Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Induktion und Bewertung der Graft-Versus-Host-Krankheit in einem xenogenen Murine-Modell und Quantifizierung menschlicher T-Zellen in Mausgeweben mit digitaler PCR

doi: 10.3791/59107 Published: May 23, 2019

Summary

Hier stellen wir ein Protokoll zur Induzieren und Bewertung von Krankheiten bei einem xenogenen Transplantat-versus-Host-Krankheitsmodell (XenoGVHD) vor. xenoGVHD bietet ein In-vivo-Modell zur Untersuchung der Immunsuppression menschlicher T-Zellen. Darüber hinaus beschreiben wir, wie man menschliche T-Zellen in Geweben mit digitaler PCR als Werkzeug zur Quantifizierung der Immunsuppression erkennt.

Abstract

Akute Transplantat-versus-Host-Krankheit (GVHD) ist eine signifikante Einschränkung für Patienten, die hämatopoetische Stammzelltransplantation als Therapie für hämatologische Mängel und Bösartige Nagenzen erhalten. Akute GVHD tritt auf, wenn Spender-T-Zellen Wirtgewebe als fremdes Antigen erkennen und eine Immunantwort auf den Wirt montieren. Aktuelle Behandlungen beinhalten toxische immunsuppressive Medikamente, die Patienten anfällig für Infektionen und Rezidiven machen. Daher gibt es laufende Forschung, um eine akute GVHD-Therapie zu bieten, die effektiv auf Spender-T-Zellen abzielen und Nebenwirkungen reduzieren kann. Ein Großteil dieser präklinischen Arbeit verwendet das xenogene GVHD (XenoGVHD) murinen Modell, das es ermöglicht, immunsuppressive Therapien an menschlichen Zellen zu testen, anstatt murine Zellen in einem In-vivo-System. Dieses Protokoll beschreibt, wie XenoGVHD induziert werden kann und wie man die klinische Bewertung blind und standardisiert, um konsistente Ergebnisse zu gewährleisten. Darüber hinaus beschreibt dieses Protokoll, wie digitale PCR verwendet werden, um menschliche T-Zellen in Mausgeweben zu erkennen, die anschließend zur Quantifizierung der Wirksamkeit getesteter Therapien verwendet werden können. Das xenoGVHD-Modell bietet nicht nur ein Modell zum Testen von GVHD-Therapien, sondern jede Therapie, die menschliche T-Zellen unterdrücken kann, die dann auf viele entzündliche Erkrankungen angewendet werden könnten.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Allogene hämatopoetische Stammzelltransplantation (HSCT) ist zu einer Routinebehandlung für Patienten geworden, die an hämatologischen Malignomen wie Leukämie mit schlechter Prognose leiden. Eine signifikante Komplikation von HSCT ist die akute Transplantat-gegen-Wirt-Krankheit (GVHD). Eine Studie aus dem Jahr 2012 berichtete, dass akute syZUde GVHD bei 39 % der HSCT-Patienten, die Transplantationen von Geschwisterspendern erhielten, und 59 % der Patienten, die Transplantationen von nicht verwandten Spendern erhielten, entwickelt wurde1. Akute GVHD tritt auf, wenn von Spendern abgeleitete T-Zellen die Organe des Empfängers angreifen. Die einzige erfolgreiche Therapie für GVHD ist die Behandlung mit hochimmunsuppressiven Medikamenten2, die hochgiftig sind und das Risiko einer Infektion und Tumorwiederkehr erhöhen. So besteht trotz Verbesserungen, die in den letzten Jahren beim akuten GVHD-Überleben erzielt wurden3,4,5, immer noch einen kritischen Bedarf an verbesserten GVHD-Therapien mit minimaler Toxizität, die eine langfristige Remission fördern.

Das übergeordnete Ziel der folgenden Methoden ist es, xenogene GVHD (XenoGVHD) zu induzieren und zu bewerten. Das XenoGVHD-Modell wurde als Werkzeug entwickelt, um akute GVHD mit menschlichen Zellen anstelle von murinen Zellen zu induzieren, was eine direktere Übersetzung der präklinischen GVHD-Forschung in klinische Studienermöglicht 6. Dieses Modell beinhaltet die intravenös injizierende menschliche periphere Mononuklezellen (PBMC) in NOD-SCID IL-2R-null (NSG)-Mäuse, die subletal bestrahlt werden. Injizierte menschliche T-Zellen werden durch menschliche Antigen-präsentierende Zellen (APCs) aktiviert, die murines Antigen darstellen, und die aktivierten T-Zellen wandern zu entfernten Geweben, was zu systemischen Entzündungen und letztlich zum Tod6,7, 8 , 9 , 10. Krankheitspathologie und Progression im XenoGVHD-Modell imitieren die akute GVHD des Menschen. Insbesondere sind die pathogenen menschlichen T-Zellen reaktiv auf murinen Haupthistokompatibilitätskomplex (MHC) Proteine, die der T-Zell-Alloreaktivität in humanen GVHD6,9ähneln. Der Hauptvorteil des XenoGVHD-Modells gegenüber dem MHC-Mismatch-Modell der Maus, dem anderen weit verbreiteten GVHD-Modell, ist, dass es das Testen von Therapien an menschlichen Zellen anstelle von murinen Zellen ermöglicht. Dies ermöglicht das Testen von Produkten, die direkt in die Klinik ohne Änderungen übersetzt werden können, weil sie auf menschliche Zellen ausgerichtet sind. Kürzlich wurde dieses Modell verwendet, um einen menschlichen Anti-IL-2-Antikörper11, humane thymische regulatorische T-Zellen (Tregs)12 und menschliche mesenchymale Stammzellen13 als mögliche Behandlungen für akute GVHD zu testen. In einem breiteren Kontext kann dieses Modell als In-vivo-Unterdrückungstest für jedes Medikament oder jeden Zelltyp verwendet werden, der die Aktivität menschlicher T-Zellen unterdrücken kann. Zum Beispiel, Stockis et al.14 verwendet das xenoGVHD Modell, um die Wirkung der Blockierung integrin 8 auf Treg Unterdrückungsaktivität in vivo zu untersuchen. So kann das xenoGVHD-Modell Einen Einblick in den Mechanismus jeder Therapie geben, die auf T-Zellen in einer In-vivo-Einstellung abzielt.

Eine weitere in diesem Protokoll beschriebene Methode ist die Erkennung menschlicher T-Zellen in Mausgeweben mithilfe der digitalen Polymerase-Kettenreaktion (dPCR). Das Ziel dieser Methode ist es, ein Werkzeug zur Quantifizierung der Migration und Proliferation von T-Zellen in Zielgeweben anzubieten, die die Wirksamkeit von immunsuppressiven Therapien messen, die in diesem Modell getestet werden. dPCR ist eine relativ neuartige Methode zur Quantifizierung von Nukleinsäuren15. Kurz gesagt, das PCR-Reaktionsgemisch ist in Partitionen unterteilt, die eine kleine Anzahl der Zielsequenz oder gar kein Ziel enthalten. Die Zielsequenz wird dann verstärkt und mit DNA-Interkalierenden Farbstoffen oder fluoreszierenden zielspezifischen Sonden nachgewiesen. dPCR quantifiziert die Anzahl der Kopien der Zielsequenz basierend auf dem Bruchteil der positiven Partitionen und Poissons Statistiken15,16. Die Detektion von T-Zellen mit dPCR erfordert im Vergleich zu anderen alternativen Methoden, einschließlich Durchflusszytometrie und Histologie, viel weniger Gewebe und kann auf gefrorenem oder festem Gewebe durchgeführt werden. dPCR benötigt keine Standardkurve zur Ermittlung von Kopiernummern und auch keine technischen Replikationen. Dies reduziert die Menge an Reagenz und Vorlagen-DNA, die für dPCR benötigt wird, im Vergleich zu herkömmlichen quantitativen PCR (qPCR)16. Die Aufteilung der PCR-Reaktion in Subreaktionen in dPCR konzentriert effektiv die Ziele17. Somit ist dPCR in erster Linie ein Werkzeug zum Nachweis seltener Ziele in einer großen Menge an Nicht-Ziel-DNA. Zum Beispiel wird dPCR verwendet, um bakterielle Kontamination in Milch18zu erkennen, seltene Mutationen im Östrogenrezeptorgen19zu identifizieren und zirkulierende Tumor-DNA im Blut von Patienten zu erkennen20. In diesem Protokoll dient dPCR als effizientes Werkzeug zur Detektion und Quantifizierung menschlicher T-Zellen in Geweben von Mäusen mit XenoGVHD.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle Mausexperimente wurden in Übereinstimmung mit Zustimmung des University of Kansas Medical Center Institutional Animal Care and Use Committee durchgeführt. Alle gesunden menschlichen Blutproben wurden mit informierter Zustimmung und mit Zustimmung des Institutional Review Board am University of Kansas Medical Center gewonnen.

1. Bestrahlung von NSG-Mäusen

  1. Einen Tag vor der PBMC-Injektion bestrahlen 8–12 Wochen alte NSG-Mäuse (entweder Geschlecht kann verwendet werden). In einem sterilen Biosicherheitsschrank Mäuse in einen sterilisierten Tortenkäfig oder Mikroisolator legen. Bestrahlung von Mäusen in einer Cs137-Quelle oder einem Kleintierbestrahlungskörper (z. B. RS 2000) mit einer Gesamtdosis von 150 cGy mit langsamer Rotation, um eine gleichmäßige Bestrahlung zu gewährleisten.
  2. Legen Sie Mäuse in saubere Käfige in einem sterilen Biosicherheitsschrank.

2. Vorbereitung der menschlichen PBMC zur Injektion

  1. Sammeln Sie genug gesundes menschliches Blut, um 1,1 x 107 PBMC pro Maus zu isolieren. Verdünnen Sie das heparinisierte Blut in einem gleichen Volumen von 2% fetalem Rinderserum (FBS) in Phosphatgepufferter Saline (PBS).
    HINWEIS: Mit diesem Protokoll beträgt die PMBC-Ausbeute in der Regel 0,5–1 x 107 pro 10 ml Vollblut. Jede Maus erhält 107 PBMC in 100 L PBS. Die zusätzlichen 1 x 106 in 10 l pro Maus sorgen dafür, dass jede Maus die volle Dosierung von PBMC erhält, falls es Probleme mit Füllspritzen gibt.
  2. 15 ml Lymphozyten-Trenndichte-Gradientenmedium (z. B. Ficoll) zu einem 50 ml konischen Rohr geben und dann bis zu 25 ml verdünntes Blut über den Dichtegradienten sorgfältig überlagern. Zentrifugieren Sie das Rohr mit Dichtegradienten und verdünntem Blut bei 400 x g für 40 min bei Raumtemperatur ohne Bremse.
  3. Ernten Sie die PBMC-Schnittstelle in 10 ml PBS in einem 50 ml konischen Rohr. Zentrifugieren Sie die Zellen bei 400 x g für 10 min. Entfernen Sie den Überstand.
  4. Pellet durch Flicken von Rohren lösen und in 10 ml PBS wieder aufhängen, um die PBMC zu waschen. Zentrifugieren Sie die Zellen bei 400 x g für 5 min.
  5. (Optional) Entsorgen Sie die überstandenen und lyseroten Blutkörperchen (RBCs) im Zellpellet, indem Sie ein Volumen von Ammonium-Chlorid-Kalium (ACK) Lysepuffer hinzufügen, der dem Pelletvolumen entspricht. Das Pellet vorsichtig wieder aufhängen und das Rohr für 30–60 s wirbeln. Rohr mit serumfreien RPMI-Medien füllen und das Rohr bei 400 x g für 5 min zentrieren.
  6. Entfernen Sie den Überstand und hängen Sie das Zellpellet in 5 ml PBS wieder auf. Zählen Sie die Zellen mit Trypanblau-Ausschluss mit einem Hämozytometer und einem Mikroskop.
  7. Zentrifugieren Sie die Zellen bei 400 x g für 5 min. Entfernen Sie den Überstand und setzen Sie die Zellen bei 1 x 108 Zellen/ml in PBS wieder auf.

3. Retro-orbitale Injektion von humaner PBMC in Mäuse21

  1. Legen Sie eine Anästhesiekammer in eine laminare Strömungshaube, um die Sterilität aufrechtzuerhalten. Vorladung der Anästhesiekammer mit 5% Isofluran und 1 L/min Sauerstoffdurchfluss rate für 5 min.
  2. Isofluran auf 2% reduzieren und Mäuse aus demselben Käfig in die Anästhesiekammer geben. Sobald Mäuse die Rechte verlieren, befeuchten Sie Mäuse für 5 min in der Kammer. Während dieser Zeit, Vorfüllspritze mit 100 l (1 x 107 Zellen) der Zellsuspension.
  3. Legen Sie die Maus auf ein Heizkissen mit der Nase in einen Nasenkegel, um die Anästhesie aufrechtzuerhalten. Überprüfen Sie auf Bewusstseinsverlust, indem Sie ein Fußpolster kneifen und auf reflexmangelhaftüberprüfen.
  4. Beschränken Sie die Maus mit dem Daumen und Mittelfinger. Setzen Sie die 28 G 1/2 in die Nadel mit der Abschrägung seitlich zum medialen Canthus, durch die Bindehautmembran, bis die Rückseite des Auges erreicht ist. Ziehen Sie die Nadel leicht zurück und injizieren Sie langsam 100 l Zellen (1 x 107 Zellen).
  5. Ziehen Sie die Nadel vollständig zurück und entsorgen Sie die Spritze und Nadel ordnungsgemäß. Schließen Sie das Augenlid und setzen Sie mit einem Gazeschwamm leichten Druck auf die Injektionsstelle aus.
  6. Untersuchen Sie die Injektionsstelle auf Schwellungen oder andere sichtbare Traumata. Lassen Sie die Maus das Bewusstsein in einem sterilen Käfig mit Papiertüchern zu gewinnen, um das Streben der Bettwäsche zu verhindern, bevor Sie in den Käfig nach Hause ziehen. Nachdem jede Blutung aufgehört hat, wenden Sie einen einzigen Tropfen Proparacain eisig auf das Auge für Analgesie.
    HINWEIS: Die Schwanzveneninjektion ist eine alternative Methode der intravenösen Injektion von PBMC für dieses Protokoll, wie von Macholz et al.22beschrieben.

4. Klinische Bewertung der akuten GVHD bei Mäusen (Abbildung 1)23

  1. Messen Sie die GVHD-Punktzahl jeden zweiten Tag, bis Mäuse eine Punktzahl von 2 erreichen und dann jeden Tag bis zum Tag des Opfers.
    1. Legen Sie den Käfig in eine laminare Fließhaube, entfernen Sie die Nahrung und das Wasser und setzen Sie den Deckel wieder auf. Score-Aktivität durch beobachten Mäuse für 5 min und weisen Sie Partituren wie folgt: 0 = Maus beginnt innerhalb von ein paar Minuten zu gehen und läuft um Käfig, 1 = Maus dauert mehr als ein paar Minuten, um aufzustehen und geht langsam um Käfig, 2 = Maus nicht aufstehen in 5 min und geht nur, wenn berührt.
  2. Wiegen Sie jede Maus in einem Glasbecher und geben Sie eine Gewichtsabnahme Punktzahl: 0 = <10% Veränderung, 1 = 10-25% Veränderung und 2 = >25% Veränderung.
  3. Während die Maus noch im Becher ist, überprüfen Sie die Haltung: 0 = normal, 1 = Inruhe, 2 = Knicken beeinträchtigt die Bewegung; Felltextur: 0 = normal, 1 = leichtes bis mäßiges Rüschen, 2 = starkes Rüschen und Hautintegrität : 0 = normal, 1 = Skalierung der Pfoten/Schwanz, 2 = offensichtliche Bereiche der denuded Haut (siehe Ohren, Schwanz und Pfoten für die Skalierung).
  4. Mit fünf Kategorien und einer Punktzahl von 0:2 für jede Kategorie kann eine Maus eine maximale Punktzahl von 10 erreichen. Wenn eine Maus eine Punktzahl von 7 oder mehr erreicht oder 42 Tage nach der Injektion erreicht, euthanisieren Sie die Maus über CO2 Euthanasie oder eine andere Methode, die vom lokalen Institutionellen Tierpflege- und Nutzungsausschuss genehmigt wurde.
    HINWEIS: Um die Genauigkeit der Ergebnisse zu gewährleisten, wird die Bewertung von einem Forscher durchgeführt, der für die Behandlungsgruppen24geblendet ist. Darüber hinaus, obwohl >20% der Körpergewichtsabnahme ist der empfohlene humane Endpunkt für viele IACUC-Protokolle, mit zusätzlicher Begründung IACUC-Zulassung dieses Protokolls erhalten werden kann.

5. Ernte von Geweben für genomische DNA von eingeschläferten Mäusen und Isolierung genomischer DNA

  1. Sezieren Sie Mäuse mit sterilen chirurgischen Werkzeugen. Schneiden Sie ein kleines, etwa 3 mm x 0,5 mm großes Gewebe aus einem von Interesse sindden Organ, z. B. Lunge, Leber oder Milz. Wiegen Sie die Gewebeprobe und legen Sie das Gewebestück in ein steriles 1,5 ml-Rohr. Wenn Sie mehrere Gewebe sammeln, waschen Sie Werkzeuge mit Ethanol zwischen dem Schneiden jedes Organs.
  2. Einfrieren von Geweben, indem Sie die Rohre, die das Gewebe in flüssigem Stickstoff enthalten, einfrieren, bis es aufhört zu sprudeln und über Nacht in -80 °C lagern. Tauen Sie die Gewebeproben und lyse sie nach einem genomischen DNA (gDNA) Isolationkit.
  3. Isolieren Sie die genomische DNA gemäß den Anweisungen des Herstellers, wie im Kit beschrieben. Beachten Sie unbedingt die Menge an Gewebe, die pro Mikroliter eluierter gDNA (mg/L) verarbeitet wurde.
    HINWEIS: Gefrorenegewebe können bei -80 °C zur späteren Verarbeitung gelagert werden.

6. Quantifizierung menschlicher T-Zellen mit digitaler PCR (Abbildung 2)

  1. Bereiten Sie digitale PCR-Reaktionen gemäß dem Protokoll für DNA-Bindungsfarbstoffe für die verwendete digitale PCR-Maschine vor. Verwenden Sie die folgenden Primer speziell für menschliche CD3-Epsilon-Genom-DNA (NCBI-Referenzsequenz: NG_007383.1); Forward Primer: AGGCTGCCTTAACTCCCAAG, Reverse Primer: GCCCTACCCTCTGGAAAC. Diese Primer ergeben ein einzelnes Band von 105 bp.
    ANMERKUNG: Fügen Sie jeder Reaktion zur Verdauung der genomischen DNA 0,5 l eines Restriktionsenzyms wie HindIII hinzu. Achten Sie darauf, verschiedene gDNA-Verdünnungen zu testen, um die Trennung von positiven und negativen Tröpfchen zu optimieren. Darüber hinaus kann eine Teilmenge der infiltrierenden T-Zellen nicht pathogene regulatorische T-Zellen sein. Diese Zellen können mit zusätzlichen Primern für regulatorische T-Zellmarker quantifiziert werden.
  2. Führen Sie die digitale PCR-Reaktion unter folgenden Bedingungen durch: Deckel bei 105 °C, 95 °C für 10 min (1 Zyklus); 95 °C für 30 s, Rampe 2 °C/s und 55 °C für 1 min, Rampe 2 °C/s (40 Zyklen); 72 °C für 10 min, 12 °C halten.
    HINWEIS: Diese Parameter müssen möglicherweise abhängig von digitalen PCR-Geräten angepasst werden.
  3. Erfassen Sie digitale PCR-Daten mit Analysesoftware. Berichtsdaten als Anzahl von Kopien pro mg Gewebe unter Verwendung der folgenden Gleichung: (Anzahl der Kopien/L) x (l gDNA in Reaktion) x (Verdünnungsfaktor)/(mg Gewebe/L der gesamtgDNA )

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Sublethal bestrahlte 8-12-Wochen alte NSG-Mäuse beiderlei Geschlechts, die menschliches PBMC erhielten, begannen mit der Anzeige klinischer Anzeichen von GVHD um Tag 10 nach der Injektion im Vergleich zu Negativkontrollmäusen, die nur PBS erhielten (Abbildung 1A). XenoGVHD-Mäuse hatten ein medianes Überleben von 23,5 Tagen (Abbildung1B). Mit digitaler PCR konnten CD3-Epsilon-positive menschliche T-Zellen in der Lunge und Leberproben von Mäusen nachgewiesen werden, die menschliches PBMC erhielten. Als Kontrollelemente wurden Gewebeproben von Mäusen verwendet, die mit PBS injiziert wurden (Abbildung 2).

Figure 1
Abbildung 1: Fortschreiten der GVHD-Krankheit. Sublethal bestrahlte 8-12 Wochen alte männliche und weibliche NSG-Mäuse wurden retro-orbital mit 1 x 107 humanem PBMC (n = 6) oder PBS (n = 4) als Negativkontrolle injiziert. Die gezeigten Daten sind die kombinierten Ergebnisse von drei unabhängigen Experimenten. (A) Der GVHD-Wert wurde jeden zweiten Tag gemessen, bis die Mäuse eine Punktzahl von 2 erreichten und dann jeden Tag bis zum Tag des Opfers. Die zu jedem Zeitpunkt für den GVHD-Score gemeldeten Daten sind der mittlere SEM-Score der lebenden Mäuse in Kombination mit den letzten Werten aller verstorbenen Mäuse in jeder Gruppe. * p < 0,05 gemäß Mann Whitney U Test. (B) Kaplan-Meier-Überlebenskurve. Der Tod wurde markiert, als der GVHD-Score 7 Betrug betrug. * p < 0,05 nach Log-Rank-Test. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 2
Abbildung 2: Detektion menschlicher T-Zellen mit digitaler PCR. Lungen- und Leberproben wurden von Mäusen entnommen, die retro-orbital mit PBS (n = 3) oder 1 x 107 humanem PBMC (n = 3) injiziert wurden, wenn Mäuse einen GVHD-Wert von 7 oder 42 Tagen nach der Injektion erreichten. Die Daten wurden aus 3 unabhängigen Experimenten gesammelt. gDNA wurde isoliert und digitale PCR wurde verwendet, um die Kopien von humanem CD3 Epsilon pro Milligramm Gewebe zu bestimmen. (A) Repräsentatives digitales PCR-Diagramm von Lungen- und Leberproben einer Maus, die mit PBS oder PBMC injiziert wurde. (B) Quantifizierung von Kopien von humanem CD3 Epsilon pro Promille gewebe von Mäusen, die mit PBS oder PBMC injiziert wurden. * p x 0,05 gemäß Mann Whitney U-Test. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Die Krankheitsprogression ist im XenoGVHD-Modell im Allgemeinen konsistent, selbst bei Injektion von PBMC von verschiedenen Spendern, so dass mehrere Experimente kombiniert werden können. Die wichtigsten Schritte, die erforderlich sind, um diese Konsistenz zu erhalten, sind die richtige i.v. Injektionstechnik, Blendung und konsistente Bewertung. Eine Studie von Nervi et al.25 zeigte, dass im Vergleich zur intravenösen Schwanzveneninjektion retro-orbitale Injektionen von PBMC zu einer konsistenteren Engraftmentierung und schwereren GVHD führten. Leon-Rico et al.26 zeigten auch, dass retro-orbitale Injektionen zu einer konsistenteren hämatopoetischen Stammzellentransplantation bei Mäusen im Vergleich zur Schwanzveneninjektion führten. Bei Bedarf können jedoch Schwanzveneninjektionen als alternative Methode im XenoGVHD Modell27,28,29verwendet werden.

Das Problem der Variabilität der Ergebnisse im Zusammenhang mit Schwanz Veneninjektionen kann durch die Erhöhung der Anzahl der Probanden reduziert werden. Darüber hinaus ist es wichtig, dass die Person, die die Mäuse bewertet, für die Mausbehandlung geblendet wird, um Verzerrungen bei der Bewertung subjektiverer Kriterien wie Aktivität oder Felltextur zu vermeiden. Wie wichtig die blinde GVHD-Bewertung ist, hat sich auch in der Klinik24gezeigt. Die Person, die die Mäuse injiziert, sollte nicht dieselbe Person sein, die die Mäuse bewertet. Wenn dies nicht möglich ist, können Kontroll- und Behandlungsröhrchen von einer anderen Person randomisiert und mit neuen IDs beschriftet werden (d. h. Die Kontrolle ist A, die Behandlung ist B), so dass Injektionen geblendet werden können. Maus-Scoring sollte etwa zur gleichen Zeit jeden Tag und an den gleichen Tagen nach der Injektion zwischen verschiedenen Experimenten durchgeführt werden.

Ein potenzielles Hindernis in diesem Modell ist der Mangel an GVHD-Entwicklung. Dies könnte auf die verminderte Lebensfähigkeit von PBMC zurückzuführen sein, die durch die Überprüfung der Lebensfähigkeit von PBMC durch Zählen von Zellen mit Trypanblau behoben werden kann. Wenn Probleme mit der Zelllebensfähigkeit auftreten, können die Zellen in PBS mit 2% FBS ergänzt werden, um das Überleben zu verbessern. Außerdem können weniger Mäuse gleichzeitig injiziert werden, um die Zeit zu reduzieren, in der Zellen bei Raumtemperatur sitzen. Die Wirksamkeit der retro-orbitalen Injektion kann das Problem sein. Mäuse, die mit PBMC injiziert werden, aber keine GVHD entwickeln, können eingeschläfert werden und Immunzellen, die aus ihren Milz isoliert werden, können über dPCR oder Durchflusszytometrie auf das Vorhandensein menschlicher Zellen analysiert werden. Wenn es eine schlechte Transplantation gibt, dann gibt es wahrscheinlich ein Problem mit der Injektionstechnik. Als Test der Injektionstechnik können Mäuse retro-orbital mit 200 L Evans blauer Farbstoff injiziert werden. Wenn die Injektion erfolgreich ist, werden die Ohren, Pfoten und Schwanz der Maus blau.

Das xenoGVHD-Modell imitiert die akute GVHD-Krankheit des Menschen und das Fortschreiten30. Im Gegensatz zum murinen MHC-Mismatch-GVHD-Modell ermöglicht das XenoGVHD-Modell das Testen der Wirkung immunsuppressiver Therapien, einschließlich menschlicher Zelltherapien, auf menschliche Zellen anstelle von murinen Zellen. Dies reduziert die Variation aufgrund von Artenunterschieden bei der Anwendung von Forschungsergebnissen auf die Klinik. Das xenoGVHD-Modell kann auch als In-vivo-Unterdrückungstest in anderen Bereichen der T-Zellforschung dienen. So können Ergebnisse aus Experimenten mit dem XenoGVHD-Modell auf jede menschliche T-Zell-vermittelte entzündliche Erkrankung zusätzlich zu GVHD angewendet werden.

Es gibt Einschränkungen beim xenoGVHD-Modell. Dazu gehören experimentelle Variabilität und mögliche Unterschiede in der GVHD-Behandlung im Vergleich zur Klinik. Experimentelle Inkonsistenzen können auf Unterschiede in der MausStamm, Standorte der PBMC-Injektion, Strahlendosis und mikrobielle Umgebung30,31. Daher sollten Laboratorien, die dieses Modell verwenden, versuchen, diese Parameter zu standardisieren, um konsistente Ergebnisse zu gewährleisten. In diesem Protokoll beschreiben wir Bewertungsmethoden, die dazu beitragen, die Variabilität in der Bewertung zu reduzieren. Zu den Faktoren, die die Vergleichbarkeit von XenoGVHD-Daten mit klinischen Ergebnissen einschränken können, gehören der Mangel an Kontrollgruppen, die mit GVHD-Prophylaxemedikamenten behandelt werden, und die Verwendung von Bestrahlung als einzige Rintherungsquelle im XenoGVHD-Modell31. Darüber hinaus rekapituliert der Mechanismus von xenoGVHD die zugrunde liegende Pathogenese bei humaner GVHD nicht vollständig. Beispielsweise sind es Spender-APCs und nicht Host-APCs, die menschliche T-Zellen im xenoGVHD-Modell aktivieren, während Host-APCs eine wichtige Rolle in menschlichen GVHD7spielen. So gibt es, wie bei den meisten präklinischen Modellen, Inkonsistenzen und Inkompatibilitäten zwischen XenoGVHD und humaner GVHD, die die Anwendung von Daten, die aus dem xenoGVHD erzeugt werden, auf die Klinik beschränken können.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Es wurden keine Interessenkonflikte angemeldet.

Acknowledgments

Wir möchten das Labor von Lane Christenson für die Bereitstellung der digitalen PCR-Maschine, die in diesen Experimenten verwendet wird, und für die technische Unterstützung würdigen. Wir danken auch Dr. Thomas Yankee für seine Beratung und Mentoring. Diese Studien wurden von der Tripp Family Foundation unterstützt.

Materials

Name Company Catalog Number Comments
1.5 mL eppendorf tubes Fisher 05-408-129
10 mL serological pipet VWR International 89130-898
10mL BD Vacutainers - Green capped with Sodium Heparin Becton Dickinson 366480
250 µL Ranin pipette tips Rainin 17001118 Do not use other pipettes or pipet tips for droplet generation
50 mL conical tube VWR International 89039-656
96-Well ddPCR plate Bio-Rad 12001925
ACK (Ammonium-Chloride-Potassium) Lysing Buffer Lonza 10-548E Optional
Alcohol Wipes Fisher Scientific 6818
Anesthesia Chamber World Precision Instruments EZ-178 Provided by animal facility
Anesthesia Machine Parkland Scientific PM1002 Provided by animal facility
BD Vacutainer Safety-Lok Blood Collection Set Becton Dickinson 367281
DG8 Cartridges and Gaskets for QX100/QX200 Droplet Generator Bio-Rad 1864007
DNAse and RNAse free Molecular Grade H2O Life Technologies 1811318
Ethyl alcohol, Pure,200 proof, for molecular biology Sigma-Aldrich E7023-500ML
Fetal Bovine Serum Atlanta Biologicals S11150
Ficoll Fisher Scientific 45001750
Insulin Syringe Fisher Scientific 329424
Isoflurane Sigma-Aldrich CDS019936 Provided by animal facility
Liquid nitrogen N/A N/A
Mouse Irradiator Pie Cage Braintree Scientific, Inc. MPC 1 Holds up to 11 mice
Nexcare Gentle Paper Tape (a.k.a. 3M Micropore Surgical Tape / 3/4") Fisher Scientific 19-027-761
P1000 pipetman MidSci A-1000
P200 pipetman MidSci A-200
Pierceable Foil Heat Seal Bio-Rad 1814040
Pipetaid Gilson Macroman Fisher Scientific F110756
Pipet-Lite Multi Pipette L8-200XLS+ Rainin 17013805 Do not use other pipettes or pipet tips for droplet generation
Qiagen DNeasy Blood and Tissue Kit Qiagen 69506
qPCR plates VWR International 89218-292
QX200 Droplet Digital PCR System Bio-Rad 12001925 Includes droplet generator, droplet reader, laptop computer, software, associated component consumables, for EvaGreen or probe-based digital PCR applications
QX200 Droplet Generation Oil for EvaGreen Bio-Rad 1864006
QX200 ddPCR EvaGreen Supermix Bio-Rad 1864033
RNase and DNase-free plate seal Thermo Scientific 12565491
RPMI Advanced 1640 Life Technologies 12633012
Sterile Gauze Pads (2" x 2", 12-Ply) Fisher Scientific 67522
Sterile Phosphate Buffered Saline Fisher Scientific 21040CV
Sterile reservoir VWR International 89094-662
Surgial Scissors Kent Scientific INS600393-4
Surgical Forceps Kent Scientific INS650914-4

DOWNLOAD MATERIALS LIST

References

  1. Jagasia, M., et al. Risk factors for acute GVHD and survival after hematopoietic cell transplantation. Blood. 119, (1), 296-307 (2012).
  2. Bolanos-Meade, J., et al. Phase 3 clinical trial of steroids/mycophenolate mofetil vs steroids/placebo as therapy for acute GVHD: BMT CTN 0802. Blood. 124, (22), quiz 3335 3221-3227 (2014).
  3. Gooley, T. A., et al. Reduced mortality after allogeneic hematopoietic-cell transplantation. New England Journal of Medicine. 363, (22), 2091-2101 (2010).
  4. Hahn, T., et al. Significant improvement in survival after allogeneic hematopoietic cell transplantation during a period of significantly increased use, older recipient age, and use of unrelated donors. Journal of Clinical Oncology. 31, (19), 2437-2449 (2013).
  5. Khoury, H. J., et al. Improved survival after acute graft-versus-host disease diagnosis in the modern era. Haematologica. 102, (5), 958-966 (2017).
  6. King, M. A., et al. Human peripheral blood leucocyte non-obese diabetic-severe combined immunodeficiency interleukin-2 receptor gamma chain gene mouse model of xenogeneic graft-versus-host-like disease and the role of host major histocompatibility complex. Clinical & Experimental Immunology. 157, (1), 104-118 (2009).
  7. Lucas, P. J., Shearer, G. M., Neudorf, S., Gress, R. E. The human antimurine xenogeneic cytotoxic response. I. Dependence on responder antigen-presenting cells. Journal of Immunology. 144, (12), 4548-4554 (1990).
  8. Ito, R., et al. Highly sensitive model for xenogenic GVHD using severe immunodeficient NOG mice. Transplantation. 87, (11), 1654-1658 (2009).
  9. Kawasaki, Y., et al. Comprehensive Analysis of the Activation and Proliferation Kinetics and Effector Functions of Human Lymphocytes, and Antigen Presentation Capacity of Antigen-Presenting Cells in Xenogeneic Graft-Versus-Host Disease. Biology of Blood and Marrow Transplantation. 24, (8), 1563-1574 (2018).
  10. Ito, R., et al. A Novel Xenogeneic Graft-Versus-Host Disease Model for Investigating the Pathological Role of Human CD4(+) or CD8. T Cells Using Immunodeficient NOG Mice. American Journal of Transplantation. 17, (5), 1216-1228 (2017).
  11. Trotta, E., et al. A human anti-IL-2 antibody that potentiates regulatory T cells by a structure-based mechanism. Nature Medicine. 24, (7), 1005-1014 (2018).
  12. Dijke, I. E., et al. Discarded Human Thymus Is a Novel Source of Stable and Long-Lived Therapeutic Regulatory T Cells. American Journal of Transplantation. 16, (1), 58-71 (2016).
  13. Huang, F., et al. Human Gingiva-Derived Mesenchymal Stem Cells Inhibit Xeno-Graft-versus-Host Disease via CD39-CD73-Adenosine and IDO Signals. Frontiers in Immunology. 8, 68 (2017).
  14. Stockis, J., et al. Blocking immunosuppression by human Tregs in vivo with antibodies targeting integrin alphaVbeta8. Proceedings of the National Academy of Sciences of the United States of America. 114, (47), E10161-E10168 (2017).
  15. Vogelstein, B., Kinzler, K. W. Digital PCR. Proceedings of the National Academy of Sciences of the United States of America. 96, (16), 9236-9241 (1999).
  16. Quan, P. L., Sauzade, M., Brouzes, E. dPCR: A Technology Review. Sensors (Basel). 18, (4), (2018).
  17. Sykes, P. J., et al. Quantitation of targets for PCR by use of limiting dilution. Biotechniques. 13, (3), 444-449 (1992).
  18. Ma, H., et al. Evaluation of Bacterial Contamination in Goat Milk Powder Using PacBio Single Molecule Real-Time Sequencing and Droplet Digital PCR. Journal of Food Protection. 1791-1799 (2018).
  19. Vitale, S. R., et al. An optimized workflow to evaluate estrogen receptor gene mutations in small amounts of cell-free DNA. Journal of Molecular Diagnostics. (2018).
  20. Gorgannezhad, L., Umer, M., Islam, M. N., Nguyen, N. T., Shiddiky, M. J. A. Circulating tumor DNA and liquid biopsy: opportunities, challenges, and recent advances in detection technologies. Lab Chip. 18, (8), 1174-1196 (2018).
  21. Yardeni, T., Eckhaus, M., Morris, H. D., Huizing, M., Hoogstraten-Miller, S. Retro-orbital injections in mice. LabAnimal. 40, (5), 155-160 (2011).
  22. Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. Manual restraint and common compound administration routes in mice and rats. Journal of Visualized Experiments. (67), (2012).
  23. Cooke, K. R., et al. An experimental model of idiopathic pneumonia syndrome after bone marrow transplantation: I. The roles of minor H antigens and endotoxin. Blood. 88, (8), 3230-3239 (1996).
  24. Weisdorf, D. J., et al. Prospective grading of graft-versus-host disease after unrelated donor marrow transplantation: a grading algorithm versus blinded expert panel review. Biology of Blood and Marrow Transplantation. 9, (8), 512-518 (2003).
  25. Nervi, B., et al. Factors affecting human T cell engraftment, trafficking, and associated xenogeneic graft-vs-host disease in NOD/SCID beta2mnull mice. Experimental Hematology. 35, (12), 1823-1838 (2007).
  26. Leon-Rico, D., et al. Comparison of haematopoietic stem cell engraftment through the retro-orbital venous sinus and the lateral vein: alternative routes for bone marrow transplantation in mice. LabAnimal. 49, (2), 132-141 (2015).
  27. Ali, N., et al. Xenogeneic graft-versus-host-disease in NOD-scid IL-2Rgammanull mice display a T-effector memory phenotype. PLoS One. 7, (8), e44219 (2012).
  28. van Rijn, R. S., et al. A new xenograft model for graft-versus-host disease by intravenous transfer of human peripheral blood mononuclear cells in RAG2-/- gammac-/- double-mutant mice. Blood. 102, (7), 2522-2531 (2003).
  29. Wunderlich, M., et al. OKT3 prevents xenogeneic GVHD and allows reliable xenograft initiation from unfractionated human hematopoietic tissues. Blood. 123, (24), e134-e144 (2014).
  30. Schroeder, M. A., DiPersio, J. F. Mouse models of graft-versus-host disease: advances and limitations. Disease Models & Mechanisms. 4, (3), 318-333 (2011).
  31. Zeiser, R., Blazar, B. R. Preclinical models of acute and chronic graft-versus-host disease: how predictive are they for a successful clinical translation? Blood. 127, (25), 3117-3126 (2016).
Induktion und Bewertung der Graft-Versus-Host-Krankheit in einem xenogenen Murine-Modell und Quantifizierung menschlicher T-Zellen in Mausgeweben mit digitaler PCR
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Seng, A., Markiewicz, M. A. Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR. J. Vis. Exp. (147), e59107, doi:10.3791/59107 (2019).More

Seng, A., Markiewicz, M. A. Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR. J. Vis. Exp. (147), e59107, doi:10.3791/59107 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter