Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Kvasi-metagenomic analyse af Salmonella fra mad og miljøprøver

doi: 10.3791/58612 Published: October 25, 2018

Summary

Vi præsenterer her, en protokol for at forberede samordnet registrerings- og subtyping af Salmonella gennem quasimetagenomic sekventering DNA-prøver fra mad og miljø microbiomes. Den kombinerede brug af kultur berigelse, immunomagnetic adskillelse (IMS) og flere forskydning forstærkning (MDA) giver mulighed for effektiv koncentration af Salmonella genomisk DNA fra mad og miljøprøver.

Abstract

Quasi-metagenomics sekventering refererer til sekvensering-baseret analyse af modificerede microbiomes af levnedsmidler og miljøprøver. I denne protokol, er microbiome ændring designet til at koncentrere genomisk DNA af target fødevarebårne patogen forurenende stof at lette påvisning og subtyping af patogenet i en enkelt arbejdsgang. Her, vi forklare og demonstrere prøve forberedelsestrin for kvasi-metagenomics analyse af Salmonella enterica fra repræsentative levnedsmidler og miljøprøver herunder lucernespirer, jorden sort peber, hakket oksekød, kylling bryst og miljømæssige svaberprøver. Prøver underkastes først kultur berigelse af Salmonella for en forkortet og justerbar varighed (4-24 h). Salmonella celler er derefter selektivt fanget fra berigelse kultur af immunomagnetic adskillelse (IMS). Endelig er flere forskydning forstærkning (MDA) udført for at forstærke DNA fra IMS-fanget celler. DNA output af denne protokol kan blive sekventeret af høj overførselshastighed sekventering platforme. En valgfri kvantitativ PCR analyse kan udføres for at erstatte sekventering for Salmonella påvisning eller vurdere koncentrationen af Salmonella DNA før sekvensering.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Metagenomics sekventering teoretisk tillader samordnet registrerings- og subtyping af fødevarebårne patogener. Dog nuværende fødevareprøver udfordringer til patogen analyse af direkte sekventering af mad microbiome. Først, fødevarebårne patogener er ofte til stede på et lavt niveau i fødevareprøver. De fleste af de kommercielt tilgængelige hurtig påvisningsmetoder stadig kræver 8-48 h dyrkning for at berige patogen celler til en påviselig niveau1. For det andet, mange fødevarer indeholder rigelige mikroflora celler og/eller mad DNA, gør fødevarebårne patogen DNA en lille brøkdel af mad metagenome og et undvigende mål for registrerings- og subtyping ved direkte metagenomic sekvensering.

Ændring af fødevarer microbiomes er blevet rapporteret at tillade betydelig koncentration af fødevarebårne patogen DNA til at lette sekvenseringen-baseret detektion af Shiga toksin-producerende Escherichia coli2,3 og Salmonella enterica4. Fordi modificerede fødevarer microbiomes er stadig blandinger af forskellige mikrobielle arter, deres sekventering, der betegnes som quasi-metagenomic analyse4. Microbiome ændring kan udføres af kultur berigelse alene2,3 eller i kombination med immunomagnetic adskillelse (IMS) og flere forskydning forstærkning (MDA)4,5. IMS kan selektivt fange patogen celler fra berigelse kultur via antistof-magnetiske perler. MDA kan generere tilstrækkelige mængder af genomisk DNA til sekvensering gennem højeffektive ɸ29 DNA polymerase6. IMS-MDA har tilladt kultur-uafhængig patogen detektion fra kliniske prøver7, og afkortning af kultur berigelse for registrering af kvasi-metagenomic og subtyping af Salmonella i levnedsmidler prøver4.

Det overordnede mål med denne metode er at forberede kvasi-metagenomic DNA fra fødevareprøver tillade målrettede koncentration af Salmonella genomisk DNA og efterfølgende registrering og subtyping af Salmonella forurenende af sekventering. I forhold til standard metoder for Salmonella påvisning8,9 og subtyping10, kan quasimetagenomic tilgang betydeligt forkorte ekspeditionstid fra kontaminerede levnedsmidler og miljøprøver til molekylære undertyper af patogenet af forene to typisk opdelt analyser i en enkelt arbejdsgang. Denne metode er særlig nyttig til applikationer såsom fødevarebårne udbrud svar og andre spor tilbage undersøgelser hvor robust patogen subtyping kræves ud over patogen detektion og hurtig analytiske turnaround er vigtigt.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Prøvetilberedning

Bemærk: Fødevareprøver er forberedt til pre berigelse ifølge Mikrobiologi laboratorium guidebog (MLG) af amerikanske Institut for landbrug fødevaresikkerhed og Inspection Service (USDA-stor)11 og bakteriologiske analytical manual (BAM) af amerikanske fødevarer og Drug Administration (FDA)12.

  1. Aseptisk placere en 25 g del af fødevarer prøve såsom sort peber, kyllingebryst, hakket oksekød, og lucernespirer eller en miljømæssig vatpind i et sterilt laboratorium blender taske med et indbygget filter. Forberede en miljømæssig svaber af aseptisk fugtning en svamp med berigelsesbouillon (Rappaport-Vassiliadis, RV). Derefter, træk podepinden over hele overfladen eller forudbestemt område og læg det i et laboratorium blender taske.

Figure 1
Figur 1: repræsentative levnedsmidler og miljøprøver til kvasi-metagenomics registrering og subtyping af Salmonella. Prøverne er placeret i sterile filterposer blenderen sammen med RV bouillon. Venligst klik her for at se en større version af dette tal.

  1. Blandes grundigt hver 25 g prøve med 225 mL af RV berigelse bouillon ved hjælp af et laboratorium blender eller hånd massage for 30 s.
    Bemærk: Varianter af RV bouillon som anbefalet af MLG og BAM kan anvendes alt efter prøven typer.
  2. Inkuber prøve-berigelse bouillon blandingen i et laboratorium inkubator ved 42 ° C til 4 – 24 h.
  3. Efter inkubationen indsamle en 50 mL delprøve berigelsesbouillon fra den filtrerede side taske i en separat 50 mL-centrifugerør.
  4. Der centrifugeres tube på 100 x g i 10 min. til at fjerne fast snavs i homogenatet.
  5. Genskab supernatanten omhyggeligt for at en ny 50 mL centrifugeres tube og centrifugeres rør på 3.000-6.000 x g i 10 min. til at inddrive celle pellet.
  6. (Valgfrit) Supernatanten og vaske pelleten af resuspension i 5 mL af Buffered pepton vand (BPW) og centrifugeres rør på 3.000-6.000 × g i 10 min.
    Bemærk: BPW kan forberedes ved opløsning 10 g af pepton, 5 g natriumchlorid, 3.5 g af dinatrium fosfat, og 1,5 g af monokaliumphosphat fosfat til 1 L med destilleret vand. Den endelige pH skal justeres til 7,2 ± 0,2 ved 25 ° C. Autoklavering ved 121 ° c i 15 min. kommercielt tilgængelige BPW kan også bruges.
  7. Kassér supernatanten og genopslæmmes pellet i 5 mL BPW.

2. Immunomagnetic adskillelse (IMS) og flere forskydning forstærkning (MDA)

Bemærk: For at undgå krydskontaminering mellem prøver, arbejde i et kabinet biosikkerhed, ændre pipette tips for hver tube, undgå at berøre røret med pipetten og Placer ikke rør tæt sammen i magnetiske stå under trinnet vask.

  1. Optø prøvebuffer og reaktion bufferen fra MDA kit på is eller ved 4 ° C på forhånd.
  2. Mix 1 mL af re suspenderede celle pellet i BPW med 20 μL af anti -Salmonella perler i 1,5 mL microcentrifuge rør og placere den på den roterende mixer i 30 min. ved stuetemperatur.
    Bemærk: Konkurrencedygtige flora, fedt partikler og proteiner i den resuspenderede pellet kan interferere med IMS. Fortynding af re suspenderede celle pellet i BPW er nyttigt at reducere tabet af perle -Salmonella komplekser fra den magnetiske stå under vask trin.
  3. Indsæt rør i den magnetiske stå og tillade 3 min for en korrekt genvinding af perler af invertere rack flere gange at koncentrere perlerne i en pellet på siden af røret.
  4. Hold rørene på den magnetiske stand. Opsug og supernatanten fra hver tube, samt den resterende væske i hver tube cap.
    Bemærk: Pas på ikke at forstyrre pellet af IMS perler på sidevæg af røret mod magneten.
  5. Fjern tube indehaveren fra den magnetiske stå og tilsættes 1 mL af vaskebuffer (PBS indeholdende 0,05% (v/v) Polysorbat 20) og invertere flere gange for at fjerne ikke-specifikt bindende bakterier fra komplekset.
  6. Gentag trin 2,3-2,5 to gange.
  7. Efter 3rd vask, skal du udføre den endelige magnetisk separation af perler ved at gentage trin 2.3-2.4. Fjerne rør fra magnetiske rack og placere dem i en mikrofuge for 1 s til spin ned perler. Placer derefter, rør i den magnetiske rack for 3 min før du fjerner alle resterende wash buffer.
  8. Genopslæmmes perle -Salmonella komplekser i 9 μL af prøvebuffer og inkuberes ved 95 ° C i 3 min til denaturering.
  9. Efter afkøling til 4 ° C på is, kombinere med 9 μL reaktion buffer plus 1 μL af enzymet mix og holde på is.
  10. I en termisk cycler, Ruger rør ved 30 ° C i 2 timer til forstærkning, efterfulgt af varme ved 65 ° C i 10 min for at inaktivere enzym- og cool at 4 ° C på is.
  11. Vurdere mængden og kvaliteten af produkterne, MDA ved måling af DNA koncentration og renhed (260/280 ratio > 1,8) på et fluorospectrometer instrument.
    Bemærk: På grund af ikke-specifik binding af IMS perler, genomisk DNA fra organismer end Salmonella er tilbøjelige til at være til stede i MDA produkter, men det påvirker ikke downstream analyse.
  12. Gemme de færdige produkter (20 μL) ved-20 ° C indtil brug for real-time PCR og/eller bibliotek forberedelse til quasimetagenomics sekvensering.

3. real-Time PCR

Bemærk: Dette trin er valgfrit til 1) påvisning af Salmonella uden subtyping, og 2) vurdering af stikprøve kvalitet før quasimetagenomics sekvensering.

  1. Forberede 18 μL af PCR blanding pr. prøve, der indeholder universelle PCR Master Mix (10 μL), videresende primer (2 μl, 900 nM), vende primer (2 μl, 900 nM), sonde (2 μl, 250 nM), og vand af Molekylær renhed (2 μl).
    Bemærk: Salmonella-specifikke oligonukleotid primere (frem: CTCACCAGGAGATTACAACATGG, omvendt: AGCTCAGACCAAAAGTGACCATC) og sonde var designet til at forstærke en 94-bp sekvens i ttr genet (GenBank tiltrædelse nr. AF 282268)13.
  2. Bland MDA produkt fra trin 2.12 ved forsigtigt pipettering op og ned perle -Salmonella komplekser sammen med væske til at oprette en suspension. Tilføj 2 μl af suspension i 18 μL af PCR blanding.
  3. Køre real-time PCR ved hjælp af en optimeret real-time PCR-protokol, angive to bedrift perioder, en ved 50 ° C i 2 min. og en anden ved 95 ° C i 10 min, efterfulgt af 40 cyklusser af 95 ° C til 15 s og 60 ° C i 60 s.
  4. Beregne den tærskel cyklus (Ct), som er antallet af cyklusser kræves til fluorescens fra amplificerede DNA til at krydse linjen tærskel.
    Bemærk: Linjen tærskel er angivet i den lineære fase mellem base line og plateau af forstærkning parceller af prøver. Negative resultater svarer til Ct værdier over 40 eller prøver med Ct værdier højere end negativ kontrol.

4. biblioteket forberedelse til Quasimetagenomic sekventering

Bemærk: MDA produkter kan blive sekventeret af både korte læse og lange læse (nanopore) sekventering platforme. Brug den nyeste version af DNA bibliotek prep kits leveres af fabrikanter af sekventering platforme. Udføre DNA bibliotek forberedelse ifølge fabrikanternes instruktion. Brug 2D pesticidanvendelse genomisk DNA protokollen for biblioteket forberedelse for længe-Læs sekventering platform5. Til biblioteket som forberedelse til den korte-Læs sekventering platform, er mindre ændringer til producentens protokollen angivet nedenfor.

  1. Følg standard biblioteket præparationsmetoder ved at tilføje buffer løsninger og reagenser til MDA produkter. 40 μL af sekventering prepped MDA produkter overføres til en ny plade og tilsættes 20 μL PCR rensning perler til hver brønd.
  2. Inkuber plade ved stuetemperatur i 10 min uden at ryste.
  3. Vask perler med 80% ethanol og tør perler i 12 min.
  4. Genopslæmmes tørrede perler i 53 μL af resuspension buffer og inkuberes i 2 min. uden rystelser.
  5. Fortyndes og pool biblioteker efter fabrikantens anvisninger.
    Bemærk: En 10 pM samles og denatureret bibliotek er nu klar til at blive sekventeret.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Før quasimetagenomic sekventering vurderes den samlede mængde og renhed af IMS-MDA produkter af fluorospectrometer (tabel 1).

Berigelse tid (h) CT værdi Koncentration (ng/ul) Renhed (260/280)
Mærke A 4 24.71 812.91 1.89
8 25.80 900.36 1,87
12 15.41 753.88 1,84
Brand B 4 20.63 872.61 1,87
8 22.61 993.41 1,87
12 19.08 954.44 1,87

Tabel 1: kvalitativ og kvantitativ vurdering af DNA prøver til kvasi-metagenomic sekvensering. Salmonella celler blev vaccineret i 25 g rå kyllingebryst af to mærker på 1 CFU/g. Inoculated prøver blev beriget i RV for 4, 8 og 12 timer før IMS-MDA.

Målrettet mængde vurdering af Salmonella DNA kan udføres af real-time PCR (tabel 1 og figur 2), som fungerer også som et alternativ til registrering af Salmonella , hvis subtyping ikke er nødvendig.

Figure 2
Figur 2: Real-time PCR for Salmonella påvisning eller prøve vurdering til kvasi-metagenomics sekvensering. Forstærkning kurver af real-time PCR af Salmonella DNA i IMS-MDA produkter efter 4, 8 og 12 h berigelse tid er vist. En prøve efter kun 2 h berigelse er også inkluderet. Salmonella celler (0,27 CFU/g) blev podet 25 g rå kyllingebryst fra to brands A og B. venligst klik her for at se en større version af dette tal.

Fluorospectrometer aflæsninger muliggøre indledende evaluering til forberedelse af prøven. Koncentration af IMS-MDA produkter fremstillet af Salmonella forurenet kyllingebryst prøver varierede fra 701.54 til 945.86 ng/µL, hvilket tyder på at prøve DNA er blevet forstærket. Ifølge fabrikantens vejledning er den mindste DNA prøve koncentration for korte læse og lange Læs sekventering 0,2 ng/µL og 1 µg, henholdsvis. 260/280 forholdet varierede fra 1,85 til 1,88 (tabel 1), viser høj renhed af DNA-prøver med lavt indhold af protein forurening.

Lavere Ct værdier indikerer højere koncentrationer af Salmonella genomisk DNA i prøven. Som vist i tabel 1 og figur 2, mindske Ct værdier af IMS-MDA produkter som berigelse tid stigninger. I vores tidligere undersøgelse4, når Ct værdier var lavere end 25, fleste (> 50%) af Se-selskabet genom var tilbøjelige til at blive sekventeret, og serotype forudsigelse fra rå sekventering læser var vellykket.

Mislykket kultur berigelse eller IMS kan resultere i en relativt høj Ct værdier der angiver lav koncentration af Salmonella genomisk DNA i den endelige stikprøve, som vist i figur 2. Dette kan ske trods en høj DNA koncentration og renhed af IMS-MDA produkter som foreslået af fluorospectrometer aflæsninger.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

På grund af den ofte-lav overflod og i homogen forekomst af Salmonella i levnedsmidler og miljøprøver, kultur berigelse før IMS-MDA er stadig nødvendige for Salmonella registrerings- og subtyping; Det er derfor et afgørende skridt i protokollen. For at identificere optimale betingelser for at øge overfloden af Salmonella i forhold til prøven baggrund flora, kan forskellige berigelse medier vurderes for specifikke prøver. MLG og BAM, kan både selektivt medie såsom RV bouillon og ikke-selektivt medie såsom bufferet pepton vand og laktose bouillon bruges til Salmonella berigelse fra fødevareprøver. Brug af RV på 42 ° C er blevet evalueret i vores tidligere undersøgelse4 for Salmonella berigelse fra rå kyllingekød, icebergsalat og sorte peberkorn til støtte for quasimetagenomic analyse af patogenet. Ifølge FDA BAM og AOAC precollaborative8,9og metodeafprøvninger14,15anbefales RV til analyse af høj mikrobiel og lav mikrobielle belastning fødevarer.

Den optimale varighed af kultur berigelse afhænger af flere faktorer, såsom prøvetype, Salmonella forureningsniveau og Salmonella forurenende fysiologiske tilstand. For eksempel, når lave niveauer af Salmonella (f.eks.< 1 CFU/g) celler er til stede i en kød prøve og under køle stress, længere berigelse tid (fx, > 12 h) kan være nødvendigt at genoplive og berige Salmonella celler. Tilstrækkelig overflod af Salmonella i den modificerede microbiome fører til passende sekventering dækning af Salmonella forurenende genom, som kan tillade belastningsniveauet enkelt nukleotid polymorfisme (SNP) at skrive4. Kortere kultur berigelse (f.eks. mindre end 12 h) er muligt for hurtig påvisning5 eller serotypning af Salmonella4.

Højere niveauer af Salmonella forurening og/eller længere kultur berigelse af forurenede fødevareprøver kan resultere i højere koncentrationer af Salmonella genomisk DNA i modificerede fødevarer microbiomes, som fører til lavere Ct værdier fra de Real-time PCR analyse. CT værdier viser en negativ sammenhæng med sekventering dækning af Salmonella forurenende genom4, og derfor kan anvendes til optimering og ændring af arbejdsprocessen. Ifølge vores erfaring er kultur berigelse, især længden af det, ofte i fokus i fejlfinding bestræbelser. For eksempel, var Ct værdien af IMS-MDA produkt fra en rå kylling bryst prøve relativt højt på 35.94 (figur 1). Denne prøve blev podet med 2,5 CFU/g af SE celler og inkuberes i BPW ved 37 ° C i 2 h. sekventering af denne prøve ikke giver tilstrækkelig dækning af det SE genom tillade serotype forudsigelse. I sammenligning, var alle de andre prøver med 4 h eller længere berigelse med held serotyped fra quasimetagenomic sequencing data (data ikke vist).

Efter sekvensering anbefaler vi brug af Kraken16 for at identificere Salmonella læser for yderligere Bioinformatik analyser. CFSAN SNP pipeline17 og SeqSero18 kan bruges til SNP maskinskrivning og serotypning forudsigelse fra rå sekventering læser, henholdsvis.

Denne quasimetagenomic teknik har flere begrænsninger. Først, DNA koncentration og renhed af IMS-MDA produkter målt ved en fluorospectrometer bør anvendes kun som en foreløbig indikator for ordentlig prøveforberedelse. På grund af den høje effektivitet af MDA, kan spormængder af input DNA blive forstærket til tilstrækkeligt hele genome sequencing19. Høj kvalitet og mængde DNA-prøver kan derfor stadig blive genereret, selvom kultur berigelse eller IMS mislykkes effektivt koncentrere Salmonella celler. Den valgfri real-time PCR-analyse giver en mere målrettet og informative vurdering af hele prøven forberedelse arbejdsproces. Andet, vanskeligt at kultur Salmonella celler, såsom levedygtige men nonculturable (VBNC) bakterier20, kan ikke vokse under kultur berigelse. Derfor, disse celler kan ikke være opdaget af vores metode.

I Resumé, sammenlignet med traditionelle metoder, vores prøve forberedelse metode og kvasi-metogenomic sekventering tilgang kan give væsentlig reduktion af den analytiske turnaround fra Salmonella-forurenet mad og miljøprøver til robust subtyping af Salmonella forurenende stoffer. Ud over Salmonellahar denne teknik potentialet blive anvendt til hurtig og samordnet registrerings- og subtyping andre fødevarebårne patogener.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer, at de har ingen konkurrerende finansielle interesser.

Acknowledgments

Forfatterne vil gerne takke Mark Harrison og Gwen Hirsch af University of Georgia venligst give den bakterielle stamme og anden støtte til denne undersøgelse.

Materials

Name Company Catalog Number Comments
Laboratory blender bag w/filter VWR 10048-886
Buffered peptone water Oxoid Micorbiology Products CM0509
Rappaport Vassiliadis broth Neogen Acumedia 7730A
Polysorbate 20  Millipore Sigma P9416 Tween 20
Stomacher blender Seward  30010108
Centrifuge Fisher Scientific 75005194
50 mL Centrifuge tubes Fisher Scientific 05-539-6
Thermal Cycler Techne Prime EW-93945-13
StepOne Real-Time Thermal cycler Applied Biosystems 4.76357
AMPure XP beads Beckman Coulter A63881 PCR purification beads; mix well before use; store at 4 °C
Nextera XT library prep kit Illumina FC-131-1024 Store at -80 °C
MinIon library prep kit Oxford Nanopore SQK-LSK108 Store at -80 °C
NanoDrop Thermo Scientific ND-2000
Dynabead Anti-Salmonella beads Applied Biosystems 71002 Vortex well prior to use
Illustra GenomiPhi V2 DNA amplification kit (MDA kit)
-Sample buffer
-Reaction buffer
-Enzyme mix
GE Healthcare 25-6600-30 Store at -80 °C
HulaMixer Invitrogen 15920D
DynaMag magnetic rack Invitrogen 12321D
TaqMan Universal PCR mastermix Applied Biosystems 4304437 Mix well before use; store at 4 °C
Microfuge Fisher Scientific 05-090-100

DOWNLOAD MATERIALS LIST

References

  1. Valderrama, W. B., Dudley, E. G., Doores, S., Cutter, C. N. Commercially Available Rapid Methods for Detection of Selected Food-borne Pathogens. Critical Reviews in Food Science and Nutrition. 56, (9), 1519-1531 (2016).
  2. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Application of metagenomic sequencing to food safety: detection of Shiga Toxin-producing Escherichia coli on fresh bagged spinach. Applied and Environmental Microbiology. 81, (23), 8183-8191 (2015).
  3. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Strain-Level Discrimination of Shiga Toxin-Producing Escherichia coli in Spinach Using Metagenomic Sequencing. PLoS One. 11, (12), e0167870 (2016).
  4. Hyeon, J. Y., et al. Quasi-metagenomics and realtime sequencing aided detection and subtyping of Salmonella enterica from food samples. Applied and Environmental Microbiology. (2017).
  5. Hyeon, J. Y., Deng, X. Rapid detection of Salmonella in raw chicken breast using real-time PCR combined with immunomagnetic separation and whole genome amplification. Food Microbiology. 63, 111-116 (2017).
  6. Hosono, S., et al. Unbiased whole-genome amplification directly from clinical samples. Genome Research. 13, (5), 954-964 (2003).
  7. Seth-Smith, H. M., et al. Whole-genome sequences of Chlamydia trachomatis directly from clinical samples without culture. Genome Research. 23, (5), 855-866 (2013).
  8. Jacobson, A. P., Gill, V. S., Irvin, K. A., Wang, H., Hammack, T. S. Evaluation of methods to prepare samples of leafy green vegetables for preenrichment with the Bacteriological Analytical Manual Salmonella culture method. Journal of Food Protection. 75, (2), 400-404 (2012).
  9. Jacobson, A. P., Hammack, T. S., Andrews, W. H. Evaluation of sample preparation methods for the isolation of Salmonella from alfalfa and mung bean seeds with the Bacteriological Analytical Manual's Salmonella culture method. Journal of AOAC International. 91, (5), 1083-1089 (2008).
  10. Deng, X., et al. Comparative analysis of subtyping methods against a whole-genome-sequencing standard for Salmonella enterica serotype Enteritidis. Journal of Clinical Microbiology. 53, (1), 212-218 (2015).
  11. Anonymous. Microbiology Laboratory Guidebook. Available from: https://www.fsis.usda.gov/wps/portal/fsis/topics/science/laboratories-and-procedures/guidebooks-and-methods/microbiology-laboratory-guidebook/microbiology-laboratory-guidebook (2018).
  12. Andrews, W. H., Wang, H., Jacobson, A., Hammack, T. Bacteriological Analytical Manual (BAM) Chapter 5: Salmonella. Available from: https://www.fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm070149.htm (2018).
  13. Malorny, B., et al. Diagnostic real-time PCR for detection of Salmonella in food. Applied and Environmental Microbiology. 70, (12), 7046-7052 (2004).
  14. June, G. A., Sherrod, P. S., Hammack, T. S., Amaguana, R. M., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella from raw flesh and other highly contaminated foods: precollaborative study. Journal of AOAC International. 78, (2), 375-380 (1995).
  15. Hammack, T. S., Amaguana, R. M., June, G. A., Sherrod, P. S., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella spp. from foods with a low microbial load. Journal of Food Protection. 62, (1), 16-21 (1999).
  16. Wood, D. E., Salzberg, S. L. Kraken: ultrafast metagenomic sequence classification using exact alignments. Genome Biology. 15, (3), R46 (2014).
  17. Davis, S., Pettengill, J. B., Luo, Y., Payne, J., Shpuntoff, A., Rand, H., Strain, E. CFSAN SNP Pipeline: an automated method for constructing SNP matrices from next-generation sequence data. PeerJ Computer Science. 1, (e20), (2015).
  18. Zhang, S., et al. Salmonella serotype determination utilizing high-throughput genome sequencing data. Journal of Clinical Microbiology. 53, (5), 1685-1692 (2015).
  19. Rodrigue, S., et al. Whole genome amplification and de novo assembly of single bacterial cells. PLoS One. 4, (9), e6864 (2009).
  20. Ramamurthy, T., Ghosh, A., Pazhani, G. P., Shinoda, S. Current Perspectives on Viable but Non-Culturable (VBNC) Pathogenic Bacteria. Front Public Health. 2, 103 (2014).
Kvasi-metagenomic analyse af <em>Salmonella</em> fra mad og miljøprøver
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).More

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter