Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Induzione e punteggio della malattia di Graft-Versus-Host in un modello di Murine Xenogeneico e quantificazione delle cellule T umane nei tessuti del topo utilizzando pcR digitale

doi: 10.3791/59107 Published: May 23, 2019

Summary

Qui, presentiamo un protocollo per indurre e segnare la malattia in un modello di malattia xenogeneica innesto contro ospite (xenoGVHD). xenoGVHD fornisce un modello in vivo per studiare l'immunosoppressione delle cellule T umane. Inoltre, descriviamo come rilevare le cellule T umane nei tessuti con la PCR digitale come strumento per quantificare l'immunosoppressione.

Abstract

La malattia acuta di innesto contro ospite (GVHD) è una limitazione significativa per i pazienti sottoposti a trapianto di cellule staminali ematopoietiche come terapia per carenze ematologiche e neoplasie. Il GVHD acuto si verifica quando le cellule T donatrici riconoscono i tessuti ospiti come un antigene estraneo e montano una risposta immunitaria all'ospite. Gli attuali trattamenti riguardano farmaci immunosoppressori tossici che rendono i pazienti suscettibili di infezione e recidiva. Così, C'è ricerca in corso per fornire una terapia acuta GVHD che può efficacemente indirizzare le cellule T del donatore e ridurre gli effetti collaterali. Gran parte di questo lavoro pre-clinico utilizza il modello murino xenogeno GVHD (xenoGVHD) che consente di testare le terapie immunosoppressive sulle cellule umane piuttosto che murine cellule in un sistema in vivo. Questo protocollo descrive come indurre xenoGVHD e come accecare e standardizzare il punteggio clinico per garantire risultati coerenti. Inoltre, questo protocollo descrive come utilizzare la PCR digitale per rilevare le cellule T umane nei tessuti dei topi, che possono essere successivamente utilizzate per quantificare l'efficacia delle terapie testate. Il modello xenoGVHD non solo fornisce un modello per testare le terapie GVHD, ma qualsiasi terapia che può sopprimere le cellule T umane, che potrebbe quindi essere applicata a molte malattie infiammatorie.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Il trapianto di cellule staminali ematopoietiche allogeniche (HSCT) è diventato un trattamento di routine per i pazienti affetti da neoplasie ematologiche come la leucemia con prognosi infausta. Una complicazione significativa dell'HSCT è la malattia acuta di innesto contro l'ospite (GVHD). Uno studio del 2012 ha riferito che il GVHD acuto si è sviluppato nel 39% dei pazienti con HSCT che hanno ricevuto trapianti da donatori fratelli e 59% dei pazienti sottoposti a trapianto da donatori non correlati1. Il GVHD acuto si verifica quando le cellule T derivate dal donatore attaccano gli organi del destinatario. L'unica terapia di successo per gVHD è il trattamento con farmaci altamente immunosoppressivi2, che sono altamente tossici e aumentano il rischio di infezione e recidiva del tumore. Così, nonostante i miglioramenti che sono stati fatti nella sopravvivenza acuta GVHD negli ultimi anni3,4,5, c'è ancora una necessità critica per il miglioramento delle terapie GVHD con tossicità minima che promuovono la remissione a lungo termine.

L'obiettivo generale dei seguenti metodi è quello di indurre e segnare GVHD xenogeneico (xenoGVHD). Il modello xenoGVHD è stato sviluppato come strumento per indurre GVHD acuto con cellule umane piuttosto che cellule murine permettendo una traduzione più diretta della ricerca GVHD pre-clinica agli studi clinici6. Questo modello prevede l'iniezione per via endovenosa di cellule mononucleari del sangue periferiche umane (PBMC) in topi NOD-SCID IL-2R - null (NSG) irradiati sublethaldalmente. Le cellule T umane iniettate vengono attivate da cellule che presentano antigene umano (APC) che presentano l'antigene murno e le cellule T attivate migrano verso tessuti distanti con conseguente infiammazione sistemica e infine la morte6,7, 8 (IN vio , 9 (in vie , 10. La patologia della malattia e la progressione nel modello xenoGVHD imitano strettamente il GVHD acuto umano. In particolare, le cellule T umane patogene sono reattive a murine principali proteine complesse di istocompatibilità (MHC), che è simile all'alloreattività delle cellule T nel GVHD umano6,9. Il vantaggio principale del modello xenoGVHD rispetto al modello di mismatch MHC del mouse, l'altro modello GVHD ampiamente usato, è che consente di testare le terapie sulle cellule umane piuttosto che sulle cellule murine. Ciò consente di testare i prodotti che possono essere tradotti direttamente in clinica senza alcuna modifica perché sono fatti per indirizzare le cellule umane. Recentemente, questo modello è stato utilizzato per testare un anti-IL-2 umano11, cellule T regolatorie umane (Tregs)12 e cellule staminali mesenchymiche umane13 come potenziali trattamenti per la GVHD acuta. In un contesto più ampio, questo modello può essere utilizzato come un saggio di soppressione in vivo per qualsiasi farmaco o tipo di cellula che può sopprimere l'attività delle cellule T umane. Ad esempio, Stockis et al.14 hanno utilizzato il modello xenoGVHD per studiare l'effetto del blocco dell'attività soppressiva di Treg in vivo. Pertanto, il modello xenoGVHD può fornire informazioni sul meccanismo di qualsiasi terapia mirata alle cellule T in un ambiente in vivo.

Un ulteriore metodo descritto in questo protocollo è come rilevare le cellule T umane nei tessuti dei topi utilizzando la reazione a catena di polimerasi digitale (dPCR). L'obiettivo di questo metodo è quello di offrire uno strumento per quantificare la migrazione e la proliferazione delle cellule T nei tessuti bersaglio, che misurano l'efficacia delle terapie immunosoppressive testate in questo modello. dPCR è un metodo relativamente nuovo per la quantificazione degli acidi nucleici15. In breve, la miscela di reazione PCR è divisa in partizioni che contengono piccoli numeri della sequenza di destinazione o nessun bersaglio a tutti. La sequenza bersaglio viene quindi amplificata e rilevata utilizzando coloranti intercalari del DNA o sonde fluorescenti specifiche del bersaglio. dPCR quantifica il numero di copie della sequenza di destinazione in base alla frazione di partizioni positive e alle statistiche di Poisson15,16. Il rilevamento delle cellule T con dPCR richiede molto meno tessuto rispetto ad altri metodi alternativi, tra cui citometria di flusso e istologia, e può essere eseguito su tessuto congelato o fisso. dPCR non richiede una curva standard per determinare i numeri di copia, né sono necessarie repliche tecniche. In questo modo si riduce la quantità di DNA di reagente e modello necessaria per il dPCR rispetto al tradizionale PCR quantitativo (qPCR)16. Partizionare la reazione PCR in sottoreazioni in dPCR concentra efficacemente gli obiettivi17. Pertanto, dPCR è principalmente uno strumento per il rilevamento di bersagli rari in una grande quantità di DNA non bersaglio. Ad esempio, dPCR viene utilizzato per rilevare la contaminazione batterica nel latte18, identificare rare mutazioni nel gene del recettore degli estrogeni19e rilevare il DNA tumorale circolante nel sangue dei pazienti20. In questo protocollo, dPCR funge da strumento efficiente per rilevare e quantificare le cellule T umane nei tessuti di topi con xenoGVHD.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tutti gli esperimenti sui topi sono stati eseguiti in conformità, e con l'approvazione dell'University of Kansas Medical Center Institutional Animal Care and Use Committee. Tutti i campioni di sangue umano sano sono stati ottenuti sotto il consenso informato e con l'approvazione da parte dell'Institutional Review Board presso l'Università del Kansas Medical Center.

1. Irradiazione di topi NSG

  1. Un giorno prima dell'iniezione DI PBMC, irradiano vecchi topi NSG da 8 a 12 settimane (entrambi i sessi possono essere usati). In un armadio sterile di biosicurezza, posizionare i topi in una gabbia sterilizzata o in un microisolatore. irradiare topi in una fonte di Cs137 o in un piccolo irradiatore animale (ad esempio, RS 2000) con una dose totale di 150 cGy con rotazione lenta per garantire anche l'irradiazione.
  2. Mettere i topi in gabbie pulite in un armadio sterile di biosicurezza.

2. Preparazione del PBMC umano per l'iniezione

  1. Raccogliere abbastanza sangue umano sano da isolare 1,1 x 107 PBMC per topo. Diluire il sangue eparanato in un volume uguale del 2% di siero bovino fetale (FBS) in fosfato bufferizzato salina (PBS).
    NOTA: Con questo protocollo, la resa del PMBC è generalmente 0,5–1 x 107 per 10 mL di sangue intero. Ogni mouse riceverà 107 PBMC in 100 , l'l di PBS. L'extra 1 x 106 su 10 l per mouse assicura che ogni mouse riceva l'intero dosaggio di PBMC, in caso di problemi con il riempimento delle siringhe.
  2. Aggiungere 15 mL di densità di separazione dei linfociti media per il gradiente medio (ad esempio, Ficoll) a un tubo conico da 50 mL, quindi sovrapporre con cura fino a 25 mL di sangue diluito sopra il gradiente di densità. Centrifugare il tubo contenente gradiente di densità e sangue diluito a 400 x g per 40 min a temperatura ambiente senza freno.
  3. Raccogliere l'interfaccia PBMC in 10 mL di PBS in un tubo conico da 50 mL. Centrifugare le cellule a 400 x g per 10 min. Rimuovere il supernatante.
  4. Allenta il pellet sfogliando il tubo e risospende nuovamente in PBS da 10 mL per lavare il PBMC. Centrifugare le cellule a 400 x g per 5 min.
  5. (Facoltativo) Eliminare il globulo rosso (RBC) supernatante e liscile nel pellet cellulare aggiungendo un volume di buffer di lisi di ammonio-cchiuro-potassio (ACK) che è uguale al volume di pellet. Risospendere delicatamente il pellet e ruotare il tubo per 30-60 s. Tubo di riempimento con supporti RPMI senza sè e centrificare il tubo a 400 x g per 5 min.
  6. Rimuovere il supernatante e sospendere nuovamente il pellet cellulare in 5 mL di PBS. Contare le cellule usando l'esclusione blu trypan con un emocitometro e un microscopio.
  7. Centrifugare le cellule a 400 x g per 5 min. Rimuovere il supernatante e rimettere in sospensione le cellule a 1 x 108 cellule / mL in PBS.

3. Iniezione retroorbitale di PBMC umano nei topi21

  1. Mettere una camera di anestesia in un cappuccio a flusso laminare per mantenere la sterilità. Pre-carica della camera di anestesia con 5% di isoflurane e 1 l/min di flusso di ossigeno per 5 min.
  2. Ridurre l'isoflurane al 2% e mettere i topi dalla stessa gabbia nella camera di anestesia. Una volta che i topi perdono il rinfarto, anestesizzano i topi per 5 min in camera. Durante questo periodo, pre-riempire la siringa con 100 (1 x 107 celle) di sospensione cellulare.
  3. Posizionare il mouse su una piastra di riscaldamento con il naso in un cono naso per mantenere l'anestesia. Controllare la perdita di coscienza pizzicando una pedana e controllando la mancanza di riflesso.
  4. Restringere il mouse con il pollice e il dito medio. Inserire il 28 G 1/2 nell'ago con la smussata laterale al canto mediale, attraverso la membrana congiuntivale fino a raggiungere la parte posteriore dell'occhio. Ritrarre leggermente l'ago e iniettare lentamente 100 .L di cellule (1 x 107 cellule).
  5. Ritrarre completamente l'ago e smaltire correttamente la siringa e l'ago. Chiudere la palpebra e applicare una leggera pressione al sito di iniezione con una spugna di garza.
  6. Esaminare il sito di iniezione per il gonfiore o altri traumi visibili. Permettere al topo di riprendere coscienza in una gabbia sterile rivestita con asciugamani di carta per evitare l'aspirazione di biancheria da letto prima di trasferirsi in gabbia di casa. Dopo che qualsiasi sanguinamento si è fermato, applicare una singola goccia di proparacaina all'occhio per l'analgesia.
    NOTA: L'iniezione di vena tail è un metodo alternativo di iniezione endovenosa di PBMC per questo protocollo come descritto da Macholz et al.22.

4. Punteggio clinico del GVHD acuto nei topi (Figura 1)23

  1. Misurare il punteggio GVHD a giorni alterni fino a quando i topi raggiungono un punteggio di un 2 e poi ogni giorno fino al giorno di sacrificio.
    1. Mettere la gabbia in un cappuccio laminare, rimuovere il cibo e l'acqua e rimettere il coperchio. L'attività del punteggio osservando i mouse per 5 minuti e assegnare i punteggi come segue: 0 - il mouse inizia a camminare entro un paio di minuti e continua a camminare intorno alla gabbia, 1 mouse prende più di un paio di minuti per alzarsi e cammina lentamente intorno gabbia, 2 - il mouse non si alza in 5 min e cammina solo quando toccato.
  2. Pesare ogni mouse in un becher di vetro e dare un punteggio di perdita di peso: 0 - <10% di cambiamento, 1 - 10-25% cambiamento e 2 > 25% cambiamento.
  3. Mentre il topo è ancora nel becher, ispezionare per la postura: 0 - normale, 1 - curvo a riposo, 2 - curvo altera il movimento; texture di pelliccia: 0 - normale, 1 - da lieve a moderata ruffling, 2 - ruffling grave, e l'integrità della pelle : 0 - normale, 1 spuntato delle zampe / coda, 2 - aree evidenti di pelle denudata (guarda orecchie, coda e zampe per il ridimensionamento).
  4. Con cinque categorie e un punteggio di 0–2 per ogni categoria, un mouse può raggiungere un punteggio massimo di 10. Quando un topo raggiunge un punteggio di 7 o superiore o raggiunge 42 giorni dopo l'iniezione, eutanasia topo tramite eutanasia CO2 o altro metodo approvato dal Comitato locale per la cura e l'uso degli animali.
    NOTA: Per garantire l'accuratezza dei risultati, il punteggio viene eseguito da un ricercatore che è accecato ai gruppi di trattamento24. Inoltre, anche se >20% della perdita di peso corporeo è l'endpoint umano raccomandato per molti protocolli IACUC, con ulteriore giustificazione iACUC approvazione di questo protocollo può essere ottenuto.

5. Raccolta di tessuti per il DNA genomico da topi eutanasia e isolare il DNA genomico

  1. I topi dissetati che utilizzano strumenti chirurgici sterili. Tagliare un piccolo pezzo di tessuto di circa 3 mm x 0,5 mm di dimensione da un organo di interesse, ad esempio, polmone, fegato o milza. Pesare il campione di tessuto e posizionare il pezzo di tessuto in un tubo sterile da 1,5 mL. Se si raccolgono più tessuti, lavare gli utensili con etanolo tra il taglio di ogni organo.
  2. Congelare i tessuti immergendo i tubi contenenti il tessuto in azoto liquido fino a quando non smette di ribollire e conservare in -80 gradi durante la notte. Scongelare i campioni di tessuto e liverli secondo un kit di isolamento del DNA genomico (gDNA).
  3. Isolare il DNA genomico secondo le istruzioni del produttore come descritto nel kit. Assicurarsi di notare la quantità di tessuto che è stato elaborato per microlitro di gDNA eluito (mg/L).
    NOTA: I tessuti congelati possono essere conservati a -80 gradi centigradi per l'elaborazione in un secondo momento.

6. Quantificazione delle cellule T umane utilizzando PCR digitale (Figura 2)

  1. Preparare le reazioni PCR digitali secondo il protocollo per i coloranti di legame del DNA per la macchina PCR digitale in uso. Utilizzare i seguenti primer specifici per il DNA genomico dell'epsilon CD3 umano (NCBI Reference Sequence: NG_007383.1); Primer in avanti: AGGCTGCCTTAACTCCCAAG, Inverti primer: GCCCTACCAGCTGGGGAAAC. Questi primer produrranno una singola banda di 105 bp.
    NOTA: Aggiungere 0,5 l di un enzima di restrizione, come HindIII, ad ogni reazione per digerire il DNA genomico. Assicurarsi di testare diverse diluizioni gDNA per ottimizzare la separazione delle goccioline positive e negative. Inoltre, un sottoinsieme di cellule T infiltranti può essere cellule T regolatorie non patogene. Queste cellule possono essere quantificate utilizzando primer aggiuntivi per marcatori di cellule T regolatori.
  2. Eseguire la reazione PCR digitale nelle seguenti condizioni: Coperchio a 105 gradi centigradi, 95 gradi centigradi per 10 min (1 ciclo); 95 s per 30 s, rampa 2 C/s e 55 gradi c per 1 min, rampa 2 C /s (40 cicli); 72 gradi centigradi per 10 min, 12 gradi centigradi.
    NOTA: potrebbe essere necessario regolare questi parametri in base alle apparecchiature PCR digitali.
  3. Acquisire dati PCR digitali con software di analisi. Riportare i dati come numero di copie per mg di tessuto utilizzando la seguente equazione: (numero di copie/l) x (L di gDNA in reazione) x (fattore di diluizione)/(mg del tessuto/l del gDNA totale)

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I vecchi topi NSG da 8-12 settimane irradiati sottolethaltale di entrambi i sessi che hanno ricevuto il PBMC umano hanno iniziato a mostrare segni clinici di GVHD intorno al giorno 10 dopo l'iniezione rispetto ai topi di controllo negativi che ricevevano solo PBS (Figura 1A). Mouse XenoGVHD ha avuto una sopravvivenza mediana di 23,5 giorni (Figura 1B). Con la PCR digitale, le cellule T umane positive dell'epsilon CD3 potrebbero essere rilevate nei campioni polmonari ed epatici di topi che hanno ricevuto PBMC umano. Campioni di tessuti di topi iniettati con PBS sono stati utilizzati come controlli (Figura 2).

Figure 1
Figura 1: progressione della malattia di GVHD. I topi NSG maschi e femmine irradiati sottolethallethally a 8-12 settimane sono stati iniettati in orbita retinerato con 1 x 107 PBMC umani (n ) o PBS (n - 4) come controllo negativo. I dati mostrati sono i risultati combinati di tre esperimenti indipendenti. (A) Punteggio GVHD è stato misurato ogni altro giorno fino a quando i topi hanno raggiunto un punteggio di un 2 e poi ogni giorno fino al giorno di sacrificio. I dati riportati in ogni momento per il punteggio GVHD è il punteggio medio di SEM dei topi vivi combinati con gli ultimi punteggi di qualsiasi topo deceduto in ogni gruppo. - p < 0,05 come determinato dal test Mann Whitney U. (B) Curva di sopravvivenza Kaplan-Meier. La morte è stata segnata quando il punteggio GVHD era di 7 dollari. - p < 0,05 come determinato dal test di log-rank. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: Rilevamento di cellule T umane utilizzando PCR digitale. Sono stati raccolti campioni di polmoni ed epatici da topi che sono stati iniettati retro-orbitalmente con PBS (n ) o 1 x 107 PBMC umani (n ) quando i topi hanno raggiunto un punteggio di GVHD di 7 o 42 giorni dopo l'iniezione. Sono stati raccolti dati da 3 esperimenti indipendenti. gDNA è stato isolato e PCR digitale è stato utilizzato per determinare le copie di epsilon umano CD3 per milligrammo di tessuto. (A) Rappresentante stampa PCR digitale di campioni polmonari ed epatici da un topo iniettato con PBS o PBMC. (B) Quantificazione delle copie dell'epsilon umano CD3 per millgrammo di tessuto proveniente da topi iniettati con PBS o PBMC. - 0,05 USD come determinato dal test di Mann Whitney U. Fare clic qui per visualizzare una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La progressione della malattia è generalmente coerente nel modello xenoGVHD, anche con l'iniezione di PBMC da donatori diversi, in modo da poter combinare più esperimenti. I passaggi chiave necessari per mantenere questa coerenza sono la tecnica di iniezione i.v. corretta, il punteggio accecante e coerente. Uno studio di Nervi et al.25 ha dimostrato che rispetto all'iniezione di vena della coda per via endovenosa, le iniezioni retroorbitali di PBMC hanno provocato un innesto più coerente e un GVHD più grave. Leon-Rico et al.26 hanno anche dimostrato che le iniezioni retroorbitali hanno portato a un innesto di cellule staminali ematopoietiche più consistenti nei topi rispetto all'iniezione di vene della coda. Tuttavia, se necessario, le iniezioni di vena della coda possono essere utilizzate come metodo alternativo nel modello xenoGVHD27,28,29.

Il problema della variabilità dei risultati associati alle iniezioni di vena della coda può essere ridotto aumentando il numero di soggetti. Inoltre, è importante che la persona che segna i topi sia accecata al trattamento del mouse per evitare distorsioni nel punteggio di criteri più soggettivi come l'attività o la consistenza della pelliccia. L'importanza del punteggio GVHD cieco è stata dimostrata anche nella clinica24. La persona che inietta i topi non deve essere la stessa persona che segna i topi. Se ciò non è possibile, i tubi di controllo e trattamento possono essere randomizzati ed etichettati con nuovi ID da un'altra persona (cioè, il controllo è A, il trattamento è B), quindi le iniezioni possono essere accecate. Il punteggio del mouse deve essere eseguito intorno alla stessa ora ogni giorno e negli stessi giorni dopo l'iniezione tra diversi esperimenti.

Un potenziale ostacolo in questo modello è la mancanza di sviluppo GVHD. Ciò potrebbe essere dovuto alla ridotta vitalità del PBMC che può essere affrontata controllando la fattibilità del PBMC contando le celle con il blu trypan. Se si incontrano problemi con la vitalità cellulare, le cellule possono essere messe in PBS integrato con 2% FBS per migliorare la sopravvivenza. Inoltre, è possibile iniettare meno topi alla volta per ridurre il tempo di seduta delle cellule a temperatura ambiente. L'efficacia dell'iniezione retroorbitale può essere il problema. I topi che vengono iniettati con PBMC ma che non sviluppano GVHD possono essere eutanasia e le cellule immunitarie isolate dalle loro milza possono essere analizzate per la presenza di cellule umane tramite dPCR o citometria di flusso. Se c'è un cattivo innesto, allora c'è probabilmente un problema con la tecnica di iniezione. Come prova di tecnica di iniezione, i topi possono essere iniettati in modo reorbitale con 200-L di coloranti blu Evans. Se l'iniezione ha successo, le orecchie, le zampe e la coda del topo diventeranno blu.

Il modello xenoGVHD imita strettamente la patogenesi e la progressionedellamalattia di GVHD acuta umana. A differenza del modello GVHD murino MHC mismatch, il modello xenoGVHD consente di testare l'effetto delle terapie immunosoppressive, comprese le terapie cellulari umane, sulle cellule umane piuttosto che sulle cellule murine. Questo riduce la variazione dovuta alle differenze di specie quando si applicano i risultati della ricerca alla clinica. Il modello xenoGVHD può anche servire come un saggio di soppressione in vivo in altri campi della ricerca sulle cellule T. Così, i risultati di esperimenti che utilizzano il modello xenoGVHD possono essere applicati a qualsiasi malattia infiammatoria mediata dalle cellule T umane oltre al GVHD.

Esistono limitazioni del modello xenoGVHD. Questi includono variabilità sperimentale e possibili differenze nel trattamento GVHD rispetto alla clinica. Le incongruenze sperimentali possono derivare da differenze nella deformazione dei topi, nei siti di iniezione PBMC, nella dose di radiazioni e nell'ambiente microbico30,31. Pertanto, i laboratori che utilizzano questo modello dovrebbero tentare di standardizzare questi parametri per garantire risultati coerenti. In questo protocollo vengono descritti i metodi di assegnazione dei punteggi che consentono di ridurre la variabilità nel punteggio. Fattori che possono limitare la comparabilità dei dati xenoGVHD agli esiti clinici includono la mancanza di gruppi di controllo trattati con farmaci profilattici GVHD e l'uso di irradiazione come unica fonte di condizionamento nel modello xenoGVHD31. Inoltre, il meccanismo di xenoGVHD non riassume completamente la patogenesi sottostante nel GVHD umano. Ad esempio, sono gli APC donatori piuttosto che gli APC host che attivano le cellule T umane nel modello xenoGVHD, mentre gli APC host svolgono un ruolo significativo nel GVHD umano7. Così, come con la maggior parte dei modelli pre-clinici, ci sono incongruenze e incompatibilità tra xenoGVHD e GVHD umano che possono limitare l'applicazione di dati generati da xenoGVHD alla clinica.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Nessun conflitto di interessi dichiarato.

Acknowledgments

Vorremmo riconoscere il laboratorio di Lane Christenson per la fornitura della macchina PCR digitale utilizzata in questi esperimenti e per il supporto tecnico fornito. Vorremmo anche ringraziare il Dr. Thomas Yankee per la sua guida e mentoring. Questi studi sono stati sostenuti dalla Tripp Family Foundation.

Materials

Name Company Catalog Number Comments
1.5 mL eppendorf tubes Fisher 05-408-129
10 mL serological pipet VWR International 89130-898
10mL BD Vacutainers - Green capped with Sodium Heparin Becton Dickinson 366480
250 µL Ranin pipette tips Rainin 17001118 Do not use other pipettes or pipet tips for droplet generation
50 mL conical tube VWR International 89039-656
96-Well ddPCR plate Bio-Rad 12001925
ACK (Ammonium-Chloride-Potassium) Lysing Buffer Lonza 10-548E Optional
Alcohol Wipes Fisher Scientific 6818
Anesthesia Chamber World Precision Instruments EZ-178 Provided by animal facility
Anesthesia Machine Parkland Scientific PM1002 Provided by animal facility
BD Vacutainer Safety-Lok Blood Collection Set Becton Dickinson 367281
DG8 Cartridges and Gaskets for QX100/QX200 Droplet Generator Bio-Rad 1864007
DNAse and RNAse free Molecular Grade H2O Life Technologies 1811318
Ethyl alcohol, Pure,200 proof, for molecular biology Sigma-Aldrich E7023-500ML
Fetal Bovine Serum Atlanta Biologicals S11150
Ficoll Fisher Scientific 45001750
Insulin Syringe Fisher Scientific 329424
Isoflurane Sigma-Aldrich CDS019936 Provided by animal facility
Liquid nitrogen N/A N/A
Mouse Irradiator Pie Cage Braintree Scientific, Inc. MPC 1 Holds up to 11 mice
Nexcare Gentle Paper Tape (a.k.a. 3M Micropore Surgical Tape / 3/4") Fisher Scientific 19-027-761
P1000 pipetman MidSci A-1000
P200 pipetman MidSci A-200
Pierceable Foil Heat Seal Bio-Rad 1814040
Pipetaid Gilson Macroman Fisher Scientific F110756
Pipet-Lite Multi Pipette L8-200XLS+ Rainin 17013805 Do not use other pipettes or pipet tips for droplet generation
Qiagen DNeasy Blood and Tissue Kit Qiagen 69506
qPCR plates VWR International 89218-292
QX200 Droplet Digital PCR System Bio-Rad 12001925 Includes droplet generator, droplet reader, laptop computer, software, associated component consumables, for EvaGreen or probe-based digital PCR applications
QX200 Droplet Generation Oil for EvaGreen Bio-Rad 1864006
QX200 ddPCR EvaGreen Supermix Bio-Rad 1864033
RNase and DNase-free plate seal Thermo Scientific 12565491
RPMI Advanced 1640 Life Technologies 12633012
Sterile Gauze Pads (2" x 2", 12-Ply) Fisher Scientific 67522
Sterile Phosphate Buffered Saline Fisher Scientific 21040CV
Sterile reservoir VWR International 89094-662
Surgial Scissors Kent Scientific INS600393-4
Surgical Forceps Kent Scientific INS650914-4

DOWNLOAD MATERIALS LIST

References

  1. Jagasia, M., et al. Risk factors for acute GVHD and survival after hematopoietic cell transplantation. Blood. 119, (1), 296-307 (2012).
  2. Bolanos-Meade, J., et al. Phase 3 clinical trial of steroids/mycophenolate mofetil vs steroids/placebo as therapy for acute GVHD: BMT CTN 0802. Blood. 124, (22), quiz 3335 3221-3227 (2014).
  3. Gooley, T. A., et al. Reduced mortality after allogeneic hematopoietic-cell transplantation. New England Journal of Medicine. 363, (22), 2091-2101 (2010).
  4. Hahn, T., et al. Significant improvement in survival after allogeneic hematopoietic cell transplantation during a period of significantly increased use, older recipient age, and use of unrelated donors. Journal of Clinical Oncology. 31, (19), 2437-2449 (2013).
  5. Khoury, H. J., et al. Improved survival after acute graft-versus-host disease diagnosis in the modern era. Haematologica. 102, (5), 958-966 (2017).
  6. King, M. A., et al. Human peripheral blood leucocyte non-obese diabetic-severe combined immunodeficiency interleukin-2 receptor gamma chain gene mouse model of xenogeneic graft-versus-host-like disease and the role of host major histocompatibility complex. Clinical & Experimental Immunology. 157, (1), 104-118 (2009).
  7. Lucas, P. J., Shearer, G. M., Neudorf, S., Gress, R. E. The human antimurine xenogeneic cytotoxic response. I. Dependence on responder antigen-presenting cells. Journal of Immunology. 144, (12), 4548-4554 (1990).
  8. Ito, R., et al. Highly sensitive model for xenogenic GVHD using severe immunodeficient NOG mice. Transplantation. 87, (11), 1654-1658 (2009).
  9. Kawasaki, Y., et al. Comprehensive Analysis of the Activation and Proliferation Kinetics and Effector Functions of Human Lymphocytes, and Antigen Presentation Capacity of Antigen-Presenting Cells in Xenogeneic Graft-Versus-Host Disease. Biology of Blood and Marrow Transplantation. 24, (8), 1563-1574 (2018).
  10. Ito, R., et al. A Novel Xenogeneic Graft-Versus-Host Disease Model for Investigating the Pathological Role of Human CD4(+) or CD8. T Cells Using Immunodeficient NOG Mice. American Journal of Transplantation. 17, (5), 1216-1228 (2017).
  11. Trotta, E., et al. A human anti-IL-2 antibody that potentiates regulatory T cells by a structure-based mechanism. Nature Medicine. 24, (7), 1005-1014 (2018).
  12. Dijke, I. E., et al. Discarded Human Thymus Is a Novel Source of Stable and Long-Lived Therapeutic Regulatory T Cells. American Journal of Transplantation. 16, (1), 58-71 (2016).
  13. Huang, F., et al. Human Gingiva-Derived Mesenchymal Stem Cells Inhibit Xeno-Graft-versus-Host Disease via CD39-CD73-Adenosine and IDO Signals. Frontiers in Immunology. 8, 68 (2017).
  14. Stockis, J., et al. Blocking immunosuppression by human Tregs in vivo with antibodies targeting integrin alphaVbeta8. Proceedings of the National Academy of Sciences of the United States of America. 114, (47), E10161-E10168 (2017).
  15. Vogelstein, B., Kinzler, K. W. Digital PCR. Proceedings of the National Academy of Sciences of the United States of America. 96, (16), 9236-9241 (1999).
  16. Quan, P. L., Sauzade, M., Brouzes, E. dPCR: A Technology Review. Sensors (Basel). 18, (4), (2018).
  17. Sykes, P. J., et al. Quantitation of targets for PCR by use of limiting dilution. Biotechniques. 13, (3), 444-449 (1992).
  18. Ma, H., et al. Evaluation of Bacterial Contamination in Goat Milk Powder Using PacBio Single Molecule Real-Time Sequencing and Droplet Digital PCR. Journal of Food Protection. 1791-1799 (2018).
  19. Vitale, S. R., et al. An optimized workflow to evaluate estrogen receptor gene mutations in small amounts of cell-free DNA. Journal of Molecular Diagnostics. (2018).
  20. Gorgannezhad, L., Umer, M., Islam, M. N., Nguyen, N. T., Shiddiky, M. J. A. Circulating tumor DNA and liquid biopsy: opportunities, challenges, and recent advances in detection technologies. Lab Chip. 18, (8), 1174-1196 (2018).
  21. Yardeni, T., Eckhaus, M., Morris, H. D., Huizing, M., Hoogstraten-Miller, S. Retro-orbital injections in mice. LabAnimal. 40, (5), 155-160 (2011).
  22. Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. Manual restraint and common compound administration routes in mice and rats. Journal of Visualized Experiments. (67), (2012).
  23. Cooke, K. R., et al. An experimental model of idiopathic pneumonia syndrome after bone marrow transplantation: I. The roles of minor H antigens and endotoxin. Blood. 88, (8), 3230-3239 (1996).
  24. Weisdorf, D. J., et al. Prospective grading of graft-versus-host disease after unrelated donor marrow transplantation: a grading algorithm versus blinded expert panel review. Biology of Blood and Marrow Transplantation. 9, (8), 512-518 (2003).
  25. Nervi, B., et al. Factors affecting human T cell engraftment, trafficking, and associated xenogeneic graft-vs-host disease in NOD/SCID beta2mnull mice. Experimental Hematology. 35, (12), 1823-1838 (2007).
  26. Leon-Rico, D., et al. Comparison of haematopoietic stem cell engraftment through the retro-orbital venous sinus and the lateral vein: alternative routes for bone marrow transplantation in mice. LabAnimal. 49, (2), 132-141 (2015).
  27. Ali, N., et al. Xenogeneic graft-versus-host-disease in NOD-scid IL-2Rgammanull mice display a T-effector memory phenotype. PLoS One. 7, (8), e44219 (2012).
  28. van Rijn, R. S., et al. A new xenograft model for graft-versus-host disease by intravenous transfer of human peripheral blood mononuclear cells in RAG2-/- gammac-/- double-mutant mice. Blood. 102, (7), 2522-2531 (2003).
  29. Wunderlich, M., et al. OKT3 prevents xenogeneic GVHD and allows reliable xenograft initiation from unfractionated human hematopoietic tissues. Blood. 123, (24), e134-e144 (2014).
  30. Schroeder, M. A., DiPersio, J. F. Mouse models of graft-versus-host disease: advances and limitations. Disease Models & Mechanisms. 4, (3), 318-333 (2011).
  31. Zeiser, R., Blazar, B. R. Preclinical models of acute and chronic graft-versus-host disease: how predictive are they for a successful clinical translation? Blood. 127, (25), 3117-3126 (2016).
Induzione e punteggio della malattia di Graft-Versus-Host in un modello di Murine Xenogeneico e quantificazione delle cellule T umane nei tessuti del topo utilizzando pcR digitale
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Seng, A., Markiewicz, M. A. Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR. J. Vis. Exp. (147), e59107, doi:10.3791/59107 (2019).More

Seng, A., Markiewicz, M. A. Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR. J. Vis. Exp. (147), e59107, doi:10.3791/59107 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter