology. 33, (9), 459-466 (2012).
  4. Dethlefsen, L., Huse, S., Sogin, M. L., Relman, D. A. The pervasive effects of an antibiotic on the human gut microbiota, as revealed by deep 16S rRNA sequencing. PLoS Biology. 6, (11), e280 (2008).
  5. Reikvam, D. H., et al. Depletion of murine intestinal microbiota: effects on gut mucosa and epithelial gene expression. PLoS One. 6, (3), e17996 (2011).
  6. Hill, D. A., et al. Metagenomic analyses reveal antibiotic-induced temporal and spatial changes in intestinal microbiota with associated alterations in immune cell homeostasis. Mucosal Immunology. 3, (2), 148-158 (2010).
  7. Fraher, M. H., O'Toole, P. W., Quigley, E. M. Techniques used to characterize the gut microbiota: a guide for the clinician. Nature Reviews Gastroenterology & Hepatology. 9, (6), 312-322 (2012).
  8. Eckburg, P. B., et al. Diversity of the human intestinal microbial flora. Science. 308, (5728), 1635-1638 (2005).
  9. Sokol, H., et al. Low counts of Fecalibacterium prausnitzii in colitis microbiota. Inflammatiry Bowel Diseases. 15, (8), 1183-1189 (2009).
  10. Bartosch, S., Fite, A., Macfarlane, G. T., McMurdo, M. E. Characterization of bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbiota. Applied Environmental Microbiology. 70, (6), 3575-3581 (2004).
  11. Ubeda, C., et al. Vancomycin-resistant Enterococcus domination of intestinal microbiota is enabled by antibiotic treatment in mice and precedes bloodstream invasion in humans. Journal of Clinical Investigation. 120, (12), 4332-4341 (2010).
  12. Saez de Guinoa, J., et al. CD1d-mediated lipid presentation by CD11c(+) cells regulates intestinal homeostasis. EMBO Journal. 37, (5), (2018).
  13. Kruglov, A. A., et al. Nonredundant function of soluble LTalpha3 produced by innate lymphoid cells in intestinal homeostasis. Science. 342, (6163), 1243-1246 (2013).
  14. Wilhelm, J., Pingoud, A., Hahn, M. Real-time PCR-based method for the estimation of genome sizes. Nucleic Acids Research. 31, (10), e56 (2003).
  15. Kembel, S. W., Wu, M., Eisen, J. A., Green, J. L. Incorporating 16S gene copy number information improves estimates of microbial diversity and abundance. PLoS Computational Biology. 8, (10), e1002743 (2012).
  16. Yang, Y. W., et al. Use of 16S rRNA Gene-Targeted Group-Specific Primers for Real-Time PCR Analysis of Predominant Bacteria in Mouse Feces. Applied Environmental Microbiology. 81, (19), 6749-6756 (2015).
구두 항생제 치료 후 Murine 장 Microbiota의 정량적 중 합 효소 연쇄 반응-기반 분석
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Jimeno, R., Brailey, P. M., Barral, P. Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment. J. Vis. Exp. (141), e58481, doi:10.3791/58481 (2018).More

Jimeno, R., Brailey, P. M., Barral, P. Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment. J. Vis. Exp. (141), e58481, doi:10.3791/58481 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter