Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Kvantitativ Polymerase kjedereaksjon-baserte analyser av Murine tarmen bakterieflora etter muntlig antibiotika behandling

doi: 10.3791/58481 Published: November 17, 2018

Summary

Her gir vi detaljert protokoller peroralt antibiotika mus, fecal prøver, DNA utvinning og kvantifisering av fekal bakterier av qPCR.

Abstract

Tarmen bakterieflora har en sentral innflytelse på menneskers helse. Mikrobiell dysbiosis er forbundet med mange vanlige immunopathologies som inflammatorisk tarmsykdom, astma og leddgikt. Dermed er forstå mekanismene bak bakterieflora immunsystem crosstalk avgjørende. Antibiotikumet administrasjon, samtidig hjelpe patogen fortolling, også induserer drastiske endringer i størrelsen og sammensetningen av intestinal bakteriell samfunn som kan ha innvirkning på menneskers helse. Antibiotika behandling i mus viser virkningen og langsiktige endringer i menneskelig bakterieflora fra antibiotika behandlet pasienter, og aktiverer undersøkelse av mekanistisk koblingene mellom endringer i mikrobielle samfunn og immun celle-funksjonen. Mens flere metoder for antibiotikabehandling mus har blitt beskrevet, indusere noen av dem alvorlig dehydrering og vekttap kompliserende tolkningen av dataene. Her gir vi to protokoller peroralt antibiotika som kan brukes for langsiktig behandling av mus uten å indusere store vekttap. Disse protokollene gjør bruk av en kombinasjon av antibiotika som er rettet mot både Gram-positive og Gram-negative bakterier og kan gis enten annonse libitum i drikkevannet eller muntlig gavage. Videre beskriver vi en metode for kvantifisering av mikrobielle i fecal prøver av qPCR som kan brukes til å validere effekten av antibiotika behandling. Kombinasjonen av disse gir en pålitelig metode for manipulering av det tarmen bakterieflora og studier av effekten av antibiotika behandling i mus.

Introduction

Pattedyr mage mucosa er et unikt miljø kolonisert av en svært kompleks blanding av mikroorganismer som etablerer et mutualistic forhold til verten. Forsvar av tarmen består av en epiteliale lag og en overflod av immunceller som begrenser commensals i tarmen samtidig bevare deres antall og mangfold. Derimot er commensal organismer nødvendig for utvikling av et fullt fungerende immunsystem. Mens interaksjoner mellom vert og gram-negative bakterier er normalt gunstig, blir det stadig klarere at dysregulated immunsystem-bakterieflora crosstalk kan favorisere utviklingen av kronisk inflammatorisk sykdommer, slik asinflammatory tarm sykdom, leddgikt eller astma1,2.

Tarmen bakterieflora kan endres av ulike faktorer, men kanskje de mest drastiske endringene er indusert av antibiotika behandling som alvorlig endrer både størrelsen og sammensetningen av bakteriell samfunn3,4. Mens fordelene med antibiotika til å behandle infeksjoner er ubestridelig, kan endres bakterieflora indusert av antibiotika eksponering i mennesker også endre immunforsvar som kan føre til skadelige effekter på helse. For eksempel antibiotika behandling hos mennesker har vært knyttet til økt risiko for Clostridium difficile-indusert diaré, astma og visse typer kreft3. Antibiotika behandling i mus viser virkningen og langsiktige endringer som finnes i tarmen samfunn av antibiotika-behandlede pasienter og aktivert undersøkelse av mekanistisk koblingene mellom endringer i mikrobielle samfunn og immun celle-funksjonen. Men har flere rapporter vist at administrasjon av antibiotika på drikkevann annonse libitum gir veldig merkbar vekttap som mus avstå fra drikkevann, antagelig på grunn av sin foul smak5,6. Dermed i disse modellene kan alvorlig dehydrering samtidig til muntlig antibiotikumet administrasjon komplisere tolkningen av eksperimenter å identifisere effekten av antibiotikabehandling immun celle funksjon.

Flere tilnærminger kan brukes å utforske størrelsen og sammensetningen av mikrobielle samfunn i intestinal seksjon7. Neste generasjons sekvensering teknologi har gitt uvurderlige data på denne saken8, men disse metodene er relativt dyrt og krever ekspert bioinformatic analyser for tolkning av dataene. På den annen side, tradisjonelle mikrobiologisk kultur metoder tillater påvisning av bakteriell arter, men de har lav følsomhet og en stor andel av commensal bakterier (spesielt anaerobes) er svært vanskelig eller umulig å dyrke med tilgjengelige metoder8. Kvantitativ polymerase kjedereaksjon (qPCR) teknikker brukes stadig for kvantifisering og identifikasjon av fecal bakterie-art, som de gir en rask og pålitelig kultur-uavhengig mål på total mikrobiell lasteevne. Følgelig qPCR metoder har vist seg nyttig å studere endringer i bakterieflora tilknyttet alder eller progresjon av flere sykdommer inkludert inflammatorisk tarm sykdom9,10. I tråd med dette gir qPCR metoder en rask og kostnadseffektiv tilnærming for å validere effekten av ulike behandlinger (inkludert antibiotika) i fecal bakteriell laster og bakterieflora komposisjon10,11,12.

Her presenterer vi en detaljert trinnvise redegjørelse for to forskjellige protokoller peroralt antibiotika til mus, fecal eksemplar innsamling, DNA utvinning, utarbeidelse av standarder og måling av bakterier i fecal prøver av qPCR. Disse protokollene gir en pålitelig metode å manipulere den tarmen bakterieflora i mus og studie av virkningene av antibiotika behandling i intestinal homeostase og sykdom.

Protocol

Eksperimenter beskrevet her ble utført med 6-8 ukens gamle vill-type (C57BL6/J) mus vedlikeholdes i en bestemt patogen gratis (SPF) anlegg. Alle dyreforsøk ble godkjent av King's College London og Francis Crick Institute dyr velferd og etiske gjennomgang kroppen og Storbritannia hjemmekontor. Før begynnelsen noen dyr prosedyre, kontroller du at riktige tillatelser er innhentet gjennom den lokal institusjon/organisasjonen.

1. administrasjon av antibiotika

Merk: Finnes to alternative metoder for antibiotikabehandling: muntlig gavage (trinn 1.1) og administrasjon av antibiotika via drikkevann (trinn 1.2).

  1. Muntlige gavage
    1. Forberede bestander av enkelte antibiotika smelte dem i autoklaveres vann på følgende konsentrasjonen: Ampicillin på 100 mg/mL, Gentamicin på 100 mg/mL, Neomycin på 100 mg/mL, Metronidazole på 10 mg/mL og Vancomycin på 100 mg/mL. Filteret sterilisere bruke filtere 0,45 µm. Aliquot og butikk på 20 ° C.
    2. Forberede en cocktail av antibiotika ved å blande aksjer forberedt ovenfor. Et volum på 1 mL blande 50 µL av Ampicillin (5 mg/mL siste), 50 µL av Gentamicin (5 mg/mL siste), 50 µL av Neomycin (5 mg/mL siste), 500 µL av Metronidazole (5 mg/mL siste), 25 µL av Vancomycin (2,5 mg/mL endelige) og 325 µL av vann. Forberede cocktail frisk før bruk.
    3. Legg antibiotika blandingen i en steril 1 mL sprøyte og fastsette en passende måler gavage p (20 G for 15-20 g mus) mens de eliminerer bobler.
    4. Gavage mus med 200 µL av antibiotika.
      1. Ta huden over musen skulderen fast, strekke hodet og halsen å rette spiserøret. Direkte ballen-spissen av fôring nålen langs taket av munnen og mot baksiden av pharynx. Deretter forsiktig passerer den i spiserøret og injisere 200 μL løsningen.
    5. Administrere antibiotika cocktail en gang daglig for varigheten av eksperimentet.
  2. Antibiotika i drikkevannet
    FORSIKTIG: Nøye overvåke musen vekt daglig for de første to ukene av antibiotikumet administrasjon i drikkevannet.
    1. Forberede en cocktail av antibiotika ved å løse opp følgende i 1 L autoklaveres vann: 1 g Ampicillin (1 g/L siste), 1 g Neomycin (1 g/L siste), 1 g Metronidazole (1 g/L siste), 0,5 g Vancomycin (0,5 g/L endelige) og 8 poser (0,75 g hver) med kunstige søtningsmiddel (60 g/L siste). Rist til oppløst. Butikken på 4 ° C.
      Merk: Søtningsmiddel lagt til skjule smaken av antibiotika og hindre mus dehydrering. Mens flere søtningsmiddel merker kan fungere, kan det hende at den siste konsentrasjonen kreves forskjellig for hver bestemt merke.
    2. Fylle antibiotika cocktail i en vannflaske (~ 100 mL/flaske) og flasken på musen bur.
      Merk: Bruk brun flasker eller dekke flasker med folie å beskytte antibiotika mot lyset.
    3. Erstatte antibiotika cocktail med fersk lager to ganger i uken for varigheten av eksperimentet.

2. samling av Fecal prøver fra avføring, Ileum innhold og Ileum vegg

  1. Veier og etikett 2 mL autoklaveres rør for prøvetaking.
  2. For samling av fersk avføringsprøver, plassere hver musen i en restrainer og samle fecal pellets direkte fra anus i en samling rør.
    Merk: Utvalg kan også fås ved å plassere mus i en ren autoklaveres bur, og samle avføringsprøver med ren sterilisert tang.
  3. Euthanize mus med CO2 kvelning etterfulgt av cervical forvridning.
  4. Lå en mus carcass med magen fullt eksponert og spray mageområdet med 70% etanol.
  5. Bruke steriliserte tang og saks, lage en tverrgående snitt i magen til å eksponere peritoneum uten å skade noen interne vev. Løft peritoneum og gjøre et snitt å avsløre tarmen.
  6. Fjern tarmen (fra kolon magen) med tang og saks og plassere den i et sterilt Petriskål.
  7. Forsiktig bruk tang for å erte tynntarmen (SI) fra hvem arterier og fett. Utvide tarmen og plassere den på en ren lab tørke.
  8. Med en linjal, mål og Klipp 4 cm til den distale ileum av SI (den nærmeste delen til cecum). Klipp og forkaste 1 cm av tarmen proksimale til cecum. Det vil være en 3 cm porsjon ileum igjen som vil bli brukt til å samle tarmbakterier.
  9. Hold den ileum delen (3 cm) over en 2 mL steril rør. Samle intestinal innholdet av direkte ekstrudering tarmen og colleting prøven i røret. Dette eksemplet vil ha bakterier fra ileum innhold.
  10. Forberede en 20 mL sprøyte med kaldt fosfat bufret saltvann (PBS) og skyll delen ileum (kast gjennomflytsenhet).
  11. Plasser den ileum delen på en ren papirhåndkle og åpne den langs med saks.
  12. Skrape innsiden av ileum veggen med skalpell.
  13. Samle alle bakterier på skalpell ved å vaske skalpell med 1 mL PBS over en ren sentrifuge rør. Spinne 8000 × g i 5 min pellets bakterier og forkaste nedbryting. Denne prøven vil inneholde bakterier fra ileum veggen.
    Merk: Fecal prøver fra avføring, ileum innhold og veggen kan fryses og lagret ved-80 ° C før bruk.
  14. Veie rør som inneholder prøvene i avføring og ileum innhold og trekke fra vekten fra Tom rør (fra trinn 2.1) for å få fecal vekten i hver prøve.
  15. Pakk ut bakteriell DNA fra avføring, ileum innhold og ileum veggen prøver ved å bruke kommersielt tilgjengelige kits. Lagre DNA-prøver på 20 ° C før bruk.

3. kvantifisering av tarmen bakterieflora av qPCR

Merk: Denne fremgangsmåten omfatter generering av en standard (trinn 3.1) og metode for qPCR oppsett for standard og fecal prøver (trinn 3.2)

  1. Generering av en standard for qPCR
    1. Bruk polymerasekjedereaksjons (PCR) å forsterke 16S rRNA genet fra genomisk DNA Hentet fra en bakteriell kultur reagenser13 og PCR vilkårene detaljert i tabell 1.
    2. Kjøre PCR produktet på en 1,5% agarose gel og rense DNA bandet ved hjelp av en kommersielt tilgjengelig DNA utvinning kit.
    3. Ligate renset DNA fragment ved hjelp av en kloning kit (se Tabell av materialer, bruk en vektor inneholder antibiotikaresistens markører og β-galactosidase (LacZ) genet fusion for blå/hvit kolonien utvalg) og transformere DH10 kompetent E. coli følge instruksjonene fra produsenten. Plate transformasjon på Ampicillin (100 µg/mL), X-gal (20 µg/mL) Luria Bertani (LB) agar plater (10 g/L Tryptone, 5 g/L gjærekstrakt, 10 g/L NaCl, 15 g/L Agar). Ruge over natten (O/N) på 37 ° C.
    4. Velg en enkelt positive (hvit) koloni fra platen. Vaksinere det i 5 mL LB buljong som inneholder 100 µg/mL Ampicillin og ruge O/N på 37 ° C, rister på 250 rpm.
    5. O/N kultur, isolere og rense plasmider ved hjelp av en kommersiell miniprep kit i henhold til produsentens instruksjoner.
      Merk: Det er viktig å sekvens plasmider innsatsen på dette stadiet, til å sikre at plasmider inneholder bare én kopi av 16S rRNA genet og bestemme lengden på base-parene (bp).
    6. Linearize plasmider med en begrensning enzym som skjærer plasmider bare én gang.
    7. Rense linearisert plasmider ved hjelp av en kommersielt tilgjengelig kit.
    8. Bestemme konsentrasjonen av plasmider ved å måle absorbans ved 260 nm bruker et spektrofotometer.
    9. Beregne antall plasmider Kopier/µL av prøve bruk den følgende formelen14:
      antall = (beløp * 6.022 × 1023) / (lengde * 1 × 109 * 650)
      hvor er DNA konsentrasjonen fikk i trinn 3.1.8 (i ng/µL); lengde er den totale lengden på plasmider (med innsatsen) i bp. Antall kopier oppnås som Kopier/µL.
      Merk: Det finnes online verktøy basert på formelen over at beregnes antallet plasmider kopier.
    10. Aliquot og lager standard etter behov på 20 ° C før bruk.
  2. qPCR oppsett for Standard og Fecal prøver
    1. Tine qPCR standard (fra trinn 3.1.10), fecal prøver DNA (fra trinn 2,15) og qPCR reagenser (fra et kommersielt tilgjengelig kit) på is.
      Merk: qPCR reagenser brukes i dette eksemplet er SYBR Green qPCR reaksjonen blanding og forover og bakover grunning (tabell 2).
    2. Fortynne standarden i sterilt DNA-fritt vann i området fra 107 til 102 Kopier/µL (f.eks 1/5 føljetong fortynninger 107 6.4 x 102 Kopier/µL). Fortynne fecal eksemplar DNA til 1/2, 1/5 1/10.
    3. Gjøre en master mix reaksjon for antall reaksjoner pluss 1 (tabell 2).
    4. Mix 30 µL av master mix og 5 µL av malen (standard, prøve eller vann for negativ kontroll)
    5. Legge til 10 µL av denne blandingen i hver brønn i en 384-og optisk qPCR plate. Utføre hver reaksjon i tre eksemplarer.
    6. Forsegle qPCR stedet, sentrifuge kort og laste plate qPCR maskinen programmert med sykling følgende: 95 ° C for 20 min etterfulgt av 40 sykluser av 95 ° C for 15 s og 60 ° C i 1 minutt.
    7. Få CT verdier for standard og eksempler.
    8. Generere en standardkurve ved plotting CT verdiene for standarder versus logaritmen til kopien antall plasmider (som beregnet i trinn 3.1.9). Utføre lineal regresjon av standardkurve.
    9. Beregne 16S rDNA kopi tallene for fecal prøver av interpolering CT verdier (innhentet i trinn 3.2.2) i standardkurven.
      Merk: 16S rDNA kopi tall for hvert utvalg bør korrigeres vurderer fortynningsfaktoren for prøven (som forberedt i trinn 3.2.2), de siste bindet nucleic syrer som var elut (i trinn 2,15) og antallet fecal eksemplar (beregnet i trinn 2.14) å få Gene eksemplarer per gram avføring.

Representative Results

Her tilbyr vi to alternative protokoller av muntlig antibiotika behandling av mus. Figur 1 viser prosentandelen av kroppsvekt (relatert til opprinnelige grunnlinjen vekt for hvert dyr) i mus behandles med antibiotika muntlig gavage (rød) eller i drikkevannet (blå) for 10 dager. Ingen merkbar vekttap er funnet i mus som mottar antibiotika av muntlig gavage. Men når mus behandles med antibiotika annonse libitum i drikkevannet, de miste vekt (~ 10%) i de første dagene av antibiotikumet administrasjon, men gjenopprette normal vekt gevinst etterpå (figur 1). Likevel, rundt 5-10% av mus få antibiotika i drikkevannet kan nå > 20% vekt tap innen den første uken av behandling, i hvilket rettssak de er euthanized.

Kvantifisering av bakterier i fecal prøver krever bruk av en tilstrekkelig standardkurven som oppnås ved å plotte loggen over antall kopier for standard (som beregnet i trinn 3.2.2) versus CT verdiene hentes fra qPCR (trinn 3.2.7). Figur 2A viser et representativt eksempel fra en standardkurven som oppfyller standardkurve ytelseskriterier med R2 verdien 0.99827, en skråning på-3.09 og en effektivitet ((-1 + 10^(-1/slope))*100) på 110%. R2 verdiene 0,99 og PCR effektivitet innenfor området 90 til 110% er å foretrekke. Lineær serien kan analyse regresjonsligningen kvantifisering av 16S rDNA overflod i fecal prøvene. Figur 2B viser antall 16S rDNA eksemplarer i fecal krakk, SI innhold og SI veggen. I figur 2B vises data som 16S rDNA Kopier/g av fecal eksemplar for fecal krakk og SI innhold. For SI vegg presenteres dataene som antall 16S rDNA eksemplarer innhentet fra bakterier utvinnes fra 3 cm av SI (som antall starter materiale er for liten til å få en nøyaktig vekt).

For å evaluere effekten av antibiotika på tettheten av bakterier i fecal prøver, mus ble behandlet med antibiotika av muntlig gavage daglig for 10 dager (1 til 10 dager) og avføringsprøver ble samlet før (dag 0), på forskjellige tidspunkt under antibiotikabehandling ( dager 5 og 10), og 7 dager etter avsluttet antibiotikumet administrasjon (dag 17; Figur 3A). Som vist i figur 3B, induserer antibiotikabehandling en kraftig nedgang i antall 16S rDNA Kopier/g av avføring oppdaget dager 5 og 10, mens tettheten av bakterier i avføringen gjenopprettet normale nivåer (sammenlignes forbehandling) 1 uke etter antibiotikumet administrasjon ble stoppet (dag 17).

Figure 1
Figur 1: administrasjon av antibiotika. Mus fikk antibiotika muntlig gavage (rød) eller i drikkevannet (blå) for 10 dager. Plottet viser vekter mus gjennom hele eksperimenter i forhold til opprinnelige vekt før antibiotikumet administrasjon (dag 0). Dataene vises som gjennomsnittlig ± SEM. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: 16S rRNA genet qPCR forsterkning av standarder og fecal prøver. (A) lineær regresjon av standardkurve med standardkurve beskrivelser. (B) beregning av genet krillens fra fecal prøver. Dataene vises som gjennomsnittlig ± SEM. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: fekal bakterier under antibiotikabehandling. (A) skjematisk av tidsplanen for antibiotikumet administrasjon av oral gavage (Ab) og prøvetaking avbildet med *. (B) 16S rDNA kopierer pr. gram av avføring i avføringsprøver fra mus samlet på de angitte dagene. Dataene vises som gjennomsnittlig ± SEM. Klikk her for å se en større versjon av dette tallet.

Reagens Volum
DNA 8 ΜL
Bufre 10 X 2 ΜL
dNTPs (10mM) 0,4 ΜL
Eubacteria - F primer (10 mM) 1 ΜL
Eubacteria - R primer (10 mM) 1 ΜL
Taq Polimerase 0,2 ΜL
H2O 7.4 ΜL
Totalt volum 20 ΜL
Primer sekvenser
Eubacteria - F primer 5' ACTCCTACGGGAGGCAGCAGT 3
Eubacteria - R primer 5' ATTACCGCGGCTGCTGGC 3
Sykling forhold
Temperatur Tid Sykluser
94 ° C 5 min 1 x
94 ° C 30 s 30 x
60 ° C 30 s 30 x
72 ° C 1 min 30 x
72 ° C 5 min 1 x
4 ° C 1 x

Tabell 1: PCR reagenser og betingelser. Denne tabellen inneholder reagenser og PCR sykling forhold å forsterke 16S rRNA genet fra bakteriell kultur for generering av en standard bruke i qPCR-analyser. Primer sekvenser ble opprinnelig publisert av Kruglov et al. 13.

Reagens Volum
SYBR grønn master mix (2 x) 17.5 ΜL
Eubacteria - F primer (10 mM) 0,7 ΜL
Eubacteria - R primer (10 mM) 0,7 ΜL
H2O 11,1 ΜL

Tabell 2: qPCR master mix. Volumene vises (siste bindet 35 µL) er et enkelt eksempel kjøres på tre eksemplarer (10 µL hver) på en 384-vel qPCR plate (regnskap for 5 µL ekstra for pipettering feil). Beløpet kan skaleres av antall eksempler som skal analyseres.

Discussion

Her gir vi eksperimentell protokoller peroralt antibiotika til mus og kvantifisering av fekal bakterier av qPCR. Kombinasjonen av antibiotika brukt i denne protokollen (inneholder ampicillin, gentamicin, neomycin, metronidazole og vancomycin) mål både Gram-positive og Gram-negative bakterier, tilbyr bakteriedrepende aktivitet mot et fullt spekter av bakterier. Både muntlig gavage og administrasjon av antibiotika i drikkevannet sterkt redusere fecal bakteriell laste5,6,12. Videre har begge behandlinger en dyp effekt på fenotypen av musene som de utvikler flere egenskaper som er typiske for bakterie-fri mus inkludert redusert milt størrelse og forstørret cecum. Valg av en bestemt metode for antibiotikumet administrasjon kan muligens avhenger på lengden på eksperimentet som muntlig gavage metoden krever daglig administrasjon av antibiotika, blir mer arbeidskrevende og muligens forårsaker mer ubehag til den dyr i det lange løp.

For administrasjon av antibiotika i drikkevannet, må forsiktighet tas med tillegg av søtningsmiddel til antibiotika blanding som dette er en avgjørende faktor for å holde mus fra dehydrering. Flere grupper har vist hvordan administrasjon av antibiotika i drikkevann (uten tillegg av søtningsmiddel) fører til svært alvorlig og raske vekttap med alle mus mister mer enn 20% av første kroppsvekt i de første dagene av eksperiment5 , 6. i våre protokollen, bruk av saccharine-baserte søtningsmiddel syntes å være tilstrekkelig til å maskere antibiotika smaken i vannet og mus mistet vekt i de første dagene etter antibiotikumet administrasjon, men utvinnes deres vekt raskt etter at ( Figur 1). Likevel, i vårt forsøk 5-10% av mus fortsatt nå menneskelige slutten-punktet i > 20% tap av planlagte kroppen vekt og måtte være euthanized. Vi har testet Sukralose-baserte søtningsmidler som mislyktes i å hindre mus dehydrering (100% av mus mistet > 20% vekt) mens andre forfattere har publisert lignende feil i aspartam-baserte søtningsmidler5,6. I tillegg til dette, bør alder, genetisk bakgrunn og generell helsestatus musene som brukes for eksperimenter vurderes, som de kan påvirke vekttap og dyr velvære under antibiotikabehandling. Derfor skal nøye overvåking av mus vekt og generelle helsetilstand utføres daglig under de to første ukene av muntlig antibiotikumet administrasjon.

qPCR metoder gir en rask og kostnadseffektiv tilnærming for kvantifisering av 16S rRNA i fecal prøver. Imidlertid noen begrensninger bør vurderes om denne teknikken inkludert: jeg) behovet for en pålitelig høy kvalitet standard; II) design og effektiviteten av qPCR primerne; III) det faktum at mikroorganismer kan ha forskjellige kopi antall 16S rRNA genet, dermed genet kopier kan ikke direkte lik celle teller15. Likevel, qPCR er en robust og sensitive metode som muliggjør rask analyse av fecal eksemplar. Denne metoden kan være spesielt nyttig å validere raskt effekten av ulike behandlinger (inkludert antibiotika) i fecal bakteriell laster som beskrevet her. Videre, selv om vi gir en protokoll for kvantifisering av totale . 16S rRNA, denne metoden kan lett tilpasses (ved å utforme spesifikke primere16) identifisere individuelle bakteriell taxa, altså både kvantitative og kvalitativ informasjon om microbiome størrelse og sammensetning.

I sammendraget, har vi gitt to protokoller for oral antibiotika behandling av mus og en qPCR-basert metode å kvantifisere antibiotika-induserte endringer i fekal bakterier. Selv om disse protokollene kan ytterligere optimalisert og kombinert med andre tilnærminger til egne eksperimentelle behov, kan de tjene som rask, kostnadseffektiv og pålitelig verktøy for å manipulere den murine tarmen bakterieflora og studie av virkningene antibiotika behandling i intestinal homeostase og sykdom.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Dette arbeidet ble finansiert av den britiske Medical Research Council (grant P.B. MR/L008157/1); R.J. ble støttet av et Marie Curie Intra-European fellesskap (H2020-MSCA-hvis-2015-703639); P.M.B. ble støttet av en studentship fra den britiske Medical Research Council og King's College London doktorgrad trening partnerskap innen biomedisinsk vitenskap (MR/N013700/1).

Materials

Name Company Catalog Number Comments
Ampicillin sodium salt Sigma-Aldrich (Merck) A9518
Neomycnin trisulfate salt hydrate Sigma-Aldrich (Merck) N1876
Metronidazole Sigma-Aldrich (Merck) M3761
Vancomycin hydrochloride Sigma-Aldrich (Merck) V2002
Gentamicin sulfate salt Sigma-Aldrich (Merck) G3632
Tryptone Sigma-Aldrich (Merck) T7293
Yeast Extract Sigma-Aldrich (Merck) Y1625
NaCL Sigma-Aldrich (Merck) S7653
Sweetener Sweet'n Low Sweet'N Low Available in the UK from Amazon.co.uk
X-Gal (5-brom-4-chloro-3-indoyl B-D-galactopyranoside) Fisher scientific 10234923
Phosphate Buffered Saline  Thermo Fisher Scientific (Gibco) 10010023
Ultrapure Agarose Thermo Fisher Scientific (Invitrogen) 16500500
RT-PCR grade water Thermo Fisher Scientific (Invitrogen) AM9935
Phusion High-Fidelity DNA Polymerase New England BioLabs M0530
Deoxynucleotide (dNTP) Solution Mix New England BioLabs N0447
iTaq Universal SYBR Green Supermix Bio-Rad 1725124 with ROX
TOPO TA cloningTM for sequencing Thermo Fisher Scientific (Invitrogen) 450030
QIAamp fast DNA Stool mini kit  Qiagen 51604
QIAprep spin Miniprep kit Qiagen 27106
QIAquick gel  extraction kit Qiagen 28704
Syringe filter 0.45 µm Fisher scientific 10460031
Swann-MortonTM Carbon steel sterile scalpel blades Fisher scientific 11792724
Syringe (1 mL) BD Plastipak 303172
Syringe (20 mL) BD Plastipak 300613
1.5 mL Crystal clear microcentriguge tube StarLab E1415-1500
2 mL Ultra high recovery microcentrifuge tube StarLab I1420-2600
Oral dosing needles 20 G x 38 mm curved (pk/3) Vet-Tech DE008A
Sterilin petri dish 50 mm  Scientific Laboratory Supplies PET2020
Absolute qPCR plate seals Thermo Fisher Scientific AB1170
MicroAmpTM optical 384-well plate  Thermo Fisher Scientific (Applied Biosystems) 4309849
ViiA7TM 7 real-time PCR system with 384-well block Thermo Fisher Scientific (Applied Biosystems) 4453536
Spectrophotometer (Nanodrop 1000) Thermo Fisher Scientific ND-1000
Labnet Prism microcentrifuge Labnet C2500
MultiGene Optimax Thermal cycler Labnet TC9610

DOWNLOAD MATERIALS LIST

References

  1. Belkaid, Y., Hand, T. W. Role of the microbiota in immunity and inflammation. Cell. 157, (1), 121-141 (2014).
  2. Hooper, L. V., Littman, D. R., Macpherson, A. J. Interactions between the microbiota and the immune system. Science. 336, (6086), 1268-1273 (2012).
  3. Ubeda, C., Pamer, E. G. Antibiotics, microbiota, and immune defense. Trends in Immunology. 33, (9), 459-466 (2012).
  4. Dethlefsen, L., Huse, S., Sogin, M. L., Relman, D. A. The pervasive effects of an antibiotic on the human gut microbiota, as revealed by deep 16S rRNA sequencing. PLoS Biology. 6, (11), e280 (2008).
  5. Reikvam, D. H., et al. Depletion of murine intestinal microbiota: effects on gut mucosa and epithelial gene expression. PLoS One. 6, (3), e17996 (2011).
  6. Hill, D. A., et al. Metagenomic analyses reveal antibiotic-induced temporal and spatial changes in intestinal microbiota with associated alterations in immune cell homeostasis. Mucosal Immunology. 3, (2), 148-158 (2010).
  7. Fraher, M. H., O'Toole, P. W., Quigley, E. M. Techniques used to characterize the gut microbiota: a guide for the clinician. Nature Reviews Gastroenterology & Hepatology. 9, (6), 312-322 (2012).
  8. Eckburg, P. B., et al. Diversity of the human intestinal microbial flora. Science. 308, (5728), 1635-1638 (2005).
  9. Sokol, H., et al. Low counts of Fecalibacterium prausnitzii in colitis microbiota. Inflammatiry Bowel Diseases. 15, (8), 1183-1189 (2009).
  10. Bartosch, S., Fite, A., Macfarlane, G. T., McMurdo, M. E. Characterization of bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbiota. Applied Environmental Microbiology. 70, (6), 3575-3581 (2004).
  11. Ubeda, C., et al. Vancomycin-resistant Enterococcus domination of intestinal microbiota is enabled by antibiotic treatment in mice and precedes bloodstream invasion in humans. Journal of Clinical Investigation. 120, (12), 4332-4341 (2010).
  12. Saez de Guinoa, J., et al. CD1d-mediated lipid presentation by CD11c(+) cells regulates intestinal homeostasis. EMBO Journal. 37, (5), (2018).
  13. Kruglov, A. A., et al. Nonredundant function of soluble LTalpha3 produced by innate lymphoid cells in intestinal homeostasis. Science. 342, (6163), 1243-1246 (2013).
  14. Wilhelm, J., Pingoud, A., Hahn, M. Real-time PCR-based method for the estimation of genome sizes. Nucleic Acids Research. 31, (10), e56 (2003).
  15. Kembel, S. W., Wu, M., Eisen, J. A., Green, J. L. Incorporating 16S gene copy number information improves estimates of microbial diversity and abundance. PLoS Computational Biology. 8, (10), e1002743 (2012).
  16. Yang, Y. W., et al. Use of 16S rRNA Gene-Targeted Group-Specific Primers for Real-Time PCR Analysis of Predominant Bacteria in Mouse Feces. Applied Environmental Microbiology. 81, (19), 6749-6756 (2015).
Kvantitativ Polymerase kjedereaksjon-baserte analyser av Murine tarmen bakterieflora etter muntlig antibiotika behandling
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Jimeno, R., Brailey, P. M., Barral, P. Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment. J. Vis. Exp. (141), e58481, doi:10.3791/58481 (2018).More

Jimeno, R., Brailey, P. M., Barral, P. Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment. J. Vis. Exp. (141), e58481, doi:10.3791/58481 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter