Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Induktion och poängsättning av graft-versus-host-sjukdom i en Xenogeneisk murin modell och kvantifiering av humana T-celler i mus vävnader med hjälp av digital PCR

doi: 10.3791/59107 Published: May 23, 2019

Summary

Här presenterar vi ett protokoll för att inducera och värdering sjukdom i en xenogena graft-versus-host sjukdom (xenogvhd) modell. xenoGVHD ger en in vivo-modell för att studera immunsuppression av humana T-celler. Dessutom beskriver vi hur man detekterar humana T-celler i vävnader med digital PCR som ett verktyg för att kvantifiera immunsuppression.

Abstract

Akut transplantat-kontra-värd sjukdom (GVHD) är en signifikant begränsning för patienter som får hematopoietisk stamcellstransplantation som terapi för hematologiska brister och maligniteter. Akut GVHD uppstår när givare T-celler erkänna värd vävnader som ett främmande antigen och montera ett immunsvar till värden. Nuvarande behandlingar innebär giftiga immunsuppressiva läkemedel som gör patienter mottagliga för infektion och recidiv. Sålunda, det finns pågående forskning för att ge en akut GVHD terapi som effektivt kan rikta givare T-celler och minska biverkningar. Mycket av detta prekliniska arbete använder den xenogena GvHD (xenogvhd) murina modell som möjliggör testning av immunsuppressiva terapier på mänskliga celler snarare än murina celler i ett in vivo-system. Detta protokoll beskriver hur man inducerar xenoGVHD och hur man blinda och standardisera kliniska scoring för att säkerställa konsekventa resultat. Dessutom beskriver detta protokoll hur man använder digital PCR för att detektera humana T-celler i mus vävnader, som sedan kan användas för att kvantifiera effekten av testade terapier. Den xenoGVHD modellen ger inte bara en modell för att testa GVHD terapier men någon behandling som kan undertrycka mänskliga T-celler, som sedan kan tillämpas på många inflammatoriska sjukdomar.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Allogen hematopoietisk stamcellstransplantation (HSCT) har blivit rutinmässig behandling för patienter som lider av hematologiska maligniteter såsom leukemi med dålig prognos. En signifikant komplikation av HSCT är akut transplantat-kontra-värd sjukdom (GVHD). En 2012 studie rapporterade att akut GVHD utvecklades i 39% av HSCT patienter som fick transplantationer från syskon givare och 59% av patienterna som fick transplantationer från icke-närstående givare1. Akut GVHD uppstår när givare härledda T-celler angriper mottagarens organ. Den enda lyckade behandlingen för GVHD är behandling med mycket immunsuppressiva läkemedel2, som är mycket giftiga och ökar risken för infektion och tumör upprepning. Således, trots förbättringar som har gjorts i akut GvHD överlevnad under de senaste åren3,4,5, det finns fortfarande ett kritiskt behov av förbättrade GvHD terapier med minimal toxicitet som främjar långsiktig remission.

Det övergripande målet med följande metoder är att inducera och poängsätter xenogena GvHD (xenogvhd). Den xenoGVHD modell utvecklades som ett verktyg för att inducera akut GVHD med mänskliga celler snarare än murina celler möjliggör mer direkt översättning av preklinisk GVHD forskning till kliniska prövningar6. Denna modell innebär intravenöst injicering av Human perifert blod mononukleära celler (PBMC) i NOD-SCID IL-2Rγnull (NSG) möss som är sublethally bestrålade. Injicerade humana t-celler aktiveras av humana antigen presenterande celler (APCS) som presenterar murinantigen och de aktiverade T-cellerna migrerar till avlägsna vävnader som resulterar i systemisk inflammation och i slutändan död6,7, 8 , 9 , 10. sjukdoms patologi och progression i xenogvhd-modellen imiterar nära Human akut GvHD. Specifikt, de patogena humana T-celler är reaktiva till murina större histocompatibility complex (MHC) proteiner, som liknar den T-cell alloreactivity i humant GvHD6,9. Den främsta fördelen med xenoGVHD modellen över musen MHC-mismatch modell, den andra allmänt använda GVHD-modellen, är det gör det möjligt för testning av terapier på mänskliga celler snarare än murina celler. Detta gör det möjligt för testning av produkter som direkt kan översättas till kliniken utan några ändringar eftersom de är gjorda för att rikta mänskliga celler. Nyligen har denna modell använts för att testa en human anti-IL-2 antikropp11, mänskliga thymic reglerande T-celler (Tregs)12 och mänskliga mesenkymala stamceller13 som potentiella behandlingar för akut GvHD. I ett bredare sammanhang, denna modell kan användas som en in vivo dämpning analys för alla läkemedel eller celltyp som kan undertrycka mänsklig T cell aktivitet. Till exempel använde Stockis et al.14 xenoGVHD-modellen för att studera effekten av att blockera integrin αVβ8 på Treg suppressiv aktivitet in vivo. Således, den xenoGVHD modellen kan ge insikt i mekanismen för alla terapi inriktning T-celler i en in vivo inställning.

En ytterligare metod som beskrivs i detta protokoll är hur man upptäcker mänskliga T-celler i mus vävnader med hjälp av digital polymeras kedjereaktion (dpcr). Målet med denna metod är att erbjuda ett verktyg för att kvantifiera migration och spridning av T-celler i målvävnaderna, som mäter effekten av immunsuppressiva terapier som testas i denna modell. dPCR är en relativt ny metod för kvantifiering av nukleinsyror15. Kortfattat, PCR reaktionsblandningen är uppdelad i partitioner som innehåller små antal av målsekvensen eller inget mål alls. Målsekvensen förstärks sedan och detekteras med hjälp av DNA-interkalating färgämnen eller fluorescerande målspecifika sonder. dpcr kvantifierar antalet kopior av målsekvensen baserat på andelen positiva partitioner och Poissons statistik15,16. Detektera T-celler med dPCR kräver mycket mindre vävnad jämfört med andra alternativa metoder, inklusive flödescytometri och histologi, och kan utföras på fryst eller fast vävnad. dPCR kräver inte en standardkurva för att bestämma kopierings nummer och inte heller är tekniska replikat krävs. Detta minskar mängden reagens och mallDNA som behövs för dPCR jämfört med traditionell kvantitativ PCR (qPCR)16. Partitionering av PCR-reaktionen i sub-reaktioner i dPCR koncentrerar effektivt mål17. Således är dPCR främst ett verktyg för detektering av sällsynta mål i en stor mängd icke-måldna. Till exempel, dPCR används för att upptäcka bakteriell kontaminering i mjölk18, identifiera sällsynta mutationer i östrogen receptor genen19, och upptäcka cirkulerande tumör-DNA i blodet hos patienter20. I detta protokoll fungerar dPCR som ett effektivt verktyg för att detektera och kvantifiera humana T-celler i vävnader från möss med xenoGVHD.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alla mus experiment utfördes i överensstämmelse, och med godkännande från, University of Kansas Medical Center institutionella djuromsorg och användning kommittén. Alla friska humanblod prov erhölls under informerat samtycke och med godkännande från den institutionella Granskningsnämnden vid University of Kansas Medical Center.

1. bestrålning av NSG-möss

  1. En dag före PBMC injektion, bestråla 8 – 12-veckors gamla NSG möss (antingen kön kan användas). I ett sterilt biosäkerhetsskåp, placera möss i en steriliserad paj bur eller microisolator. Bestråla möss i en cs137 källa eller små djur Irradiator (t. ex., rs 2000) med en total dos av 150 CGY med långsam rotation för att säkerställa jämn bestrålning.
  2. Placera möss i rena burar i ett sterilt biosäkerhetsskåp.

2. beredning av Human PBMC för injektion

  1. Samla tillräckligt friskt humant blod för att isolera 1,1 x 107 PBMC per mus. Späd det hepariniserade blodet i en lika volym av 2% fetalt bovint serum (FBS) i fosfatbuffrad saltlösning (PBS).
    Anmärkning: med detta protokoll, PMBC avkastningen är i allmänhet 0.5-1 x 107 per 10 ml helblod. Varje mus får 107 PBMC i 100 μl PBS. Den extra 1 x 106 i 10 μl per mus säkerställer att varje mus får full dos av PBMC, bör det finnas några problem med fyllning sprutor.
  2. Tillsätt 15 mL lymfocytseparering densitet gradient medium (t. ex. Ficoll) till en 50 mL koniskt rör och sedan försiktigt överlagra upp till 25 mL utspädd blod ovanpå densitetsgradienten. Centrifugera röret som innehåller densitetsgradient och utspädd blod vid 400 x g för 40 min vid rumstemperatur utan broms.
  3. Skörda PBMC-gränssnittet i 10 mL PBS i ett 50 mL koniskt rör. Centrifugera cellerna vid 400 x g i 10 min. ta bort supernatanten.
  4. Lossa pelleten genom att snärta röret och Omsuspendera i 10 mL PBS för att tvätta PBMC. Centrifugera cellerna vid 400 x g i 5 min.
  5. Valfritt Kassera supernatanten och lyse röda blodkroppar (RBCs) i cellpelleten genom att tillsätta en volym ammoniumklorid-kalium (ACK) lysis buffert som är lika med pellets volymen. Försiktigt Omsuspendera pelleten och snurra röret i 30 – 60 s. fyllnings röret med serumfritt RPMI media och centrifugera röret vid 400 x g i 5 min.
  6. Avlägsna supernatanten och återsuspendera cellpelleten i 5 mL PBS. Räkna cellerna med trypan blå uteslutning med en hemocytometern och ett mikroskop.
  7. Centrifugera cellerna vid 400 x g i 5 min. ta bort supernatanten och Omsuspendera cellerna vid 1 x 108 celler/ml i PBS.

3. retro-orbital injektion av humant PBMC till möss21

  1. Placera en anestesi kammare i ett laminärt flöde huva för att upprätthålla sterilitet. Pre-Ladda anestesi kammaren med 5% isofluran och 1 L/min syre flöde för 5 min.
  2. Minska isofluran till 2% och placera möss från samma bur i anestesi kammaren. När möss förlorar rätande, söva möss för 5 min i kammaren. Under denna tid, pre-Fill spruta med 100 μL (1 x 107 celler) av cellsuspensionen.
  3. Placera musen på en värmedyna med näsan i en näskon för att bibehålla anestesi. Kontrollera om förlusten av medvetandet genom att nypa en fot pad och kontroll av brist på reflex.
  4. Hindra musen med tummen och långfingret. Sätt i 28 G 1/2 i nålen med avfasning ner sidled till mediala canthus, genom konjunktival membranet tills bak i ögat är nådd. Dra försiktigt ut nålen och injicera långsamt 100 μL celler (1 x 107 celler).
  5. Dra ut nålen ordentligt och Kassera sprutan och nålen på rätt sätt. Stäng ögonlocket och applicera milt tryck på injektionsstället med en gasväv svamp.
  6. Undersök injektionsstället för svullnad eller annat synligt trauma. Låt musen återfå medvetandet i en steril bur fodrad med pappershanddukar för att förhindra aspiration av sängkläder innan du flyttar till hem buren. Efter en blödning har slutat, tillämpa en enda droppe proparacaine i ögat för smärtlindring.
    Anmärkning: svans venen injektion är en alternativ metod för intravenös injektion av PBMC för detta protokoll som beskrivs av Macholz et al.22.

4. klinisk bedömning av akut GVHD hos möss (figur 1)23

  1. Mät GVHD Poäng varannan dag tills möss når en poäng av en 2 och sedan varje dag fram till dag av offer.
    1. Placera buren i en laminärt flödeshuv, ta bort maten och vattnet och sätt tillbaka locket. Poäng aktivitet genom att observera möss för 5 min och tilldela poäng enligt följande: 0 = musen börjar gå inom ett par minuter och fortsätter att gå runt bur, 1 = musen tar en mer än ett par minuter att gå upp och promenader långsamt runt bur, 2 = musen inte gå upp i 5 min och bara går vid beröring.
  2. Väg varje mus i en glasbägare och ge en viktminskning Poäng: 0 = < 10% förändring, 1 = 10 – 25% förändring och 2 = > 25% förändring.
  3. Medan musen är kvar i bägaren, inspektera för kroppshållning: 0 = normal, 1 = hunching i vila, 2 = hunching försämrar rörelse; päls konsistens: 0 = normal, 1 = mild till måttlig ruffling, 2 = kraftig ruffling och hudens integritet : 0 = normal, 1 = fjällning av tassar/svans, 2 = uppenbara områden av utblottad hud (titta på öron, svans och tassar för skalning).
  4. Med fem kategorier och en poäng på 0 – 2 för varje kategori, kan en mus nå en maximal poäng på 10. När en mus når en poäng av 7 eller större eller når 42 dagar efter injektion, euthanize mus via CO2 eutanasi eller annan metod som godkänts av den lokala institutionella djuromsorg och användning kommittén.
    Anmärkning: för att säkerställa träffsäkerheten i resultaten utförs poängsättningen av en forskare som är förblindad till behandlingsgrupperna24. Dessutom, även om > 20% av kroppsvikt förlusten är den rekommenderade humana endpoint för många IACUC protokoll, med ytterligare motivering IACUC godkännande av detta protokoll kan erhållas.

5. avverknings vävnader för genomiskt DNA från euthaniserade möss och isolerar genomiskt DNA

  1. Dissekera möss med sterila kirurgiska verktyg. Skär en liten bit vävnad ca 3 mm x 0,5 mm i storlek från ett organ av intresse, t. ex., lung, lever, eller mjälte. Väg vävnadsprovet och placera vävnads stycket i ett sterilt 1,5 mL-rör. Om insamling av flera vävnader, tvätta verktyg med etanol mellan skära varje organ.
  2. Frys vävnader genom att dränka rören som innehåller vävnaden i flytande kväve tills den stoppar bubblande och förvara i-80 ° c över natten. Tina vävnadsproverna och lyse dem enligt ett genomiskt DNA (gDNA) isolerings kit.
  3. Isolera genomiskt DNA enligt tillverkarens anvisningar enligt beskrivningen i satsen. Var noga med att notera den mängd vävnad som behandlades per mikroliter eluerade gDNA (mg/μL).
    Obs: frysta vävnader kan förvaras vid-80 ° c för bearbetning vid ett senare tillfälle.

6. kvantifiering av humana T-celler med digital PCR (figur 2)

  1. Förbered digitala PCR-reaktioner enligt protokollet för DNA-bindande färgämnen för den digitala PCR-maskinen som används. Använd följande primers specifika för humant CD3 Epsilon genomisk DNA (ncbi referenssekvens: ng_ 007383.1); Framåt primer: AGGCTGCCTTAACTCCCAAG, omvänd primer: GCCCTACCAGCTGTGGAAAC. Dessa primers kommer att ge ett enda band på 105 BP.
    Anmärkning: Tillsätt 0,5 μL av ett begränsnings enzym, såsom HindIII, till varje reaktion för att smälta det genomiska DNA. Se till att testa olika gDNA-utspädningar för att optimera separationen av positiva och negativa droppar. Dessutom kan en delmängd av infiltrerande T-celler vara icke-patogena reglerande T-celler. Dessa celler kan kvantifieras med hjälp av ytterligare primers för regulatoriska T-cellmarkörer.
  2. Utför den digitala PCR-reaktionen under följande betingelser: lock vid 105 ° c, 95 ° c i 10 min (1 cykel); 95 ° c för 30 s, ramp 2 ° c/s och 55 ° c i 1 min, ramp 2 ° c/s (40 cykler); 72 ° c i 10 min, 12 ° c Hold.
    Obs: dessa parametrar kan behöva justeras beroende på digital PCR-utrustning.
  3. Hämta digitala PCR-data med analysprogramvara. Rapportera data som antal kopior per mg vävnad med hjälp av följande ekvation: (antal kopior/μL) x (μL av gDNA som reaktion) x (utspädningsfaktor)/(mg vävnad/μL totalt gDNA)

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Sublethally bestrålade 8-12-veckors gamla NSG möss av båda könen som fick humant PBMC började Visa kliniska tecken på GVHD runt dag 10 efter injektion jämfört med negativa kontroll möss som fick PBS endast (figur 1a). XenoGVHD-möss hade en median överlevnad på 23,5 dagar (figur 1b). Med digital PCR kunde CD3 Epsilon positiva humana T-celler upptäckas i lungan och leverprover av möss som fick humant PBMC. Vävnadsprover från möss som injicerats med PBS användes som kontroller (figur 2).

Figure 1
Figur 1: progression av GVHD-sjukdomen. Sublethally bestrålade 8-12-veckors gamla manliga och kvinnliga NSG möss var retro-Orbitally injiceras med 1 x 107 mänskliga PBMC (n = 6) eller PBS (n = 4) som en negativ kontroll. Data som visas är de kombinerade resultaten av tre oberoende experiment. (A) GvHD-Poäng mättes varannan dag tills möss nådde en poäng på en 2 och sedan varje dag fram till dag av uppoffring. Data som rapporteras vid varje tidpunkt för GVHD-Poäng är den genomsnittliga ± SEM-poängen för levande möss kombinerat med de sista poängen för alla avlidna möss i varje grupp. * p < 0,05 som bestäms av Mann Whitney U test. BKaplan-Meier-kurva för överlevnad. Döden markerades när GVHD-poängen var ≥ 7. * p < 0,05 som bestäms av log-rank test. Vänligen klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: detektion av humana T-celler med digital PCR. Lung-och leverprover samlades in från möss som var retroorbitalt injicerade med PBS (n = 3) eller 1 x 107 Human PBMC (n = 3) när möss nådde en GvHD-poäng på ≥ 7 eller 42 dagar efter injektion. Data samlades in från 3 oberoende experiment. gDNA isolerades och digital PCR användes för att bestämma kopior av humant CD3 Epsilon per milligram vävnad. A) representativ Digital PCR-Plot av lung-och leverprover från en mus injicerad med PBS eller PBMC. B) kvantifiering av kopior av humant CD3 Epsilon per millgram vävnad från möss som injicerats med PBS eller PBMC. * p ≤ 0,05 som bestäms av Mann Whitney U test. Vänligen klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Sjukdomsprogression är i allmänhet konsekvent i xenoGVHD-modellen, även med injektion av PBMC från olika givare, så att flera experiment kan kombineras. De viktigaste stegen som krävs för att bibehålla denna konsekvens är korrekt i.v. injektion teknik, bländande och konsekvent scoring. En studie av Nervi et al.25 visade att jämfört med intravenös svans ven injektion, retroorbital injektioner av PBMC resulterade i mer konsekvent engrafktion och mer svår GvHD. Leon-Rico et al.26 visade också att retro-orbital injektioner resulterade i mer konsekvent hematopoietisk stamcellstransplantation hos möss jämfört med svans venen injektion. Men, om nödvändigt, svans venen injektioner kan användas som en alternativ metod i xenogvhd modell27,28,29.

Problemet med variationer i utfall i samband med svans venen injektioner kan minskas genom att öka antalet försökspersoner. Dessutom är det viktigt att personen som poängerar mössen är förblindad till mus behandling för att undvika bias i poängsättningen av mer subjektiva kriterier som aktivitet eller päls textur. Vikten av blindad GVHD scoring har också visats på kliniken24. Den person som injicerar möss bör inte vara samma person som poängerar mössen. Om detta inte är möjligt, kontroll och behandling rör kan randomiseras och märkas med nya ID ' s av en annan person (dvs., kontroll är en, behandling är B) så injektioner kan vara förblindade. Mus scoring bör utföras ungefär samma tid varje dag och på samma dagar efter injektion mellan olika experiment.

Ett potentiellt hinder i denna modell är avsaknaden av GVHD utveckling. Detta kan bero på minskad lönsamhet hos PBMC som kan åtgärdas genom att kontrollera PBMC-cellernas livskraft genom att räkna celler med trypan Blue. Om problem med cellernas lönsamhet påträffas kan cellerna sättas i PBS kompletterat med 2% FBS för att förbättra överlevnaden. Dessutom kan färre möss injiceras i en tid för att minska tiden cellerna sitter vid rumstemperatur. Effekten av retro-orbital injektion kan vara problemet. Möss som injiceras med PBMC men inte utvecklar GvHD kan euthanized och immunceller isolerade från sina mjälte kan analyseras för förekomst av mänskliga celler via dpcr eller flödescytometri. Om det finns dålig Inympning, då finns det sannolikt ett problem med injektion teknik. Som ett test av injektion teknik, möss kan injiceras retro-Orbitally med 200 μL av Evans blå färgämne. Om injektionen lyckas, kommer öronen, tassar och svans av musen att bli blå.

Den xenoGVHD modellen härmar nära mänsklig akut GVHD sjukdom patogenes och progression30. Till skillnad från murina MHC mismatch GvHD modell tillåter xenogvhd modellen testning av effekten av immunsuppressiva terapier, inklusive mänskliga cellterapier, på mänskliga celler snarare än murina celler. Detta minskar variationen på grund av Art skillnader vid tillämpning av forskningsresultat på kliniken. Den xenoGVHD modellen kan också fungera som en in vivo suppression assay i andra områden av T-cellsforskning. Således, resultat från experiment med hjälp av xenoGVHD modellen kan tillämpas på alla mänskliga T cell-medierad inflammatorisk sjukdom utöver GVHD.

Det finns begränsningar i xenoGVHD-modellen. Dessa inkluderar experimentell variation och möjliga skillnader i GVHD-behandling jämfört med kliniken. Experimentella inkonsekvenser kan bero på skillnader i mus belastning, platser för PBMC-injektion, strålningsdos och mikrobiell miljö30,31. Laboratorier som använder denna modell bör därför försöka standardisera dessa parametrar för att säkerställa konsekventa resultat. I det här protokollet beskriver vi poängsättnings metoder som bidrar till att minska variationen i poängsättningen. Faktorer som kan begränsa jämförbarheten av xenoGVHD-data till kliniska resultat inkluderar avsaknaden av kontrollgrupper som behandlats med GVHD profylaktiska läkemedel och användning av strålning som den enda källan till konditionering i xenoGVHD-modellen31. Dessutom, mekanismen av xenoGVHD inte fullständigt recapitulate den bakomliggande patogenesen i mänsklig GVHD. Till exempel är det givare APCs snarare än värd APCs som aktiverar mänskliga T-celler i xenoGVHD modellen, medan värd APCs spela en viktig roll i human GVHD7. Således, som med de flesta prekliniska modeller, det finns inkonsekvenser och inkompatibiliteter mellan xenoGVHD och mänskliga GVHD som kan begränsa tillämpningen av data som genereras från xenoGVHD till kliniken.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Inga intressekonflikter har deklarerats.

Acknowledgments

Vi skulle vilja erkänna laboratoriet för Lane Christenson för att tillhandahålla den digitala PCR-maskin som används i dessa experiment och för den tekniska support som tillhandahålls. Vi skulle också vilja tacka Dr Thomas Yankee för hans vägledning och mentorskap. Dessa studier stöddes av tripp Family Foundation.

Materials

Name Company Catalog Number Comments
1.5 mL eppendorf tubes Fisher 05-408-129
10 mL serological pipet VWR International 89130-898
10mL BD Vacutainers - Green capped with Sodium Heparin Becton Dickinson 366480
250 µL Ranin pipette tips Rainin 17001118 Do not use other pipettes or pipet tips for droplet generation
50 mL conical tube VWR International 89039-656
96-Well ddPCR plate Bio-Rad 12001925
ACK (Ammonium-Chloride-Potassium) Lysing Buffer Lonza 10-548E Optional
Alcohol Wipes Fisher Scientific 6818
Anesthesia Chamber World Precision Instruments EZ-178 Provided by animal facility
Anesthesia Machine Parkland Scientific PM1002 Provided by animal facility
BD Vacutainer Safety-Lok Blood Collection Set Becton Dickinson 367281
DG8 Cartridges and Gaskets for QX100/QX200 Droplet Generator Bio-Rad 1864007
DNAse and RNAse free Molecular Grade H2O Life Technologies 1811318
Ethyl alcohol, Pure,200 proof, for molecular biology Sigma-Aldrich E7023-500ML
Fetal Bovine Serum Atlanta Biologicals S11150
Ficoll Fisher Scientific 45001750
Insulin Syringe Fisher Scientific 329424
Isoflurane Sigma-Aldrich CDS019936 Provided by animal facility
Liquid nitrogen N/A N/A
Mouse Irradiator Pie Cage Braintree Scientific, Inc. MPC 1 Holds up to 11 mice
Nexcare Gentle Paper Tape (a.k.a. 3M Micropore Surgical Tape / 3/4") Fisher Scientific 19-027-761
P1000 pipetman MidSci A-1000
P200 pipetman MidSci A-200
Pierceable Foil Heat Seal Bio-Rad 1814040
Pipetaid Gilson Macroman Fisher Scientific F110756
Pipet-Lite Multi Pipette L8-200XLS+ Rainin 17013805 Do not use other pipettes or pipet tips for droplet generation
Qiagen DNeasy Blood and Tissue Kit Qiagen 69506
qPCR plates VWR International 89218-292
QX200 Droplet Digital PCR System Bio-Rad 12001925 Includes droplet generator, droplet reader, laptop computer, software, associated component consumables, for EvaGreen or probe-based digital PCR applications
QX200 Droplet Generation Oil for EvaGreen Bio-Rad 1864006
QX200 ddPCR EvaGreen Supermix Bio-Rad 1864033
RNase and DNase-free plate seal Thermo Scientific 12565491
RPMI Advanced 1640 Life Technologies 12633012
Sterile Gauze Pads (2" x 2", 12-Ply) Fisher Scientific 67522
Sterile Phosphate Buffered Saline Fisher Scientific 21040CV
Sterile reservoir VWR International 89094-662
Surgial Scissors Kent Scientific INS600393-4
Surgical Forceps Kent Scientific INS650914-4

DOWNLOAD MATERIALS LIST

References

  1. Jagasia, M., et al. Risk factors for acute GVHD and survival after hematopoietic cell transplantation. Blood. 119, (1), 296-307 (2012).
  2. Bolanos-Meade, J., et al. Phase 3 clinical trial of steroids/mycophenolate mofetil vs steroids/placebo as therapy for acute GVHD: BMT CTN 0802. Blood. 124, (22), quiz 3335 3221-3227 (2014).
  3. Gooley, T. A., et al. Reduced mortality after allogeneic hematopoietic-cell transplantation. New England Journal of Medicine. 363, (22), 2091-2101 (2010).
  4. Hahn, T., et al. Significant improvement in survival after allogeneic hematopoietic cell transplantation during a period of significantly increased use, older recipient age, and use of unrelated donors. Journal of Clinical Oncology. 31, (19), 2437-2449 (2013).
  5. Khoury, H. J., et al. Improved survival after acute graft-versus-host disease diagnosis in the modern era. Haematologica. 102, (5), 958-966 (2017).
  6. King, M. A., et al. Human peripheral blood leucocyte non-obese diabetic-severe combined immunodeficiency interleukin-2 receptor gamma chain gene mouse model of xenogeneic graft-versus-host-like disease and the role of host major histocompatibility complex. Clinical & Experimental Immunology. 157, (1), 104-118 (2009).
  7. Lucas, P. J., Shearer, G. M., Neudorf, S., Gress, R. E. The human antimurine xenogeneic cytotoxic response. I. Dependence on responder antigen-presenting cells. Journal of Immunology. 144, (12), 4548-4554 (1990).
  8. Ito, R., et al. Highly sensitive model for xenogenic GVHD using severe immunodeficient NOG mice. Transplantation. 87, (11), 1654-1658 (2009).
  9. Kawasaki, Y., et al. Comprehensive Analysis of the Activation and Proliferation Kinetics and Effector Functions of Human Lymphocytes, and Antigen Presentation Capacity of Antigen-Presenting Cells in Xenogeneic Graft-Versus-Host Disease. Biology of Blood and Marrow Transplantation. 24, (8), 1563-1574 (2018).
  10. Ito, R., et al. A Novel Xenogeneic Graft-Versus-Host Disease Model for Investigating the Pathological Role of Human CD4(+) or CD8. T Cells Using Immunodeficient NOG Mice. American Journal of Transplantation. 17, (5), 1216-1228 (2017).
  11. Trotta, E., et al. A human anti-IL-2 antibody that potentiates regulatory T cells by a structure-based mechanism. Nature Medicine. 24, (7), 1005-1014 (2018).
  12. Dijke, I. E., et al. Discarded Human Thymus Is a Novel Source of Stable and Long-Lived Therapeutic Regulatory T Cells. American Journal of Transplantation. 16, (1), 58-71 (2016).
  13. Huang, F., et al. Human Gingiva-Derived Mesenchymal Stem Cells Inhibit Xeno-Graft-versus-Host Disease via CD39-CD73-Adenosine and IDO Signals. Frontiers in Immunology. 8, 68 (2017).
  14. Stockis, J., et al. Blocking immunosuppression by human Tregs in vivo with antibodies targeting integrin alphaVbeta8. Proceedings of the National Academy of Sciences of the United States of America. 114, (47), E10161-E10168 (2017).
  15. Vogelstein, B., Kinzler, K. W. Digital PCR. Proceedings of the National Academy of Sciences of the United States of America. 96, (16), 9236-9241 (1999).
  16. Quan, P. L., Sauzade, M., Brouzes, E. dPCR: A Technology Review. Sensors (Basel). 18, (4), (2018).
  17. Sykes, P. J., et al. Quantitation of targets for PCR by use of limiting dilution. Biotechniques. 13, (3), 444-449 (1992).
  18. Ma, H., et al. Evaluation of Bacterial Contamination in Goat Milk Powder Using PacBio Single Molecule Real-Time Sequencing and Droplet Digital PCR. Journal of Food Protection. 1791-1799 (2018).
  19. Vitale, S. R., et al. An optimized workflow to evaluate estrogen receptor gene mutations in small amounts of cell-free DNA. Journal of Molecular Diagnostics. (2018).
  20. Gorgannezhad, L., Umer, M., Islam, M. N., Nguyen, N. T., Shiddiky, M. J. A. Circulating tumor DNA and liquid biopsy: opportunities, challenges, and recent advances in detection technologies. Lab Chip. 18, (8), 1174-1196 (2018).
  21. Yardeni, T., Eckhaus, M., Morris, H. D., Huizing, M., Hoogstraten-Miller, S. Retro-orbital injections in mice. LabAnimal. 40, (5), 155-160 (2011).
  22. Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. Manual restraint and common compound administration routes in mice and rats. Journal of Visualized Experiments. (67), (2012).
  23. Cooke, K. R., et al. An experimental model of idiopathic pneumonia syndrome after bone marrow transplantation: I. The roles of minor H antigens and endotoxin. Blood. 88, (8), 3230-3239 (1996).
  24. Weisdorf, D. J., et al. Prospective grading of graft-versus-host disease after unrelated donor marrow transplantation: a grading algorithm versus blinded expert panel review. Biology of Blood and Marrow Transplantation. 9, (8), 512-518 (2003).
  25. Nervi, B., et al. Factors affecting human T cell engraftment, trafficking, and associated xenogeneic graft-vs-host disease in NOD/SCID beta2mnull mice. Experimental Hematology. 35, (12), 1823-1838 (2007).
  26. Leon-Rico, D., et al. Comparison of haematopoietic stem cell engraftment through the retro-orbital venous sinus and the lateral vein: alternative routes for bone marrow transplantation in mice. LabAnimal. 49, (2), 132-141 (2015).
  27. Ali, N., et al. Xenogeneic graft-versus-host-disease in NOD-scid IL-2Rgammanull mice display a T-effector memory phenotype. PLoS One. 7, (8), e44219 (2012).
  28. van Rijn, R. S., et al. A new xenograft model for graft-versus-host disease by intravenous transfer of human peripheral blood mononuclear cells in RAG2-/- gammac-/- double-mutant mice. Blood. 102, (7), 2522-2531 (2003).
  29. Wunderlich, M., et al. OKT3 prevents xenogeneic GVHD and allows reliable xenograft initiation from unfractionated human hematopoietic tissues. Blood. 123, (24), e134-e144 (2014).
  30. Schroeder, M. A., DiPersio, J. F. Mouse models of graft-versus-host disease: advances and limitations. Disease Models & Mechanisms. 4, (3), 318-333 (2011).
  31. Zeiser, R., Blazar, B. R. Preclinical models of acute and chronic graft-versus-host disease: how predictive are they for a successful clinical translation? Blood. 127, (25), 3117-3126 (2016).
Induktion och poängsättning av graft-versus-host-sjukdom i en Xenogeneisk murin modell och kvantifiering av humana T-celler i mus vävnader med hjälp av digital PCR
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Seng, A., Markiewicz, M. A. Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR. J. Vis. Exp. (147), e59107, doi:10.3791/59107 (2019).More

Seng, A., Markiewicz, M. A. Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR. J. Vis. Exp. (147), e59107, doi:10.3791/59107 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter