Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Generation af kræft celle kloner til at visualisere Telomeric Repeat-holdige RNA TERRA udtrykt fra en enkelt Telomer i levende celler

doi: 10.3791/58790 Published: January 17, 2019

Summary

Vi præsenterer her, en protokol for at generere kræft celle kloner indeholdende en MS2 sekvens tag på en enkelt subtelomere. Denne tilgang, lid MS2-normal god landbrugspraksis system, giver mulighed for visualisering af de endogene afskrifter af telomeric repeat-holdige RNA (TERRA) udtrykt fra en enkelt Telomer i levende celler.

Abstract

Telomerer er transskriberet, giver anledning til telomeric repeat-holdige længe noncoding RNA'er (TERRA), som er blevet foreslået til at spille en vigtig rolle i telomere biologi, herunder heterochromatin dannelse og telomere længde homøostase. De seneste resultater viste, at TERRA molekyler også interagere med interne kromosomale områder at regulere genekspression i mus embryonale stamceller (ES) celler. I overensstemmelse med denne dokumentation, RNA fluorescens i situ hybridisering (RNA-fisk) analyser har vist, at kun et undersæt af TERRA udskrifter lokalisere på kromosom ender. En bedre forståelse af dynamikken i TERRA molekyler vil hjælpe med at definere deres funktion og virkningsmekanismer. Her, beskriver vi en metode til at mærke og visualisere single-telomere TERRA udskrifter i kræftceller ved hjælp MS2-normal god landbrugspraksis system. Til dette formål præsenterer vi en protokol til at generere stabile kloner, ved hjælp af AGS menneskelige mave cancer cellelinie, indeholder MS2 sekvenser integreret på en enkelt subtelomere. Transskription af TERRA fra MS2-tagged telomere resulterer i udtryk for MS2-tagged TERRA molekyler, der er visualiseret ved live-celle Fluorescens mikroskopi efter Co udtryk for en MS2 RNA-bindende protein smeltet til normal god landbrugspraksis (MS2-NGL). Denne tilgang gør det muligt for forskere at studere dynamikken i single-telomere TERRA molekyler i kræftceller, og det kan anvendes til andre cellelinjer.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Den lange noncoding RNA TERRA er transskriberet fra regionen subtelomeric i kromosomer og dens transskription provenuet mod kromosom enderne, terminering i telomeric gentage tarmkanalen1,2. Af denne grund, TERRA udskrifter består af subtelomeric-afledte sekvenser på deres 5' ende og opsige med telomeric gentagelser (UUAGGG i hvirveldyr)3. Vigtige roller er blevet foreslået for TERRA, herunder heterochromatin dannelse på telomerer4,5, DNA replikation6, fremme homologe rekombination blandt kromosom slutter7,8 , 9, regulering af telomere struktur10og telomere længde homøostase2,11,12,13. Derudover interagere TERRA udskrifter med talrige extratelomeric websteder til at regulere udbredt genekspression i mus embryonale stamceller (ES) celler14. I overensstemmelse med disse beviser, RNA fluorescens i situ hybridisering (RNA-fisk) analyser har vist, at kun et undersæt af TERRA udskrifter lokalisere på telomerer1,2,15. Derudover er TERRA blevet rapporteret at form nukleare aggregater lokalisering på X- og Y-kromosomer i mus celler2,16. Disse resultater viser, at TERRA udskrifter gennemgå kompleks dynamik i kernen. Forståelse af dynamikken i TERRA molekyler vil hjælpe med at definere deres funktion og virkningsmekanismer.

MS2-normal god landbrugspraksis system har været meget anvendt til at visualisere RNA molekyler i levende celler fra forskellige organismer17,18. Dette system har tidligere været anvendt til tag og visualisere single-telomere TERRA molekyler i S. cerevisiae12,19. Ved hjælp af dette system, blev det for nylig vist, gær TERRA udskrifter lokalisere i cytoplasma i post-diauxic Skift fase, tyder på, at TERRA kan udøve extranuclear funktioner20. Vi har for nylig brugt MS2-normal god landbrugspraksis systemet for at studere single-telomere TERRA udskrifter i kræft celler21. Til dette formål, vi ansat CRISPR/Cas9 genom redaktion værktøj at integrere MS2 sekvenser på en enkelt telomere (telomere 15q, i det følgende benævnt Tel15q) og opnået kloner udtrykker MS2-tagged endogene Tel15q TERRA (TERRA-MS2 kloner). Co udtryk for en normal god landbrugspraksis-smeltet MS2 RNA-bindende protein (MS2-NGL), genkender og binder MS2 RNA sekvenser giver mulighed for visualisering af single-telomere TERRA udskrifter i levende celler,21. Formålet med protokollen illustreret her er at beskrive i detaljer de trin, der kræves for generation af TERRA-MS2 kloner.

For at generere TERRA-MS2 kloner, en MS2 kassette er integreret inden for regionen subtelomeric af telomere 15q, neden for TERRA promotor-regionen og transskription startsted. MS2 kassette indeholder et neomycin resistens gen flankeret af lox-p steder, og dets integration ved subtelomere 15q udføres ved hjælp af CRISPR/Cas9 system22. Efter Transfektion af MS2 kassette, enkelt kloner er valgt og subtelomeric integration af kassetten bekræftes ved PCR, duppes DNA sekvensering og sydlige. Positive kloner er inficeret med en Cre-udtrykker adenovirus for at fjerne markeringen markør i kassette, forlader kun MS2 sekvenser og en enkelt lox-p websted på subtelomere 15q. Udtryk for MS2-tagged TERRA udskrifter fra Tel15q er verificeret af RT-qPCR. Endelig, MS2-normal god landbrugspraksis fusion protein er udtrykt i TERRA-MS2 kloner via retroviral infektion for at visualisere MS2-TERRA udskrifter af Fluorescens mikroskopi. TERRA udskrifter kan let påvises af RNA-fisk og live-celle imaging ved hjælp af telomeric repeat-specifikke sonder1,2,15,23. Disse tilgange giver vigtige oplysninger om lokalisering af den samlede befolkning i TERRA molekyler med enkelt celle opløsning. Generation af kloner indeholdende MS2 sekvenser på en enkelt subtelomere vil sætte forskerne i at studere dynamikken i single-telomere TERRA udskrifter i levende celler, som vil hjælpe med at definere funktion og virkningsmekanismer af TERRA.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Udvalg af Neomycin resistente kloner

  1. Vokse AGS celler i skinkes F-12_K (Kaighn) medium suppleret med 10% føtal bovin Serum (FBS), 2 mM L-glutamin, penicillin (0,5 enheder pr. mL medium) og streptomycin (0,2 µg pr. mL medium) ved 37 ° C og 5% CO2. Transfect cellerne i en 50-60% sammenløbet med sgRNA/Cas9 at udtrykke vektor og MS2 kassetten på en 1:10 molære forhold21.
    Bemærk: I en parallel eksperiment, kontrollere Transfektion effektivitet af transfecting et udtryk for normal god landbrugspraksis vektor (dvs. Cas9-NGL vektor). Mindst 60-70% Transfektion effektivitet bør opnås.
  2. Den følgende dag, erstatte de dyrkningsbaserede middel med medium indeholdende neomycin på 0,7 µg/mL endelige koncentration (selektivt medie).
    Bemærk: Opdele celler og såning dem i selektivt medie dagen efter Transfektion vil fremskynde udvælgelsesproceduren. Alle ikke-transfekteret celler vil straks dø. Hvis Transfektion udføres i 6 godt plader, i hvilket tilfælde hver brønd på en 60% ville sammenløbet indeholde ca 0,7 x 106 celler, den følgende dag celler kan opdeles fra et enkelt godt til en 10 cm parabol indeholdende selektivt medie.
  3. Hold celler i selektivt medie for 7-10 dage, skiftende medium, hver en eller to dage, indtil enkelt kloner er synlige.
  4. Plukning af celle kloner
    1. Forberede en 96 godt plade der indeholder 10 µL af 0,25% trypsin i hver brønd.
      Bemærk: Forberede to 96 godt plader i tilfælde mere end 96 kloner forventes at blive plukket.
    2. Ved hjælp af et mikroskop, mark positionen af hver klon synlig i 10 cm parabol ved at gøre en prik i bunden af fadet ved hjælp af en markør. Hver prik svarer til en koloni til at blive plukket.
    3. Erstatte de dyrkningsbaserede middel med lige nok phosphat bufferet saltvand (PBS) at danne en tynd film af væske på kloner og ikke lade cellerne tørre under klon plukning.
    4. Vælge enkelt kolonier ved hjælp af en 10 µL pipette. Vedhæfte den spids, der indeholder 5 µL af trypsin at kolonien og langsomt frigive den trypsin, som forbliver lokaliseret på kolonien. Tillad trypsin at løsrive celler i 1 min., derefter skrabe koloni med spidsen og suge det op i spidsen.
      Bemærk: Under denne procedure, flipping parabol en smule på den ene side så for at reducere lydstyrken i PBS omkring kolonien bliver plukket vil hjælpe plukprocessen ved at undgå fortynding trypsin omkring kolonien. Ved hjælp af en klon ring kan også hjælpe med picking up enkelt kloner.
    5. Placer cellerne fra kolonien i en brønd af 96 godt pladen som indeholder 10 µL af 0,25% trypsin.
    6. Inkuber 5 min ved stuetemperatur, så fyld godt med 150 µL af selektivt medie (skinkes F - 12K (Kaighn) medium suppleret med 10% FBS, 2 mM L-glutamin, penicillin (0,5 enheder pr. mL medium), streptomycin (0,2 µg pr. mL medium) og som indeholder neomycin på en koncentration på 0,7 µg/mL.
      Bemærk: Under inkubationstiden andre kloner kan plukkes. Det anbefales at vælge så mange kloner som muligt. Flere kloner er plukket jo højere er chancerne vil være at identificere positive.
    7. Når alle kloner er samlet og overført i 96 godt plade, tillade celler til at vokse i et par dage i selektivt medie skinkes F - 12K (Kaighn) medium suppleret med 10% FBS, 2 mM L-glutamin, penicillin (0,5 enheder pr. mL medium), streptomycin (0,2 µg / mL af medium), og som indeholder neomycin ved en koncentration på 0,7 µg/mL ved 37 ° C og 5% CO2, indtil nå 90% sammenløb.
  5. Opdeling af kloner
    1. Forberede tre 96 godt plader overtrukket med gelatine af tilføjer 100 µL af gelatine pr. brønd, inkuberes i 30 min. ved stuetemperatur, så vaskes to gange med PBS. Disse plader skal bruges til DNA-ekstraktion (DNA plade) og klon frysning (indefrysning plader).
      Bemærk: Gelatine vil fremme den vedhæftede fil på celler og DNA brønde. Især vil gelatine belægning tillade DNA til at holde sig i bunden af brøndene under DNA-ekstraktion og vaske procedurer (diskuteres nedenfor). Under proceduren klon-opdeling er det tilrådeligt at bruge en multikanalpipette.
    2. Når kloner nå 90% sammenløb, Aspirér medium fra hver brønd af 96 godt plade, vask med PBS, tilføje 30 µL af 0,25% trypsin pr. brønd og Inkuber i 5 min. ved 37 ° C.
      Bemærk: Kloner vil vokse til forskellige priser, som vil også afhænge af antallet af celler plukket pr. klon. Således, dette skridt vil blive udført i løbet af flere dage, når de forskellige kloner når 90% sammenløbet.
    3. Tilføje 70 µL af selektivt medie pr. brønd, forstyrre celle klumper af pipettering op og ned inde i brøndene og derefter overføre 30 µL af de 100 µL til gelatinized DNA pladen udfyldes på forhånd med 120 µL af selektivt medie pr. godt og 30 µL til gelatinized frysning plader forudfyldte wit h 50 µL medium (uden markering).
    4. DNA-pladen anbringes i rugemaskinen og tillade celler til at vokse ved 37 ° C og 5% CO2 indtil 90% sammenløb.
    5. Tilføje 80 µL af iskold frisklavet 2 x frysning medium (80% FBS og 20% dimethylsulfoxid (DMSO)) til hvert hul i indefrysning pladen, tilføje parafilm (sprøjtes med 70% ethanol) på toppen af pladen for at forsegle hver brønd, låget lægges på toppen og wrap plade med alufolie. Sted indefrysning plader ved-80 ° C.
    6. Tilføje 90 µL af selektivt medie pr. brønd til den originale 96 godt plade der indeholder kloner, der har været splittet og holde det i kultur indtil PCR screening resultater. Denne plade vil blive brugt som backup plade.

2. screening af Neomycin resistente kloner

  1. DNA-ekstraktion fra 96 godt DNA pladen.
    1. Når kloner kulturperler i DNA plade når 90% sammenløb, vask 2 gange med PBS, så lyse med 50 µL lysisbuffer (10 mM Tris pH 7,5, 10 mM EDTA, 10 mM NaCl, 0,5% SDS og 1 mg/mL proteinase K). Dække pladen med parafilm, forsegling hver brønd, lægge låg på, dække med saran wrap og placere ved 37 ° C natten over.
    2. Tilsæt 100 µL koldt ethanol (Et-OH) / NaCl løsning (0,75 M NaCl i 100% ethanol) til hver godt og bundfald i 6 timer eller natten over ved stuetemperatur.
      Bemærk: Protokollen kan pause her.
    3. Fjerne Et-OH/NaCl løsning ved at invertere pladen og vask 3 gange med 200 µL af 70% ethanol pr. brønd.
    4. Tilsæt 25 µL af RNAse A opløsning i destilleret vand og der inkuberes ved 37 ° C i 1 time.
  2. Bruge 3 µL af genomisk DNA til PCR-amplifikation. Udføre PCR screening af udvalgte kloner ved hjælp af primere udglødning inden for neomycin resistens gen og subtelomere 15q. PCR-amplifikation udføres ved hjælp af standard polymerase enzymer og PCR-protokoller21.
    Bemærk: PCR betingelser for MS2 primere (MS2-subtel15q-primer-S og MS2 primer som) og CTR primere (CTR prime S og CTR primer som) er følgende: 98 ° C i 20 s som denaturering trin og derefter 34 cyklusser på 98 ° C 10 s, 58° C 20 s, 72 ° C 15 s , ved hjælp af polymerase enzym i en 25 µL reaktion mix (Se Tabel af materialer). Primer sekvenser er angivet i tabel 1.
  3. Køre PCR reaktioner på agarosegel og udtrække PCR bands fra positive kloner ved hjælp af standard gel ekstraktion procedurer (Se Tabel af materialer for gel udvinding reagenser).
  4. Udføre DNA-sekventering analyser af gel-udvundet PCR produkt til bekræftelse af tilstedeværelsen af MS2 sekvenser21.
    Bemærk: Sekventering analyser kan udføres ved hjælp af primere anvendes til PCR-screening.
  5. Sydlige skamplet screening af PCR positive kloner
    1. Vokse kloner positiv PCR og sekventering screening fra den originale 96 godt plade (backup pladen) til 6 godt plader i skinkes F - 12K (Kaighn) medium suppleret med 10% FBS, 2 mM L-glutamin, penicillin (0,5 enheder pr. mL medium), streptomycin (0,2 µg pr. mL medium), og som indeholder neomycin ved en koncentration på 0,7 µg/mL ved 37 ° C 5% CO2.
      Bemærk: Alternativt, hvis nogle af disse kloner er gået tabt, tø dem fra en af de frysende plader (se protokollen 2.6).
    2. Når kloner er på 90% confluence i 6 godt pladen, cellerne vaskes med PBS og tilføje 250 µL af lysisbuffer indeholdende 0,5 µg proteinase K pr. brønd.
    3. Skrab celler ved hjælp af en celle skraber og overføre den lysate i en 1,5 mL tube.
    4. Der inkuberes ved 37 ° C i 16 h.
    5. Der tilsættes 1 mL 100% ethanol, rystes kraftigt, og tillade DNA at udfælde mindst 2 timer eller natten over ved-20 ° C.
      Bemærk: Protokollen kan pause her.
    6. Spin på 13.400 x g ved 4 ° C i 10 min, supernatanten fjernes, og vaske pellets med 70% ethanol. Lad pellets lufttørre ved stuetemperatur. Alternativt kan du bruge en vakuum koncentrator.
    7. Resuspend DNA pellets i 50 µL af destilleret vand indeholdende RNAse A og Inkuber i 1 time ved 37 ° C.
    8. Fordøje 5-10 µg genomisk DNA ved hjælp af NcoI og BamHI-restriktionsenzymer (to uafhængige digestions) i 100 µL reaktion volumen ved at inkubere fordøjelsen reaktioner ved 37 ° C natten over.
    9. Køre 4 µL af fordøjelsen på agarosegel (0,8% Agarosen) for komplet fordøjelsen bekræftelse.
    10. Tilføj 1/10 bind natrium acetat 3 M løsning pH 5,2 og 2 bind af 100% ethanol til begrænsning fordøjelsen reaktioner og inkuberes mindst 2 h eller natten ved-20 ° C til udfældes DNA.
      Bemærk: Protokollen kan pause her.
    11. Der centrifugeres ved 13.400 x g ved 4 ° C i 20 min., kassere analysere og vaske pellets med 70% ethanol. Tillad pellets til luft tørre ved stuetemperatur. Alternativt kan du bruge en vakuum koncentrator.
    12. Resuspend pellets i 20 µL destilleret vand og indlæse fordøjet DNA på en 0,8%-agarosegel.
      Bemærk: For en bedre opløsning af fordøjet DNA, forberede en gel mindst 15 cm lang og køre natten over ved lav spænding (̴30 volt). Elektroforese oprettet skal optimeres.
    13. Den følgende dag, pletten gel med en DNA mærkning agent, såsom ethidiumbromid på 1 µL/10 mL endelige koncentration i 30 min. ved stuetemperatur og tage et billede med en lineal tæt på gel på en gel imaging instrument.
    14. Indstil overførsel af DNA til en nylon membran og udføre membran hybridisering med en MS2 sekvens-specifikke sonden ved hjælp af standardprocedurer21.
    15. Optø de kloner, der er positiv ved PCR, DNA sekvensering og sydlige skamplet fra en af de to indefrysning plader (se næste trin).
  6. Optøning af kloner
    1. Forberede en 15 mL tube der indeholder 5 mL af pre varmede skinke F - 12 K (Kaighn) medium suppleret med 10% FBS, 2 mM L-glutamin, penicillin (0,5 enheder pr. mL medium) og streptomycin (0,2 µg pr. mL medium) for hver klon at blive optøet straks.
    2. Fjerne en af de frysende plader fra-80 ° og tilsæt 100 µL af pre varmede F12K komplet medium til de godt indeholdende den positive klon at blive optøet straks.
      Bemærk: Denne procedure bør udføres hurtigt og 96 godt pladen anbringes på tøris efter hver klon er optøet, således at de andre kloner skal forblive frosne. Dette er især vigtigt hvis flere kloner skal optøs fra den samme 96 godt plade.
    3. Overfør celler til 15 mL tube indeholder 5 mL af medium og centrifugeres ved 800 x g i 5 min ved stuetemperatur.
    4. Opsug mediet, resuspend celler i 500 µL af pre varmede komplet F12K medium og overføre hver klon til et enkelt godt af en 12 godt plade.
  7. Eliminering af neomycin resistens gen fra MS2 kassette integreret på subtelomere 15q.
    1. Tillad kloner at vokse fra en 12 godt plade til en 10 cm parabol i komplet F12K medium.
      Bemærk: Neomycin bør ikke medtages i medium medmindre andet er angivet.
    2. Tilføje Cre-udtrykker adenovirus til cellerne kulturperler i en 10 cm parabol på 70% confluence i 10 mL af komplet F12K medium.
      Bemærk: Ved hjælp af en Cre-normal god landbrugspraksis udtrykker adenovirus vil tillade evaluering af effektiviteten af infektion, som bør henvende sig til 100%. Replikering defekte adenovirus vil gå tabt efter par passager i kultur.
    3. 48 timer efter infektion, Opdel celler i tre 10 cm retter. To retter vil blive anvendt til kontrol af neomycin gen fjernelse af negative valg, voksende celler i neomycin-holdige medium (første parabol), og af det sydlige duppes (andet fad).
    4. Kultur den tredje skål indeholdende klon for celle frysning og RNA udvinding.

3. efterprøvning af TERRA-MS2 udskrift udtryk af RT-qPCR

  1. Ved kontrol af neomycin gen fjernelse, udføre total RNA udvinding fra TERRA-MS2 kloner ved hjælp af organiske opløsningsmidler (phenol og guanidin isothiocynate løsning)21.
    1. Resuspend RNA ekstraheret fra en 10 cm parabol i 100 µL diethyletheren pyrocarbonate (DEPC) vand.
    2. Køre 3 µL af RNA på en denaturating (1% formaldehyd-indeholdende) 1 x 3-(N-Morpholino) propanesulfonic syre (MOPPER) gel for at kontrollere koncentrationen og integriteten af RNA. Også analysere RNA koncentration ved hjælp af et spektrofotometer.
    3. Behandle 3 µg af RNA med DNAse jeg bruger 1 enhed af DNAse jeg enzym i 60 µL endelige reaktion volumen.
    4. Inkuber reaktion i 1 timer ved 37 ° C.
  2. Reverse transkription reaktion og qPCR analyser
    1. Tilføj følgende komponenter til en nukleasen-fri microcentrifuge tube: 2 µL af en 1 µM TERRA specifikke primer, 1 µL af dNTP'er mix (10 mM), 6 µL af DNAse jeg-behandlede RNA (svarende til ̴300ng RNA). Regulér lydstyrken til 13 µL med 4 µL af DEPC vand.
      Bemærk: For hvert RNA analyseres, et andet rør, der indeholder de samme reagenser, men en reference specifikke primer, i stedet for TERRA specifikke primer, bør være forberedt.
    2. Opvarm blandingen til 65 ° C i 5 min og der inkuberes i isbad i mindst 1 min.
    3. Indsamle indholdet af rørene ved kort centrifugering og tilføje 4 µL af 5 X RT enzym Buffer, 1 µL 0,1 M dithiothreitol (DTT), 1 µL (4 enheder) af RNAse hæmmer og 1 µL af reverse transkriptase (Se Tabel af materialer).
    4. Inkuber prøver på 42 ° C i 60 min og derefter bruge 2 µL af RT reaktion for qPCR analyser.
  3. Forberede qPCR mastermix i en endelige mængden af 20 µL bestående af 10 µL af 2 x qPCR master mix, 2 µL cDNA skabelon, 1 µL af fremad primer (10 µM), 1 µL af reverse primer (10 µM), og 6 µL vand.
  4. Udføre qPCR reaktion i en thermocycler ved hjælp af standardprotokoller21.

4. produktion af en MS2-normal god landbrugspraksis udtrykker Retrovirus

  1. For at generere MS2-normal god landbrugspraksis udtrykker retrovirus, transfect 80% sammenflydende phoenix emballage celler MS2-normal god landbrugspraksis fusion protein udtrykker retrovirus vektor (pBabe-MS2-NGL PURO) og en env gen udtrykker vektor (f.eks. pCMV-VSVG) ved hjælp af en kindtand forholdet 4:1 i de to vektorer.
  2. Den følgende dag, skal du erstatte de dyrkningsbaserede middel (DMEM suppleret med 10% FBS, 2 mM L-glutamin og Pen/Strep) med frisk medium indeholdende 10mM natrium butyrat.
  3. Inkuber i 8 timer ved 37 ° C, 5% CO2, og derefter erstatte mediet med friske dyrkningsbaserede middel hvorfra virus vil blive indsamlet.
  4. Efter 48 h, skal du fjerne den retrovirus-holdige medium fra phoenix celler. Dette medie kan bruges direkte til infektion af TERRA-MS2 kloner, i hvilket tilfælde mediet der filtreres gennem et 0,45 µm filter, tilføje polybrene (30 µg/mL slutkoncentration) og føje den til celler (i dette tilfælde protokollen fortsætter på trin 5). Alternativt, retrovirus kan være fældet i en 50 mL falcon rør ved at tilføje 1/5th volumen af 50% PIND-8000/900 mM NaCl løsning og inkubering natten over ved 4 ° C på en rotator hjul.
  5. Den følgende dag, pellet retrovirus partikler ved centrifugering ved 2.000 x g i 30 min, Fjern supernatanten og resuspenderes i F12K medium uden serum.
    Bemærk: Viruspartikler kan være genopslemmes i 1/100th af den oprindelige supernatanten volumen. En infektion testen bør gennemføres for at kontrollere minimumsvolumen af retrovirus skal effektivt inficere celler.

5. visualisering af TERRA-MS2 udskrifter i levende celler

  1. Plade TERRA-MS2 kloner og WT AGS celler i glas-bund retter. På dagen for infektion, skal du tilføje polybrene til medium (30 µg/mL slutkoncentration) og MS2-normal god landbrugspraksis udtrykker retrovirus.
  2. Efter 24 timer, skille sig af med den virus-holdige medium og tilføje frisk medium uden phenol-rød.
  3. Analysere cellerne i en inverteret mikroskop ved hjælp af passende mikroskop indstilling. Image celler med en 100 X eller 60 X mål med store numerisk blænde (1,4 X) og ved hjælp af en følsom kamera (EMCCD). Bruge en miljømæssig kontrolsystem til at vedligeholde prøverne på 37 ° C og 5% CO2 under imaging.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Figur 1 repræsenterer en oversigt over den eksperimentelle strategi. De vigtigste trin i protokollen og en vejledende tidsplan for generation af TERRA-MS2 kloner i AGS celler er vist (figur 1A). På dag 1, er flere brønde i en 6 godt plade transfekteret med MS2 kassette og sgRNA/Cas9 at udtrykke vektorer (vist i figur 1B). To forskellige subtelomere 15q-specifikke guide RNA sekvenser er klonet Cas9 nickase-udtrykker pX335 vektor, genererer to sgRNA-pX335 vektorer, der er co transfected med MS2 kassette. Et godt af pladen kan være transfekteret med en normal god landbrugspraksis udtrykker vektor at kontrollere Transfektion effektivitet. På dag 2, er cellerne trypsinized og overføres fra en enkelt brønd til en 10 cm parabol indeholdende selektivt medie. På dag 3, bør medium ændres som mest untransfected celler vil være døde. Celler dyrkes i udvalg, indtil kloner er synlige og klar til at blive plukket. I løbet af denne tid, bør man ikke trypsinized celler og dyrkningsbaserede medium bør ændres hver 1-2 dage for den første uge og derefter hver 2-3 dage bagefter. Når enkelt kloner er synlige, er de plukket og overført i en 96 godt plade hvor de er tilladt at vokse indtil nå 80-90% af sammenløb. På dette tidspunkt, er kloner opdelt i 4 forskellige 96 godt plader, der er markeret i figur 1 med en farvekode. Når kloner kulturperler i DNA plade (grøn) nå 80% sammenløb, de er mængden og genomisk DNA ekstraheret til PCR screening; kloner i backup plade (blå) vil blive holdt i kultur indtil resultaterne af den PCR screening, mens de røde indefrysning plader er frosset ved-80 ° C. Figur 2 B viser repræsentative resultater af en PCR screening af neomycin-resistente kloner. For denne screening anvendes to sæt primere: en primer par (MS2 primere) udglødning inden for neomycin gen og subtelomere 15q sekvens bruges til at kontrollere tilstedeværelsen af MS2 kassette (et repræsentativt billede af primere lokalisering er vist i Figur 2A). En anden primer par (CTR primere) udglødning på en intern kromosomale region bruges til at kontrollere tilstedeværelsen af falsk negative kloner (primer sekvenser er angivet i tabel 1). Negative kloner til integration af kassetten bør være negativt at MS2 primere forstærkning og positive til CTR primere forstærkning. Tekniske problemer i genomisk DNA-ekstraktion resulterer i mangel af genomisk DNA eller dens forurening ville udelukke PCR-amplifikation fra MS2 og CTR primer reaktioner. I disse tilfælde, kan kloner involveret re screenes ved PCR på udvinding af genomisk DNA fra backup pladen. Bands, fremkommet MS2 primere forstærkning af positive kloner kan være gel udvindes og sekventeret hjælp MS2 primere, for at bekræfte tilstedeværelsen af ti MS2 sekvenser.

Kloner, der er positiv ved PCR screening er kulturperler fra 96 godt backup pladen (den blå plade i figur 1) til en 6 godt plade, så mængden for genomisk DNA-ekstraktion og sydlige skamplet analyser. Figur 2 D viser repræsentative billeder af en gel (til venstre) og membran hybridiseret med en radioaktivt mærket MS2 sekvens specifikke sonde (til højre) af en sydlige skamplet screening af PCR positive kloner. Til bekræftelse af MS2 sekvenser integration på subtelomere 15q, bør genomisk DNA ekstraheret fra hver klon fordøjes med to forskellige restriktionsenzymer (NcoI og BamHI) i to separate fordøjelsen reaktioner. NcoI og BamHI-restriktionsenzymer er velegnet til kontrol af MS2 kassette integration på subtelomere 15q. Andre enzymer kan også bruges. Gelen viser en komplet foraskning af genomisk DNA ved hjælp af BamHI begrænsning enzym, som angivet ved tilstedeværelsen af en smøre. Resultaterne fra det sydlige skamplet tyder på at en klon er positive for integration af MS2 kassette på subtelomere 15q, mens flere kloner vis flere integrationen begivenhederne i kassette, som angivet ved tilstedeværelsen af flere bands. En positiv klon bør analyseres af en anden sydlige skamplet på NcoI fordøjelse af genomisk DNA21. Et repræsentativt billede af en subtelomere 15q som indeholder MS2 kassette og placeringen af BamHI og NcoI begrænsning enzym websteder er vist i figur 2C.

Kloner positiv PCR og sydlige skamplet analyser er inficeret med en Cre-normal god landbrugspraksis udtrykker adenovirus for at fjerne neomycin gen findes i MS2 kassette. Figur 3 A skildrer en MS2-markeret subtelomere 15q før og efter Cre udtryk. Et billede af en positiv for MS2 kassette integration på subtelomere 15q klon inficeret med en Cre-NGL udtrykker adenovirus er vist i figur 3B. For en fuldstændig fjernelse af neomycin genet i alle celler, bør infektion effektivitet nå cirka 100%. Som vist i figur 3C, for at kontrollere fjernelsen af neomycin-genet, er Cre-NGL inficerede celler opdelt i tre plader efter 48 timer fra infektionen. Én plade vil blive kulturperler i overværelse af neomycin. Alle cellerne i denne plade skulle dø inden for 6-7-dage. I en anden plade må celler til at vokse i komplet medium uden markering til 80-90% sammenløb. På dette tidspunkt, genomisk DNA udtages og analyseres af det sydlige skamplet. Den tredje plade er kulturperler i komplet medium til forberedelse af frosne bestande af klon og for RNA udvinding og RT-qPCR analyser af TERRA-MS2 udskrift udtryk. Figur 3 D viser repræsentative billeder af sydlige skamplet analyser af en positiv klon før og efter Cre-normal god landbrugspraksis infektion. DNA agarosegel (billedet til venstre) bekræfter komplet fordøjelsen af genomisk DNA ved hjælp af NcoI begrænsning enzym. Sydlige skamplet analyse blev udført ved hjælp af en radioaktivt mærket MS2-sekvens specifikke sonde (billedet til højre). Denne analyse bekræfter fjernelse af neomycin-genet. Tilstedeværelsen af en smøre i eksemplet Cre-NGL inficeret bekræfter telomeric integration af MS2 sekvenser. Placeringen af NcoI begrænsning websteder inden for subtelomere 15q er vist i fig. 3A.

Når fjernelsen af neomycin resistens gen er bekræftet, kan kloner blive testet for udtryk af TERRA-MS2 udskrifter. Til dette formål, er total RNA ekstraheret fra hver klon og køre på en denaturating MOPS gel til at bekræfte sin integritet (figur 4A). Ribosomale RNA bands skal være synlig på 4.700 baser (rRNA 28S) og 1.900 baser (18S rRNA). Retrotranscription reaktion udføres ved hjælp af en telomeric repeat-specifikke primer og reference gen-specifikke primer (fig. 4B, top) mens qPCR analyser af TERRA udtryk udføres ved hjælp af to sæt primere: en primer par udglødning inden for MS2 sekvens og sekvensen der subtelomere 15q; et andet par af primere udglødning inden for subtelomere 15q. Primer sekvenser er angivet i tabel 1. Grafen i figur 4B viser RT-qPCR analyser af TERRA udtryk fra AGS WT celler og to forskellige TERRA-MS2 kloner. Disse analyser bekræfte udtryk af TERRA-MS2 udskrifter i de to kloner på niveauer, der er sammenlignelige med TERRA udskrifter udtrykt fra subtelomere 15q i WT celler. Disse data viser, at de to TERRA-MS2 kloner udvalgt er velegnet til analyser af TERRA-MS2 udskrifter af levende celle billeddannelse.

For at visualisere TERRA-MS2 udskrifter i levende celler, er de udvalgte kloner inficeret med en retrovirus udtrykker MS2-normal god landbrugspraksis fusion protein. Figur 5 A viser proceduren til at generere MS2-normal god landbrugspraksis udtrykker retrovirus, som beskrevet i protokollen trin 4. AGS WT celler og TERRA-MS2 kloner er smittet i glas-bund retter. Efter 24 timer fra infektionen analyseres celler af Fluorescens mikroskopi. Specificiteten af signalet er bekræftet ved tilstedeværelsen af TERRA-MS2-NGL foci opdages i kernen af TERRA-MS2 kloner og ikke i AGS WT celler (figur 5B). I en population af MS2-normal god landbrugspraksis udtrykker celler, heterogenitet MS2-normal god landbrugspraksis niveauer blandt celler med hensyn til forventes og celler, der udtrykker lavt niveau bør vælges for de billeddiagnostiske analyser. Alternativt, MS2-normal god landbrugspraksis udtrykker celler kan sorteres efter FACS forudgående mikroskopi analyser for at indsamle delpopulation af celler, der udtrykker lave niveauer af normal god landbrugspraksis. Vi har tidligere fundet TERRA-MS2-NGL foci i 40-60% af celler af AGS TERRA-MS2 kloner21. I disse celler, blev en til fire TERRA-MS2-NGL foci afbildet pr. celle. TERRA-MS2-NGL foci viser forskellige størrelser og dynamik kan være registreret21. TERRA-MS2 kloner kan bruges til at studere dynamikken i single-telomere TERRA udskrifter i levende celler. Som et eksempel på denne ansøgning viser figur 5C repræsentative billeder fra mikroskopi analyser af en TERRA-MS2 klon udtrykker MS2-normal god landbrugspraksis fusion protein og Telomer-bindende protein TRF2 sammenvokset til mCherry for at visualisere MS2-tagged TERRA udskrifter og telomerer i levende celler. Brug denne fremgangsmåde, har vi tidligere observeret at TERRA-MS2-NGL foci Co lokalisere med telomerer i 44% af cellerne, der angiver, at TERRA udskrifter kun forbigående Co lokalisere med kromosom ender i AGS celler21.

Figure 1
Figur 1 . Oversigt over den eksperimentelle strategi og vejledende tidsplan for generation af TERRA-MS2 kloner i AGS celler. A) trinene beskrevet i protokollen og en vejledende tidslinje for udvælgelsen af TERRA-MS2 kloner er vist. Celler er transfekteret i en 6 godt plade med lineariseret MS2 kassette og sgRNA/Cas9 at udtrykke vektorer. En farvekode bruges til at skelne DNA pladen, backup pladen og frysning pladerne er angivet i afsnittet protokol. B) The MS2 kassette består af en 800 nt lang subtelomere 15q sekvens efterfulgt af 10 gentagelser af MS2 sekvenser og et neomycin resistens gen flankeret af lox-p steder og afslutter med en 300 nt længe telomeric gentage tarmkanalen på sine 3' enden. sgRNA/Cas9 udtrykker vektorer blev genereret af kloning subtelomere 15q-specifikke guide RNA sekvenser i pX335 vektor ved hjælp af BbsI begrænsning site21,22. To forskellige sgRNA-pX335 vektorer blev genereret og en 1:1 blanding af de to vektorer blev brugt til Transfektion. Sekvenser for sgRNAs er angivet i tabel 1. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 . Repræsentative billeder af PCR og sydlige duppes screening af neomycin resistente kloner. A) repræsentativt billede af subtelomere 15q som indeholder MS2 kassette. Placeringen af MS2 primere (MS2-subtel15q-primer-S og MS2 primer som) anvendes til PCR screening er indiceret. LoxP websteder stede i kassetten er vist med rødt. B) repræsentativt billede af PCR screening af neomycin resistente kloner ved hjælp af to sæt primere, MS2 primere og CTR primere (CTR prime S og CTR primer som). C) repræsentativt billede af subtelomere 15q som indeholder MS2 kassette. BamHI og NcoI begrænsning websteder og MS2 sonden bruges til sydlige skamplet screening er vist. D) venstre: 10 µg genomisk DNA pr. klon var fordøjet med BamHI og køre på en agarosegel. Billedet blev erhvervet efter en overnatning køre på 30 volt. Højre: genomisk DNA fordøjes med BamHI begrænsning enzym blev overført til et positivt ladede nylon membran og hybridiseret med en radioaktivt mærket MS2 sekvens-specifikke sonde. Det røde felt angiver den forventede størrelse på de positive band. Den røde pil angiver en positiv klon. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3 . Eliminering af neomycin resistens gen og validering eksperimenter. A) repræsentativt billede af subtelomere 15q som indeholder MS2 kassette før og efter Cre udtryk. MS2 specifikke sonden bruges til sydlige skamplet analyser og NcoI begrænsning enzym websteder er vist. LoxP websteder stede i kassetten er vist med rødt. B) Fluorescens mikroskopi analyse af en TERRA-MS2 klon inficeret med Cre-normal god landbrugspraksis udtrykker adenovirus. Repræsentativt billede erhvervet på en enkelt brændplanet er vist. MOI, mangfoldighed af infektion, er forholdet mellem antallet af vira, der anvendes for infektionen og antallet af værtsceller. Skalalinjen: 30 µm C) oversigt over den eksperimentelle strategi anvendes til at kontrollere fjernelsen af neomycin-genet. Cre-GFP inficerede celler er opdelt i tre plader efter 48 timer fra infektionen i) negative valg, ii) sydlige skamplet analyser og iii) forberedelse af frosne celle bestande og RNA udvinding. D) sydlige skamplet analyser af en TERRA-MS2 klon før og efter Cre-normal god landbrugspraksis adenovirus infektion. 10 µg genomisk DNA var fordøjet med begrænsning enzym NcoI. Agarosegel bekræfter, at fuldstændig fordøjelsen er opnået i begge kloner (til venstre). Den fordøjede genomisk DNA blev overført til et positivt ladede nylon membran og hybridiseret ved hjælp af en MS2 sekvens-specifikke sonde. Fuldstændig fjernelse af neomycin-genet er bekræftet ved fravær af specifikke bandet. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4 . RT-qPCR analyser af Tel15q-TERRA og Tel15q-TERRA-MS2 afskrifter udtryk. A) repræsentativt billede af en MOPS gel viser total RNA udtrukket fra AGS WT celler og TERRA-MS2 kloner. Bånd svarende til ribosomale RNA'er 28S og 18S angives. B) Top: en skematisk af den MS2-markeret subtelomere 15q udtrykker TERRA udskrifter. Primere bruges til TERRA retrotranscription (gul) og qPCR analyser af Tel15q-TERRA (blå) og Tel15q-MS2 TERRA (rød) er vist. Webstedet loxP er vist med rødt. Bund: RT-qPCR analyser af Tel15q-TERRA og Tel15q-MS2 TERRA udskrifter udtryk i AGS WT celler og TERRA-MS2 kloner. p < 0,05, uparret t-test. Venligst klik her for at se en større version af dette tal.

Figure 5
Figur 5 . Levende celle imaging analyser af TERRA-MS2 kloner. A) en oversigt over procedure til at producere en MS2-normal god landbrugspraksis udtrykker retrovirus, som beskrevet i protokollen trin 4. En skematisk af MS2-markeret subtelomere 15q og TERRA udskrifter anerkendt af MS2-normal god landbrugspraksis fusion protein er vist til højre. B) repræsentative Fluorescens mikroskopi billede af AGS WT og to TERRA-MS2 kloner udtrykker MS2-normal god landbrugspraksis. TERRA-MS2-NGL foci er angivet med pile. Billeder blev erhvervet ved hjælp af en roterende disk Konfokal mikroskop udstyret med en EMCCD kamera. Billederne blev fanget ved hjælp af en 100 X / 1.46 apochromat mål i en billeddiagnostiske afdeling vedligeholdes ved 37 ° C med 5% CO2. En 488 laser blev brugt som lyskilde. Skalalinjen: 5 µm. C) levende celle imaging analyser af TERRA-MS2-NGL foci og TRF2-mCherry mærket telomerer. Hændelsen Co lokalisering mellem TERRA-MS2-NGL fokus og en enkelt telomere er vist. Billeder blev erhvervet som i B, ved hjælp af 488 og 520 lasere som lyskilde. En maksimal projektion af et z stak eksperiment udført på et enkelt tidspunkt point af time-lapse imaging eksperiment er vist. Skalalinjen: 5 µm. venligst klik her for at se en større version af dette tal.

Primer navn Primer sekvens Ansøgning
MS2-subtel15q-primer-S TGCATTAAAGGGTCCAGTTG MS2 primer frem anvendes til PCR screening af neomycin resistente kloner
MS2 primer som CCTAACTGACACACATTCCACAGA MS2 primer omvendt anvendes til PCR screening af neomycin resistente kloner
CTR primer Sørensen TGT ACG CCA ACA CAG TGC TG CTR primer frem anvendt i PCR screening af neomycin resistente kloner
CTR primer som GCT GGA AGG TGG ACA GCG A CTR primer omvendt bruges i PCR screening af neomycin resistente kloner
Tel15q-S1 GCAGCGAGATTCTCCCAAGC Forstand primer anvendes til at påvise Tel15q og Tel15q-MS2 TERRA udtryk af qPCR
hTel15q-AS TAACCACATGAGCAATGTGGGTG Antisense primer anvendes til at påvise Tel15q og Tel15q-MS2 TERRA udtryk af qPCR
Tel15q-MS2-AS ATGTTTCTGCATCGAAGGCATTAGG Antisense primer anvendes til at påvise Tel15q-MS2 TERRA udtryk af qPCR
TERRA-RT-primer CCCTAACCCTAACCCTAACCCTAACCCTAA Primer anvendes til retrotranscription af TERRA udskrifter
sgRNA1 TTGGGAGAATCTCGCTGGCC Sekvens af den korte vejledning RNA 1 klonede i pX335 vektor og bruges til direkte Cas9 nickase enzymatisk aktivitet til subtelomere 15q
sgRNA2 TGCATTAAAGGGTCCAGTTG Sekvens af den korte vejledning RNA 2 klonet i pX335 vektor og bruges til direkte Cas9 nickase enzymatisk aktivitet til subtelomere 15q

Tabel 1 : Liste over de primere, der anvendes i denne undersøgelse. Der findes en liste over primere og sekvenser af sgRNAs anvendes i denne protokol. Sekvenser er 5' til 3'.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I denne artikel præsenterer vi en metode til at generere menneskelige kræft celle kloner indeholdende MS2 sekvenser integreret inden for subtelomere 15q. Brug disse kloner, registreres MS2-tagged TERRA molekyler transskriberet fra subtelomere 15q af Fluorescens mikroskopi af co udtryk for en normal god landbrugspraksis MS2 fusion protein. Denne tilgang gør det muligt for forskere at studere dynamikken i TERRA udtrykt fra en enkelt Telomer i levende celler,21. I denne protokol, er TERRA-MS2 kloner markeret i linjen AGS celle, som repræsenterer en interessant modelsystem at studere TERRA, da TERRA udtryk er upregulated i menneskelige mave kræft prøver24. Protokollen beskrevet her kan dog tilpasset for udvælgelse af TERRA-MS2 kloner i andre cellelinjer. Integration af MS2 sekvenser kan i princippet fremmes på en subtelomere forskellig fra telomere 15q ved hjælp af en specifik MS2 kassette og CRISPR strategi. I den metode, der præsenteres her, er en Cas9 nickase enzym og dobbelt guide RNA'er ansat for at øge integrationen22specificitet. Bruger denne strategi, forventes en samlet 2% af positive kloner at blive identificeret i AGS celler. Andre versioner af Cas9 enzymet kan testes i forsøget på at øge succesraten for kloner udvalg25. De følgende trin i protokollen er desuden kritiske dem at tage hensyn til at maksimere effektiviteten af klon udvalg:

I) for at øge chancerne for at vælge TERRA-MS2 klonerne, det er vigtigt at opnå en høj Transfektion effektivitet af MS2 kassette og CRISPR vektorer. Dårligt transfekteret cellelinjer vil sandsynligvis kræve flere runder af Transfektion, klon udvælgelse og screening for at vælge positive kloner.

II) det er vigtigt at fastlægge den præcise koncentration af neomycin til brug for udvælgelse af kloner. Ja, ved hjælp af en lav koncentration af stoffet vil resultere i falske positive kloner, mens en høj koncentration kan udelukke identifikation af positive kloner. Neomycin koncentrationen i denne protokol anførte er dødbringende til AGS celler inden for 6-7 dage fra tilføjelsen til de dyrkningsbaserede middel.

III) klon plukning er et kritisk skridt. Faktisk i løbet af denne procedure er det nødvendigt at kun enkelt kloner er plukket. For denne grund, kolonier, der er for tæt på hinanden bør undgås for at forebygge sammenblanding celler fra forskellige kloner, integreret hvilket resulterer i udvælgelsen af en blandet population af kloner, som kan indeholde MS2 sekvenser på flere genomisk websteder. Disse begivenheder bør identificeres under sydlige skamplet screening.

IV) mængden af genomisk DNA ekstraheret fra en sammenflydende 96 godt DNA plade (protokol 2) skønnes for at være omkring 5 µg og burde være nok til at screene alle klon af PCR og sydlige duppe med en enkelt begrænsning enzym fordøjelsen. For at bekræfte integration af kassette på den forventede telomere, vil det imidlertid være vigtigt at skærm hver klon af sydlige skamplet af fordøje genomisk DNA med to forskellige restriktionsenzymer. Til dette formål, som det fremgår af protokollen, bør kloner positive på PCR screening være kulturperler i 6 godt plader. Mængden af genomisk DNA ekstraheret fra en brønd af et 6 godt plade vil være tilstrækkeligt for mindst to begrænsning digestions kræves for de sydlige skamplet analyser.

I protokollen beskrevet her, MS2 sekvenser er integreret i subtelomere 15q for en række årsager: Jeg) TERRA promotor region og TERRA transskription start sites er blevet identificeret på denne subtelomere26,27; II) TERRA udtryk fra subtelomere 15q er blevet valideret ved hjælp af in vitro- teknikker4,27,28,29,30; III) subtelomeric regionen kromosom 15q er blevet sekventeret, og den indeholder en unik region støder op til den telomeric gentage tarmkanalen, der kan målrettes til integration af MS2-kassette21. PCR og sydlige skamplet tilgange blev udviklet for at bekræfte en enkelt integration af MS2 sekvenser i subtelomere 15q i TERRA-MS2 kloner. Det ville være interessant at også udføre DNA-fisk eksperimenter på kromosom spreads for at visualisere den kromosomale lokalisering af MS2 sekvenser i faste metafase kromosomer. Men længden af 10xMS2 sekvenser (450 bp) pålægger brug af meget korte sonder i forhold til sonder generelt anvendes i DNA-fisk eksperimenter på kromosom spreads (bakteriel kunstige kromosomer (Bac), cosmids eller plasmider)31. Denne tekniske udfordring har forhindret os i at visualisere MS2 sekvenser på kromosom spreads, som repræsenterer en begrænsning af protokollen. En yderligere begrænsning af metoden er tid og den indsats, der kræves for at vælge TERRA-MS2 kloner. Derudover er specifikke laboratorium oprettet og udstyr til brug af vira, radioaktivt materiale og mikroskopi analyser påkrævet.

Metoden beskrevet her kan gennemføres for generation af TERRA-MS2 kloner i forskellige cellelinier for at definere TERRA dynamik i forskellige biologiske sammenhænge, såsom under telomere dysfunktion eller cellular gulne, hjælper os med at forstå funktionen af TERRA i disse processer. En interessant udvikling af denne tilgang vil blive generation af TERRA-MS2 kloner indeholdende Millie gentager integreret på en bestemt subtelomere, herunder MS2-tagged telomere. Udtryk for en TetR protein smeltet til en fluorescerende proteiner (dvs. mCherry) vil tillade visualisering af dette særlige Telomer i levende celler32. Denne fremgangsmåde vil give undersøgelse om menneskelige TERRA udskrifter lokalisere og agere i cis på TERRA transskribere telomere og kromosom eller i trans ved at flytte til andre kromosomer. Dette spørgsmål i biologi af TERRA stadig afklares.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer ikke konkurrerende finansielle interesser

Acknowledgments

Vi er taknemmelige for ansatte i den avancerede billedbehandling anlæg i CIBIO på universitetet i Trento og BioOptics lys mikroskopi facilitet på Max F. Perutz laboratorier (MFPL) i Wien. Forskning fører til disse resultater har modtaget støtte fra Mahlke-Obermann Stiftung og EUs syvende rammeprogram for forskning, teknologisk udvikling og demonstration under tilskudsaftalen ingen 609431 til EF. EF er understøttet af en Rita Levi Montalcini stipendium fra det italienske ministerium for uddannelse University og forskning (MIUR).

Materials

Name Company Catalog Number Comments
AGS cells - - Gift from Christian Baron (Université de Montréal).
F12K Nut Mix 1X GIBCO 21127022 Culturing medium for AGS cells
L-Glutamine  CORNING MT25005CI Component of cell culturing medium
Penicillin Streptomycin Solution CORNING 30-002-CI Component of cell culturing medium
Fetal Bovine Serum Sigma Aldrich F2442 Component of cell culturing medium
DMEM 1X GIBCO 21068028 culturing medium for phoenix cell
CaCl2 Sigma Aldrich C1016 used in phoenix cell transfection
HEPES Sigma Aldrich H3375 used in phoenix cell transfection (HBS solution)
KCl Sigma Aldrich P9333 used in phoenix cell transfection (HBS solution)
Dextrose Sigma Aldrich D9434 used in phoenix cell transfection (HBS solution)
NaCl Sigma Aldrich S7653 used in phoenix cell transfection (HBS solution) and retrovirus precipitation
Na2HPO4 Sigma Aldrich S3264 used in phoenix cell transfection (HBS solution)
TRYPSIN EDTA SOLUTION 1X CORNING 59430C used in cell split
DPBS 1X GIBCO 14190250 Dulbecco's Phosphate Buffered Saline
DMSO Sigma Aldrich D8418 Component of cell freezing medium (80% FBB and 20% DMSO)
G-418 Disulphate Formedium G4185 selection drug for 
Gelatin solution Bioreagent Sigma Aldrich G1393 cotaing of 96 well DNA plate and freezing plate
Tris-base Fisher BioReagents 10376743 Component of Cell lysis buffer for genomic DNA extraction
EDTA Sigma Aldrich E6758 Component of Cell lysis buffer for genomic DNA extraction
SDS Sigma Aldrich 71729 Component of Cell lysis buffer for genomic DNA extraction
Proteinase K Thermo Fisher AM2546 Component of Cell lysis buffer for genomic DNA extraction
RNAse A Thermo Fisher 12091021 RNA degradation during DNA extraction
Agarose Sigma Aldrich A5304 DNA gel preparation
Atlas ClearSight Bioatlas BH40501 Stain reagent used for detecting DNA and RNA samples in agarose gel
ethanol Fisher BioReagents BP28184 DNA precipitation
Sodium Acetate  Sigma Aldrich 71196 Used for DNA precipitation at a 3M concentration pH5.2
Wizard SV Gel and PCR clean-Up system Promega A9282 Extraction of PCR fragments from agarose gel during PCR screening of neomycin positive clones
Trizol AMBION 15596018 Organic solvent used for RNA extraction
Dnase I THERMO SCIENTIFIC 89836 degradation of genomic DNA from RNA 
dNTPs mix Invitrogen 10297018 used in RT and PCR reactions
DTT Invitrogen 707265ML used in RT reactions
diethyl pyrocarbonate Sigma Aldrich D5758 used to inactivate RNAses in water (1:1000 dilution)
Ribolock Thermo Fisher EO0381 RNase inhibitor
MOPS Sigma Aldrich M9381 preparation of RNA gel
Paraformaldehyde Electron Microscopy Sciences 15710 preparation of denaturating RNA gel (1% PFA in 1x MOPS)
Superscript III Reverse transcriptase Invitrogen 18080-093 Retrotranscription reaction
Pfu DNA polymerase (recombinant) Thermo Scientific EP0501 PCR reaction
2X qPCRBIO SyGreen Mix Separate-ROX PCR BIOSYSTEMS PB 20.14 qPCR reaction
Cre-GFP adenovirus https://medicine.uiowa.edu/vectorcore 1174-HT used to infect TERRA-MS2 clones in order to remove the neomycn gene
Sodium Butyrate Sigma Aldrich B5887 used to promote retrovirus particles production in phoenix cells
PEG8000 Sigma Aldrich 89510 Precipitation of retrovirus partcles
35µ-Dish Glass Bottom Ibidi 81158 used in live cell imaging analyses of TERRA-MS2 clones

DOWNLOAD MATERIALS LIST

References

  1. Azzalin, C. M., Reichenbach, P., Khoriauli, L., Giulotto, E., Lingner, J. Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science. 318, (5851), 798-801 (2007).
  2. Schoeftner, S., Blasco, M. A. Developmentally regulated transcription of mammalian telomeres by DNA-dependent RNA polymerase II. Nature Cell Biology. 10, (2), 228-236 (2008).
  3. Diman, A., Decottignies, A. Genomic origin and nuclear localization of TERRA telomeric repeat-containing RNA: from Darkness to Dawn. FEBS Journal. (2017).
  4. Arnoult, N., Van Beneden, A., Decottignies, A. Telomere length regulates TERRA levels through increased trimethylation of telomeric H3K9 and HP1alpha. Nature Structural & Molecular Biology. 19, (9), 948-956 (2012).
  5. Montero, J. J., et al. TERRA recruitment of polycomb to telomeres is essential for histone trymethylation marks at telomeric heterochromatin. Nature Communications. 9, (1), 1548 (2018).
  6. Beishline, K., et al. CTCF driven TERRA transcription facilitates completion of telomere DNA replication. Nature Communications. 8, (1), 2114 (2017).
  7. Arora, R., et al. RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells. Nature Communications. 5, 5220 (2014).
  8. Balk, B., et al. Telomeric RNA-DNA hybrids affect telomere-length dynamics and senescence. Nature Structural & Molecular Biology. 20, (10), 1199-1205 (2013).
  9. Graf, M., et al. Telomere Length Determines TERRA and R-Loop Regulation through the Cell Cycle. Cell. 170, (1), 72-85 (2017).
  10. Lee, Y. W., Arora, R., Wischnewski, H., Azzalin, C. M. TRF1 participates in chromosome end protection by averting TRF2-dependent telomeric R loops. Nature Structural & Molecular Biology. (2018).
  11. Moravec, M., et al. TERRA promotes telomerase-mediated telomere elongation in Schizosaccharomyces pombe. EMBO Reports. 17, (7), 999-1012 (2016).
  12. Cusanelli, E., Romero, C. A., Chartrand, P. Telomeric noncoding RNA TERRA is induced by telomere shortening to nucleate telomerase molecules at short telomeres. Molecular Cell. 51, (6), 780-791 (2013).
  13. Moradi-Fard, S., et al. Smc5/6 Is a Telomere-Associated Complex that Regulates Sir4 Binding and TPE. PLoS Genetics. 12, (8), e1006268 (2016).
  14. Chu, H. P., et al. TERRA RNA Antagonizes ATRX and Protects Telomeres. Cell. 170, (1), 86-101 (2017).
  15. Lai, L. T., Lee, P. J., Zhang, L. F. Immunofluorescence protects RNA signals in simultaneous RNA-DNA FISH. Experimental Cell Research. 319, (3), 46-55 (2013).
  16. Zhang, L. F., et al. Telomeric RNAs mark sex chromosomes in stem cells. Genetics. 182, (3), 685-698 (2009).
  17. Gallardo, F., Chartrand, P. Visualizing mRNAs in fixed and living yeast cells. Methods in Molecular Biology. 714, 203-219 (2011).
  18. Querido, E., Chartrand, P. Using fluorescent proteins to study mRNA trafficking in living cells. Methods in Cell Biology. 85, 273-292 (2008).
  19. Cusanelli, E., Chartrand, P. Telomeric noncoding RNA: telomeric repeat-containing RNA in telomere biology. Wiley Interdisciplinary Reviews: RNA. 5, (3), 407-419 (2014).
  20. Perez-Romero, C. A., Lalonde, M., Chartrand, P., Cusanelli, E. Induction and relocalization of telomeric repeat-containing RNAs during diauxic shift in budding yeast. Current Genetics. (2018).
  21. Avogaro, L., et al. Live-cell imaging reveals the dynamics and function of single-telomere TERRA molecules in cancer cells. RNA Biology. 1-10 (2018).
  22. Ran, F. A., et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell. 154, (6), 1380-1389 (2013).
  23. Yamada, T., et al. Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres. Scientific Reports. 6, 38910 (2016).
  24. Deng, Z., et al. Formation of telomeric repeat-containing RNA (TERRA) foci in highly proliferating mouse cerebellar neuronal progenitors and medulloblastoma. Journal of Cell Science. 125, (Pt 18), 4383-4394 (2012).
  25. Casini, A., et al. A highly specific SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology. 36, (3), 265-271 (2018).
  26. Nergadze, S. G., et al. CpG-island promoters drive transcription of human telomeres. RNA. 15, (12), 2186-2194 (2009).
  27. Porro, A., et al. Functional characterization of the TERRA transcriptome at damaged telomeres. Nature Communications. 5, 5379 (2014).
  28. Farnung, B. O., Brun, C. M., Arora, R., Lorenzi, L. E., Azzalin, C. M. Telomerase efficiently elongates highly transcribing telomeres in human cancer cells. PLoS One. 7, (4), e35714 (2012).
  29. Flynn, R. L., et al. Alternative lengthening of telomeres renders cancer cells hypersensitive to ATR inhibitors. Science. 347, (6219), 273-277 (2015).
  30. Scheibe, M., et al. Quantitative interaction screen of telomeric repeat-containing RNA reveals novel TERRA regulators. Genome Research. 23, (12), 2149-2157 (2013).
  31. Bolland, D. J., King, M. R., Reik, W., Corcoran, A. E., Krueger, C. Robust 3D DNA FISH using directly labeled probes. Journal of Visualized Experiments. (78), (2013).
  32. Masui, O., et al. Live-cell chromosome dynamics and outcome of X chromosome pairing events during ES cell differentiation. Cell. 145, (3), 447-458 (2011).
Generation af kræft celle kloner til at visualisere Telomeric Repeat-holdige RNA TERRA udtrykt fra en enkelt Telomer i levende celler
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).More

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter