Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Forbedret Cross Linking Immunoprecipitation (eCLIP) metode til effektiv identifikation af protein-bundet RNA i Mouse testis

doi: 10.3791/59681 Published: May 10, 2019
* These authors contributed equally

Summary

Her præsenterer vi en eCLIP-protokol for at bestemme store RNA-mål for RBP-kandidater i testikler.

Abstract

Spermatogenesis definerer en højt bestilt proces af mandlige kimcelle differentiering i pattedyr. I testis, transkription og oversættelse er afkoblet, understreger betydningen af post-transkriptional regulering af genekspression orkestreret af RBPs. At belyse mekanistiske roller af en RBP, Cross Linking immunopræcipitation (Clip) metode kan bruges til at indfange sine endogene direkte RNA mål og definere de faktiske interaktion sites. Den forbedrede CLIP (eCLIP) er en nyudviklet metode, der giver flere fordele i forhold til de konventionelle CLIPs. Men, brugen af eCLIP har hidtil været begrænset til cellelinjer, der opfordrer til udvidede applikationer. Her har vi ansat eCLIP til at studere MOV10 og MOV10L1, to kendte RNA-bindende helicases, i mus testis. Som forventet, finder vi, at MOV10 overvejende binder sig til 3 ' uover satte regioner (UTRs) af mRNA og MOV10L1 selektivt binder sig til Piwi-interagerende RNA (piRNA) forløber transkriptioner. Vores eCLIP-metode giver mulighed for hurtig bestemmelse af større RNA-arter, der er bundet af forskellige RBPs via mindre sekvensering af subkloner og dermed tilgængelighed af kvalificerede biblioteker, som en arrestordre til at fortsætte med dyb sekvensering. Denne undersøgelse fastsætter et relevant grundlag for eCLIP i pattedyrs testikler.

Introduction

Mammale testiklerne repræsenterer en fremragende udviklingsmodel, hvor en indviklet Celledifferentiering program kører cyklisk at give talrige spermatozoer. En unik værdi af denne model ligger i fremkomsten af transkriptional inaktivering på visse stadier af spermatogenesen, typisk når meiotisk sex kromosom inaktivering (MSCI) forekommer1,2 og når runde spermatider gennemgår drastisk nuklear komprimering under spermiogenesis3. Disse sammenhængende transkriptionsmæssige hændelser nødvendiggør en regulering efter transkriptional gen, hvor RNA-bindende proteiner (RBPs) spiller en afgørende rolle, idet de danner transkriptomer og bevarer fertiliteten hos hanner.

For at identificere de bona fide-RNA-mål for en individuel RBP in vivo, blev Cross Linking immunopræcipitation (Clip) metodenudviklet til4,5, baseret på, men ud over den regulære RNA immunopræcipitation (RIP)6,7 , ved inkorporering af centrale trin, herunder ultraviolet (UV) Cross Linking, streng vask og gel overførsel for at forbedre signal specificitet. Den avancerede anvendelse af CLIP kombineret med sekvensering med høj gennemløb har vakt stor interesse i profilering af protein-RNA interaktion på genomdækkende niveauer8. Ud over genetiske undersøgelser af RBP-funktion har sådanne biokemiske metoder, der identificerer det direkte samspil mellem endogene proteiner og RNA, været uundværlige for nøjagtigt at belyse de RNA-regulerende roller for RBPs. For eksempel er MOV10L1 en testis-specifik RNA helicase kræves for mandlig fertilitet og Piwi-interagerende RNA (Pirna) Biogenese9. Parallogue MOV10 er kendt som en allestedsnærværende og multifunktionelle RNA helicase med roller i flere aspekter af RNA biologi10,11,12,13,14 , 15 af , 16 ud af , 17 ud af , 18. ved at ansætte den konventionelle Clip-SEQ, vi fandt, at MOV10L1 binder og regulerer primære Pirna prækursorer til at initiere tidlig Pirna behandling19,20, og at MOV10 binder mRNA 3 ' utrs og samt Noncoding RNA arter i testikel kimceller (data ikke vist).

Ikke desto mindre, CLIP er oprindeligt en besværlig, radioaktiv procedure efterfulgt af sekvensering bibliotek forberedelse med et bemærkelsesværdigt tab af CLIP Tags. I den konventionelle CLIP, er et cDNA bibliotek forberedt ved hjælp af adaptere ligeret ved begge RNA ekstremiteter. Efter protein fordøjelsen forbliver kryds sammenkædede korte polypeptider knyttet til RNA-fragmenter. Dette kryds bindende mærke delvist blokerer reverse transkriptase (rtase) progression under cDNA syntese, hvilket resulterer i afkortede cdnas, som repræsenterer omkring 80% af cDNA Library21,22. Således er det kun cDNA-fragmenter som følge af RTase, der springer over Cross Linking-stedet (læse-through), der er sekvenseret. For nylig, forskellige CLIP tilgange, såsom PAR-CLIP, iCLIP, eCLIP og uvCLAP, har været ansat til at identificere crosslink sites af RBPs i levende celler. PAR-CLIP involverer anvendelse af 365 nm UV-stråling og fotoaktivatable nukleotidanalotter og er derfor eksklusivt til in-culturing levende celler, og inkorporering af nukleosid analoler i nysyntetiserede udskrifter er tilbøjelige til at producere bias hvor RNA fysisk interagerer med protein23,24. I iCLIP er det kun en enkelt adapter, der er ligeret til de 3 ' ekstremiteter af crosslinked RNA-fragmenter. Efter reverse transkription (RT), er både afkortet og læse-gennem cdnas opnået ved intramolecularly cirkularisering og re-linearisering efterfulgt af polymerase kædereaktion (PCR) amplifikation25,26. Effektiviteten af intramolekylær cirkularisering er dog relativt lav. Selv om ældre CLIP-protokoller har brug for mærkning af crosslinked RNA med en radioisotop, ultraviolet Cross linking og Affinity rensning (uvCLAP), med en proces med streng tandem affinitets rensning, er ikke afhængig af radioaktivitet27. Ikke desto mindre er uvCLAP begrænset til kultiverede celler, der skal transficeret med udtrykket vektor bærer 3x FLAG-HBH tag for tandem affinitet rensning.

I eCLIP blev adaptere ligeret først ved 3 ' ekstremiteten af RNA efterfulgt af RT, og derefter ved 3 ' ekstremiteterne af cDNAs i en intermolekylær tilstand. Derfor er eCLIP i stand til at indfange alle afkortet og læse-through cDNA28. Også, det er hverken begrænset til radioaktiv mærkning, eller at bruge cellelinjer baseret på dens princip, samtidig med at enkelt-nukleotid opløsning.

Her giver vi en trinvis beskrivelse af en eCLIP-protokol, der er tilpasset musens testikler. Kort, denne eclip protokol starter med UV tværbinding af testikel tubuser, efterfulgt af delvis RNase fordøjelse og immunopræcipitation ved hjælp af et protein-specifikt antistof. Dernæst er det proteinbundne RNA dephosphoryleret, og adapteren er ligeret til dens 3 ' ende. Efter protein gel elektroforese og overførsel af gel til membran isoleres RNA ved at skære membran arealet af et forventet størrelsesinterval. Efter RT er DNA-adapteren ligeret til 3 ' enden af cDNA efterfulgt af PCR-forstærkning. Screening af subkloner forud for sekventering med høj hastighed tages som en Biblioteks kvalitetskontrol. Denne protokol er effektiv til at identificere de vigtigste arter af protein-bundet RNA af RBPs, eksemplificeret ved de to testis-udtrykker RNA helicases MOV10L1 og MOV10.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle udførte dyreforsøg er blevet godkendt af Nanjing Medical University Committee. Mand C57BL/6-mus blev holdt under kontrollerede lysdrifts betingelser og blev forsynet med mad og vand.

1. vævs høst og UV crosslinking

  1. Euthanize 2 voksne mus bruger kuldioxid (CO2) for 1-2 min eller indtil vejrtrækningen stopper. Derefter skal du udføre cervikal dislokation på hver mus.
  2. Høst omkring 100 mg testiklerne fra mus i passende alder (en voksen testikler i dette studie) for hvert immunopræcipitation eksperiment, og læg vævene i iskoldt fosfatbuffer (PBS).
  3. Fjern tunika albugineen forsigtigt med et par fintippet pincet.
  4. Tilsæt 3 ml iskold PBS i en vævs mølle og udriv vævet ved mild mekanisk kraft ved hjælp af en løs glas Pestle (type a glas Pestle).
    Bemærk: Formålet med dette trin er ikke at lyse celler, men at trække hinanden væv. Det er vigtigt at bevare cellernes levedygtighed og integritet.
  5. Vævs suspensionen overføres til en cellekultur skål (10 cm i diameter), og der tilsættes iskold PBS op til 6 mL.
  6. Ryst pladen hurtigt, så væsken dækker bunden af skålen jævnt. Hvis vævet er formalet korrekt, vil jævnt fordelte seminiferøse tubuser være synlige, hvorimod tilstedeværelsen af vævs klumper indikerer, at vævs spredningen er suboptimal.
  7. Crosslink suspensionen tre gange med 400 mJ/cm2 ved 254 nm på is. Bland suspensionen mellem hver bestråling.
    Bemærk: For hvert nyt eksperiment skal Cross Linking optimeres.
  8. Suspensionen opsamles i et 15 mL konisk rør og pellet ved 1.200 x g i 5 min ved 4 °c. Supernatanten fjernes, og pellet opslæmmet i 1 mL PBS, hvorefter suspensionen overføres til et 1,5 mL centrifugeglas. Drej ved 4 °C og 1.000 x g i 2 min., og Fjern supernatanten.
  9. På dette tidspunkt, straks fortsætte med resten af protokollen, eller snap fryse pellets i flydende kvælstof og opbevares ved-80 °C indtil brug.

2. forberedelse af perler

  1. Der tilsættes 125 μL protein A magnetiske perler pr. prøve (pellet) til et friskt centrifugeglas.
    Bemærk: Brug protein G magnetiske perler til mus antistoffer.
  2. Anbring røret på magneten for at adskille perlerne fra opløsningen. Efter 10 s, fjerne supernatanten. Vask perler to gange med 1 mL iskold lysis buffer.
    Bemærk: Efterfølgende adskillelse af protein en magnetisk perler følger dette trin. Lysis buffer sammensætning er 50 mM Tris-HCl, pH 7,5; 100 mM NaCl; 1% NP-40; 0,1% SDS; 0,5% natriumdeoxycholat; 1/50 ethylenediaminetetraeddikesyre (EDTA)-fri proteasehæmmer cocktail (tilsæt frisk).
  3. Perler gensuspenderes i 100 μL kold lyse buffer med 10 μg eCLIP-antistof. Rotér rørene ved stuetemperatur i 45 min.
    Bemærk: Den endelige antistofkoncentration for immunopræcipitation er 10 μg/ml. Hvis antistofkoncentrationen er ukendt, skal mængden af antistof optimeres.
  4. Vask perler to gange med 1 mL iskold lysis buffer.

3. vævs lysis og delvis RNA-fordøjelse

  1. Vævs pellets resuspenderes i 1 mL kold lyse buffer (tilsæt 22 μL 50x (EDTA)-fri protein inhibitor cocktail og 11 μL RNase-hæmmer til 1 mL lysis-buffer).
    1. Resuspender to UV-krydslinkede pellets og to ikke-krydslinkede pellets per gruppe af eksperimenter: UV-crosslinked-1 pellets til eCLIP bibliotek (UV-1); UV-crosslinked-2 pellets til eCLIP bibliotek (UV-2); ikke-crosslinked-1 pellets til eCLIP bibliotek som en kontrol (ikke-UV); ikke-crosslinked-2 pellets for IgG IP at demonstrere specificitet af antistoffer.
      Bemærk: den ideelle kontrol til eCLIP-biblioteket af de UV-kryds forbundne vidvinkel-testikler er den UV-kryds sammenkædede knockout testiklerne fra mus af samme kuld.
  2. Hold lyserende prøverne på is i 15 min (for at forhindre nedbrydning af protein og RNA).
  3. Sonicate i en digital sonicator ved 10% amplitude i 5 min, ved 30 s on/30 s off. Prøven anbringes altid på is, og sonden rengøres med nukleasefri vand mellem hver prøve.
  4. Tilsæt 4 μL DNase til hvert rør, og bland godt. Der inkube i 10 min ved 37 °C, omrystes ved 1.200 rpm.
  5. Tilsæt 10 μL fortyndet RNase i (4 e/μL RNase i i PBS), og bland godt. Der inkurueres i 5 min ved 37 °C, idet der rystes ved 1.200 rpm.
  6. Lysatet ryddes ved centrifugering ved 15.000 x g i 20 min. (ved 4 °c).
  7. Saml forsigtigt supernatanten. Efterlad 50 μL af lysatet og kassér pellet med det.
  8. Gem input eksempler som Rwb (Kør for Western blot) og rri (Kør for RNA-isolation). Spar 20 μL (2%) af UV-1-, UV-2-, ikke-UV-og IgG-prøver som input til RWB-gel-belastning. Spar 20 μL (2%) af UV-1-eller UV-2-prøver som input til RRI-gel-belastning.

4. immunoprecipitation

  1. Der tilsættes 1 mL af lysatet (fra trin 3,7) til perlerne (fremstillet i punkt 2), og prøverne drejes ved 4 °C i 2 timer eller natten over.
  2. Saml perlerne med en magnetisk stander og kassér supernatanten. Perlerne vaskes to gange med 900 μL høj salt buffer (50 mM Tris-HCl, pH 7,5; 1 M NaCl; 1 mM EDTA; 1% NP-40; 0,1% SDS; 0,5% natrium deoxycholat), og vask derefter perler to gange med 900 μL vaskebuffer (20 mM Tris-HCl, pH 7,5; 10 mM MgCl2; 0,2% Tween-20).
    Bemærk: For IgG prøven, pause proceduren her og gemme på is i vaskebuffer.
  3. Vask perler en gang med 500 μl 1x dephosphorylering buffer (10 mm Tris-HCl, pH 7,5; 5 mm mgcl2; 100 mm KCl; 0,02% Triton X-100).

5. dephosphorylering af RNA 3 ' ender

  1. Saml perlerne med en magnetisk stander og kassér supernatanten. Fjern rest væsken ved hjælp af fine pipettespidser. Der tilsættes 100 μL dephosphoryleringmastermix (10 μL 10x dephosphoryleringbuffer [100 mM Tris-HCl, pH 8,0; 50 mM MgCl2; 1 M kcl; 0,2% Triton X-100; 1 mg/ml bovint serumalbumin (BSA)]; 78 μl nukleasefri vand; 2 μl RNase-hæmmer; 2 μl DNase; 8 μl al kalinfosfatase) til hver prøve og inkube i 15 min ved 37 °C, idet der rystes ved 1.200 rpm.
  2. Der tilsættes 300 μL polynukleotidkinase (PNK) Master Mix (60 μL af 5x PNK pH 6,5 buffer [350 mM Tris-HCl, pH 6,5; 50 mM MgCl2]; 223 μl nukleasefri vand; 5 μl rnasehæmmer; 2 μl DNase; 7 ΜL pnk-enzym; 3 μl 0,1 M dithiothreitol) til hver prøve , inkube i 20 min ved 37 °C, ryster ved 1.200 rpm.
  3. Saml perlerne med en magnetisk stander og kassér supernatanten. Vask perler én gang med 500 μL kold vaskebuffer. Vask derefter perler en gang med 500 μL kold høj salt buffer. Gentag disse skyller igen i denne rækkefølge.
  4. Vask perler en gang med 500 μL kold vaskebuffer og derefter to gange med 300 μL kold 1x ligation buffer (ingen dithiothreitol, 50 mM Tris-HCl, pH 7,5; 10 mM MgCl2).

6. RNA-adapter ligation til RNA 3 ' ender

  1. Kassér supernatanten, og fjern rest væsken med fine pipettespidser. Der tilsættes 25 μL 3 ' ligationmastermix til hver prøve. Bland forsigtigt ved pipettering. Dette trin er tilbøjelige til at producere bobler.
    Bemærk: Ligation Master Mix indeholder 3 μL 10x ligation buffer [500 mM Tris-HCl, pH 7,5; 100 mM MgCl2]; 9 μL nukleasefri vand; 0,4 μL af RNase-hæmmer; 0,3 μL af 0,1 M ATP; 0,8 μL dimethylsulfoxid (DMSO); 9 μL 50% polyethylenglycol (PIND) 8000; 2,5 μL RNA-ubiquitinligase [30 e/μL].
  2. Der tilsættes 2,5 μL RNA-adapter X1A (tabel 1) og 2,5 μl RNA-adapter X1B (tabel 1) til hver prøve. Bland forsigtigt ved pipettering eller svippe, og inkube i 75 min ved 25 °c, svipå for at blande hver 10 min.
  3. Vask perler en gang med 500 μL kold vask buffer (Genoptag IgG prøve her).
  4. Vask perler en gang med 500 μL kold høj salt buffer og derefter med 500 μL kold vaskebuffer. Gentag disse skyller igen.
  5. Magnetisk adskilte perler, og fjerne resterende væske med fine pipettespidser.
  6. Opslæb perlerne i 100 μL kold vaskebuffer (sæt IgG-prøven på pause her, og opbevar den på is i vaskebufferen). Der flyttes 20 μL til nye rør som RWB-prøver. De resterende 80 μL magnetisk adskilles som RRI-prøver. Fjern RRI-prøverne supernatanten, og resuspender perlerne i 20 μL vaskebuffer.
  7. Tilsæt 37,5 μL af 4X lithium dodecyl sulfat (LDS) prøve buffer og 15 μL 10x prøve reduktionsmiddel til IgG prøven. Der tilsættes 7,5 μL af 4X SDH-prøve buffer og 3 μL 10 x prøve reduktionsmiddel til de (resterende) prøver. (Må ikke blandes med pipette Rings). Der inkube i 10 min ved 70 °C, omrystes ved 1.200 rpm. Der afkøles på is i 1 min, og centrifugeres ved 1.000 x g i 1 min ved 4 °c.

7. SDS-side og membran overførsel

  1. Belastning gels.
    1. For RRI gel (4-12% bis-Tris protein gel, 10-brønd, 1,5 mm) anbringes rørene på en magnet og et separat protein eluat fra perlerne. Der skal indlæses 30 μL prøve pr. brønd. Prøverne er fordelt på præ-farvet protein størrelses markør.
    2. For RWB gel (4-12% bis-Tris protein gel, 10-brønd, 1,5 mm) anbringes rørene på en magnet og et separat protein eluat fra perlerne. Der skal indlæses 15 μL prøve pr. brønd. Gem de resterende prøver ved-20 °C som sikkerhedskopier.
  2. Der tilsættes 500 μL antioxidant til 500 mL 1x SDS-løbe buffer. Køre på 200 V i 1x SDS kører buffer for 50 min eller indtil farvestof front er i bunden.
    Bemærk: Antioxidant indeholder N, N-dimethylformamid, natrium bisulfit, som migrerer med reducerede proteiner for at forhindre reoxidation af følsomme aminosyrer som methionin og tryptophan.
  3. Overfør protein-RNA-komplekser fra gelen til en nitrocellulose membran ved 10 V for 70 min i 1xtransfer buffer med 10% methanol (Vol/Vol). Skyl RRI membranen i kold PBS, Pak den i plastikfolie, og opbevar den ved-80 °C.
  4. Bloker RWB-membranen i 5% mælk i TBST ved stuetemperatur i 1 time. Skyl membranen i TBST. Der inkumeres med det primære antistof i TBST ved 4 °C om natten. Vask to gange med TBST i 5 min. Inkuperer med sekundært antistof (1:5000 HRP Goat anti-kanin IgG) i TBST ved stuetemperatur i 1 time. vask tre gange med TBST i henholdsvis 5 min, 10 min og 15 min.
  5. Bland lige store mængder af elektrochemiluminescens (ECL) buffer A og buffer B, tilsæt membranen og inkube i 1 min. dæk membranen med plastikfolie, og Udsæt den for en røntgenfilm ved stuetemperatur i 2-3 min. Derefter udvikle filmen.
    Bemærk: Filmen med overeksponering vil tydeligt vise formen af membranens kanter, hvorved filmen kan justeres tilbage til RWB membranen. Derefter justeres RWB og RRI membraner baseret på positionerne af markører deri. Lagdelt i rækkefølge fra bund til top er filmen, RWB membranen og RRI membranen i rækkefølge.

8. RNA-isolation

  1. Skær regionen fra protein bandet til 75 kDa (ca. 220 NT af RNA) over det, ved hjælp af RWB membran og film som guider.
    Bemærk: Da et protein beskyttet RNA-molekyle kan have en maksimumlængde på 225 baser, med ca. 340 da pr. base, er det rimeligt at klippe regionen omkring 75 kDa over RBP-båndet for at hente alle protein-RNA-komplekser.
  2. Skær det exciserede stykke membran i flere små skiver, og læg dem i et frisk 1,5 mL centrifugeglas. Der tilsættes 200 μL proteinase K (PK) buffer (100 mM Tris-HCl pH 7,5; 50 mM NaCl; 10 mM EDTA) med 40 μL PK til membran delene. Blandingen blandes og inkueres i 20 min ved 37 °C, idet der rystes ved 1.200 rpm.
  3. Der tilsættes 200 μL PK-urea-buffer (100 mM Tris-HCl pH 7,4; 50 mM NaCl; 10 mM EDTA; 7 M urea) til hver prøve. Inkube i 20 min ved 37 °C, ryster ved 1.200 rpm.
  4. Der tilsættes 400 μL syre phenol/chloroform/isoamylalkohol (25:24:1), blandes godt og inkuleeres i 5 min ved 37 °C, og der rystes ved 1.200 rpm.
  5. 2 mL tungt rør med faslås (PLG) anbringes i centrifugen og centrifugeres ved 15.000 x g i 25 s.
  6. Overfør alt indhold undtagen membran skiver til PLG Heavy tube. Der inkurueres i 5 min ved 37 °C, idet der rystes ved 1.200 rpm.
  7. Drej ved stuetemperatur og 15.000 x g i 15 min. Overfør det vandige lag til et nyt 15 ml konisk rør.
  8. Brug RNA-rensning og koncentrations kolonner til at udtrække RNA.
    1. Der tilsættes 2 bind (800 μL) RNA-bindings buffer til hver prøve (fra trin 8,7) og blandes. Der tilsættes en tilsvarende mængde (1200 μL) af 100% ethanol og blandes.
    2. Der overføres 750 μL prøve (fra trin 8.8.1) til RNA-rensnings-og koncentrations kolonnerne i en opsamlings slange, og der centrifugeres ved 15.000 x g i 30 s. gennemstrømning.
    3. Gentag trin 8.8.2, indtil alle prøver er passeret gennem kolonnen. Der tilsættes 400 μL RNA-prep-buffer til kolonnen, og der centrifugeres ved 15.000 x g i 30 s. gennemstrømning, Anvend 700 μl RNA-vaskebuffer, og centrifuge kolonnen ved 15.000 x g i 30 s. udsmid gennemstrømning.
    4. Der tilsættes 400 μL RNA-vaskebuffer til kolonnen, og der centrifugeres ved 15.000 x g i 2 min. kolonnen overføres forsigtigt til et nyt 1,5 ml rør. Der tilsættes 10 μL nukleasefri vand til kolonne matrixen, lad det sidde i 2 min og centrifugeres ved 15.000 x g i 30 s. Opbevar eclip-prøverne ved-80 °C indtil RT (trin 11,1).

9. dephosphorylering af input RNA 3 ' ender

  1. Der tilsættes 15 μL dephosphoryleringmastermix (2,5 μL 10x dephosphoryleringbuffer [100 mM Tris-HCl, pH 8,0; 50 mM MgCl2; 1 M kcl; 0,2% Triton X-100; 1 mg/ml BSA]; 9,5 μl nukleasefri vand; 0,5 μl RNase-hæmmer; 2,5 μl alkalisk fosfatase) til 10 μl input prøver (fra trin 8.8.4). Inkube i 15 min ved 37 °C, ryster ved 1.200 rpm.
  2. Der tilsættes 75 μL PNK Master Mix (20 μL 5x PNK PH 6,5 buffer [350 mM Tris-HCl, pH 6,5; 50 mM MgCl2]; 44 μl nukleasefri vand; 1 μl RNase-hæmmer; 2 μl DNase; 7 ΜL pnk-enzym; 1 μl 0,1 M dithiothreitol) til prøverne. Inkube i 20 min ved 37 °C, ryster ved 1.200 rpm.
  3. Oprydning af input-RNA
    1. Gensuspension af den magnetiske beadi hætteglasset (vortex i mere end 30 s). Der tilsættes 20 μL nukleinsyre ekstraktions magnetiske perler for hver prøve til nye rør. Saml perlerne med en magnetisk stander og kassér supernatanten.
    2. Vask perler én gang med 1 mL RNA-rensnings lysis-buffer (RLT-buffer). Anbring røret på en magnet i 30 s og kassér supernatanten.
      Bemærk: Efterfølgende adskillelse af nukleinsyre udvinding magnetiske perler fulgt dette trin.
    3. Resuspension af perler med 300 μL RLT buffer og tilsættes til prøven. Der tilsættes 10 μL 5 M NaCl og 615 μL 100% ethylalkohol (EtOH) og blandes ved pipettering. Drej ved stuetemperatur i 15 minutter. magnetisk adskille perlerne og fjerne supernatant.
    4. Resuspension af perler i 1 mL 75% EtOH og overførsel til et nyt rør. Efter 30 s, indsamle perlerne med en magnetisk stativ og kassere supernatanten. Vask to gange med 75% EtOH, magnetisk adskille perlerne, og kassér residualvæsken med fine pipettespidser. Lufttørres i 5 min. (undgå overdreven tørring).
    5. Perlerne resuspenderes med 10 μL nukleasefri vand, og de inkueres i 5 minutter. magnetisk adskilte perler, og Flyt 5 μL supernatanten til et nyt rør (for 3 ' adapter ligation nedenfor). Det resterende RNA kan opbevares ved-80 °C som sikkerhedskopier.

10. RNA-adapter ligation til input RNA 3 ' ender

  1. Der tilsættes 1,5 μL DMSO og 0,5 μL RiL19 adapter (tabel 1) til 5 μl input-RNA (fra trin 9.3.5), inkuberes i 2 min ved 65 °c og anbringes på is i mere end 1 min. Tilsæt 13,5 μl af 3 ' ligation Master Mix til hver prøve , blandes ved pipettering, og inkube i 75 min ved 25 °c, med svippe at blande hver 15 min.
    Bemærk: Ligation Master Mix indeholder 2 μL 10x ligation buffer [500 mM Tris-HCl, pH 7,5; 100 mM MgCl2; 10 mm dithiothreitol]; 1,5 μL nukleasefri vand; 0,2 μL af RNase-hæmmer; 0,2 μL af 0,1 M ATP; 0,3 μL DMSO; 8 μL 50% PEG8000; 1,3 μL RNA-ubiquitinligase [30 e/μL].
  2. Oprydning af ligeret input-RNA
    1. Ved magnetisk adskillelse af 20 μL nukleinsyre ekstraktion af magnetiske perler for hver prøve, og Fjern supernatanten. Vask perler én gang med 1 mL RLT buffer.
    2. Perler opslæmmet i 61,6 μL RLT buffer og Overfør suspension til hver prøve. Tilsæt 61,6 μL af 100% EtOH. Brug pipette til at blande i 15 min hver 5 min. magnetisk adskilte perler, og fjern supernatant.
    3. Gentag trin 9.3.4.
    4. Resuspension perler med 10 μL nuklease-fri vand, og lad det sidde i 5 min. magnetisk adskille perlerne og overføre 10 μL af supernatanten til et nyt rør.
      Bemærk: Dette er et muligt stoppunkt (input prøverne kan opbevares ved-80 °C til næste dag).

11. omvendt transkription, DNA adapter ligation til cDNA 3 ' Ends

  1. Der tilsættes 0,5 μL RT-primer (tabel 1) til 10 μl input-RNA (fra trin 10.2.4) og 10 ΜL Clip RNA (fra trin 8.8.4), der inkures i 2 min i FORVARMET PCR-blok ved 65 °c, anbringes på is i mere end 1 min.
  2. Der tilsættes 10 μL RT Master Mix (2 μL RT buffer [500 mM Tris-HCl, pH 8,3; 750 mM KCl; 30 mM MgCl2]; 4 μl nukleasefri vand; 0,3 μl rnasehæmmer; 2 ΜL 0,1 m dithiothreitol; 0,2 μl af 0,1 m datp; 0,2 μl af 0,1 m dctp; 0,2 μl af 0,1 M dGTP; 0,2 μL af 0,1 M dTTP; 0,9 μL revers transkriptase) til hver prøve blandes, inkube ved 55 °C i 45 min på en forvarmet PCR-blok.
  3. Der blandes 20 μL RT reaktionsprodukt med 3,5 μL PCR-produkt oprydnings reagens. Inkubeter i 15 min ved 37 °C.
  4. Tilsæt 1 μL af 0,5 M EDTA, bland ved pipettering. Der tilsættes 3 μL 1 M NaOH, blandes ved pipettering, og der inkueres i 12 min ved 70 °C på en PCR-blok for at hydrolysere skabelon-RNA.
  5. Der tilsættes 3 μL 1 M HCl, pipette-mix for at neutralisere bufferen.
  6. Oprydning af cDNA
    1. Ved magnetisk adskillelse af 10 μL nukleinsyre ekstraktions magnetiske perler for hver prøve fjernes supernatanten. Vask én gang med 500 μL RLT-buffer.
    2. Perler opslæmmet i 93 μL RLT buffer og Overfør suspension til prøven. Der tilsættes 111,6 μL af 100% EtOH, inkuleteres i 5 min. og pipette blandes hver 2. Saml perlerne med en magnetisk stander og kassér supernatanten. Resuspension perler med 1 mL 80% EtOH og flytte til en ny tube.
    3. Efter 30 s, indsamle perlerne med en magnetisk stativ og kassere supernatanten. Vask to gange med 80% EtOH. Magnetisk adskillelse og kassér residualvæsken med fin spids. Lufttørres i 5 min. (undgå overdreven tørring). Perlerne resuspenderes i 5 μL 5 mM Tris-HCl og inkueres i 5 minutter.
  7. Der tilsættes 0,8 μL DNA-adapter (tabel 1) og 1 ΜL DMSO til perlerne, der inkuerer i 2 minutter ved 75 °c. Læg på is i mere end 1 min.
  8. Der tilberedes 12,8 μL ligationmastermix (2 μL 10x ligations buffer [500 mM Tris-HCl; 100 mM MgCl2; 10 mm dithiothreitol]; 1,1 μl nukleasefri vand; 0,2 μl af 0,1 M ATP; 9 μl af 50% PEG8000; 0,5 μl RNA-ubiquitinligase [30 e/μl]) , svirp for at blande, spin kortvarigt i en centrifuge, og tilsæt det til hver prøve, rør prøven med pipettespidsen langsomt.
  9. Der tilsættes yderligere 1 μL RNA-ubiquitinligase [30 e/μL] til hver prøve, og svirp for at blande. Der inkurueres i 30 s ved 25 °C, idet der rystes ved 1.200 rpm. Der inkubeeres ved 25 °C natten over. Svip for at blande let 5 til 6 gange, en gang i timen.
  10. Oprydning af ligeret cDNA
    1. Ved magnetisk adskillelse af 5 μL nukleinsyre ekstraktion af magnetiske perler for hver prøve, og fjern supernatant.
    2. Vask en gang med 500 μL RLT buffer.
    3. Resuspension af perler i 60 μL RLT buffer til perler og overførsel suspension til hver prøve. Tilsæt 60 μL af 100% EtOH, inkuperer det i 5 min og pipette mix hver 2 min. magnetisk adskilt, kassér supernatant.
    4. Gentag trin 9.3.4.
    5. Resuspension af perler med 27 μL 10 mM Tris-HCl, inkuperer den i 5 min. magnetisk adskilt, og Flyt 25 μL prøve til et nyt rør. 1 μL ligeret cDNA fortyndes med 9 μL nukleasefri vand i et nyt rør. De resterende prøver opbevares ved-20 °C indtil trin 13,1.

12. kvantificering af cDNA ved real-time kvantitativ PCR (qPCR)

  1. Der tilsættes 9 μL qPCR-mastermix (5 μL 2x Master Mix; 3,6 μL nukleasefri vand; 0,4 μL primer mix [10 μM PCR-F-D50X og 10 μM PCR-R-D70X]) til en 96-Well qPCR-plade. Der tilsættes 1 μL 1:10 fortyndet (i H2O) cDNA (fra trin 11.10.5), tætning og blanding.
  2. Kør qPCR-programmet i en termo cycler: 2 min ved 50 °C; 2 min ved 95 °C; 3 s ved 95 °C efterfulgt af 30 s ved 68 °C i 40 cyklusser; 15 s ved 95 °C efterfulgt af 60 s ved 68 °C efterfulgt af 15 s ved 95 °C i 1 cyklus. Note CT (cyklus tærskel) værdi.

13. PCR-forstærkning af cDNA

  1. Der dispenseres 35 μL PCR-mastermix (25 μL 2x PCR-mastermix; 5 μL nukleasefri vand; 5 μL primer mix [20 μM PCR-F-D50X og 20 μM PCR-R-D70X]) i 8-brønd strimler. For CLIP-gruppen tilsættes 12,5 μL af CLIP-prøven + 2,5 μL af H2O; for input gruppen tilsættes 10 μL indgange + 5 μL H2O. Bland godt og drej kortvarigt i centrifuge.
  2. Kør PCR-programmet: 30 s ved 98 °C; 15 s ved 98 °C efterfulgt af 30 s ved 68 °C efterfulgt af 40 s ved 72 °C i 6 cyklusser. 15 s ved 98 °C efterfulgt af 60 s ved 72 °C for N-cyklusser = (qPCR CT-værdier-3)-6; 60 s ved 72 °C; 4 °C holder.
    Bemærk: Det er bedre at udføre 1 til 2 ekstra PCR cyklusser for de første par klip.

14. gel rensning

  1. Indlæs prøver på en 3% højopløsnings-agopstået gel. Forlader 1 tom godt mellem prøverne, og bruge en stige på begge sider af gelen. Kør ved 100 V for 75 min i 1x Tris-Borate-EDTA (TBE) buffer.
  2. Under blåt lys, skæres gel skiver 175-350 BP ved hjælp af friske barberblade til hver prøve. Anbring dem i 15 mL koniske rør.
    1. Veje geludsnittet, og elutere gelen ved hjælp af et gel ekstraktions kit.
    2. Tilsæt 6x volumen af gel opløsning buffer til at smelte gel (100 mg gel = 600 μL gel opløsning buffer). Opløs gelen ved stuetemperatur. (Ryst for at blande hver 15 min, indtil geludsnittet er helt opløst). Tilsæt 1 gel volumen på 100% isopropanol og bland godt.
    3. Der overføres 750 μL prøve (fra trin 14.2.2) til kolonnen i en opsamlings slange, og der centrifugeres ved 17.900 x g i 1 min. gennemstrømning.
    4. Gentag trin 14.2.3 indtil alle prøver er passeret gennem kolonnen, vask én gang med 500 μL gel opløsning buffer.
    5. Der tilsættes 750 μL vaskebuffer (fra gel-ekstraktions kittet) til kolonnen, og der centrifugeres ved 17.900 x g i 1 min. gennemstrømning, spin ved 17.900 x g i 2 min. Anbring kolonnen i et nyt 1,5 ml rør.
    6. Fjern al resterende vaskebuffer fra kolonnens plastik lilla rand. Lufttørres i 2 min. Tilsæt 12,5 μL nukleasefri vand til midten af membranen. Lad kolonnen stå i 2 minutter ved stuetemperatur, og spin ved 17.900 x g i 1 min (for et forbedret udbytte, skal du gentage elutions trinnet).

15. TOPO klon af PCR produkt

  1. Forbered TOPO-klonings reaktionsblandingen (1 μL PCR-produkt fra trin 14.2.6; 1 μL klonings blanding; 3 μL sterilt vand). Bland forsigtigt og inkubeter i 5 min ved 20-37 °C. Kølig på is.
  2. Tø kemisk kompetente E. coli bakterier på is. Der tilsættes 5 μL af TOPO klonings produktet til 100 μL af de kompetente bakterier29. Bland forsigtigt godt. Inkube på is i 30 min.
  3. Varmechok for 60 s ved 42 °C. Derefter afkøles på is i 2 min. Tilsæt 900 μL lysogeny bouillon (LB) medium, inkube ved 37 °C i 1 time, omrystning ved 225 rpm. Spin ved 1.000 x g i 1 min., og fjern derefter 900 μl supernatant. Resuspender resten af opløsningen.
  4. Plaid de transformerede bakterier på 1,5% LB agar plader indeholdende ampicillin (100 μg/mL), og inkube natten ved 37 °C.
  5. Der tilberedes mindst 20 1,5 mL centrifugeglas til hver konstruktion. Fyld et sæt med 500 μL LB-medium indeholdende 100 μg/mL ampicillin. Brug en steril pipettespids til at ridse en bakterie koloni tilfældigt og bland (ved pipettering) med 500 μL LB-medium. Der inkubeeres ved 37 °C i 5 timer, idet der rystes ved 225 rpm.
  6. Sæt skærstykket i sekvens ved hjælp af M13 reverse primer: CAGGAAACAGCTATGAC af sanger Sequencing30.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Eclip-proceduren og resultaterne er illustreret i figur 1, figur 2, figur 3, figur 4. Mus blev aflives med kuldioxid og en lille indsnit blev foretaget i den nedre abdomen ved hjælp af kirurgiske saks (figur 2a,B). Muse testiklerne blev fjernet, detuniurt og derefter UV-crosslinked efter slibning (figur 2c-I). Repræsentative eCLIP-resultater ved brug af to kendte RNA-bindende helicases i testikler er afbildet i figur 3 og 4. Vi udførte MOV10 eCLIP i testiklerne fra voksne vild-type mus, med fælles koncentration af 40 U/mL RNase jeg behandle crosslinked lysate. Det øverste panel i figur 3a viser, at målproteinet størrelse omkring 114 kDa blev beriget med succes. Western blot af de immunoprecipiterede MOV10L1 proteiner blev udført med to koncentrationer (5 eller 40 e/mL) af RNase i under eCLIP-processen (figur 3a). Figur 3B viser qPCR ved hjælp af 1:10 fortyndet cDNA (allerede ligeret med DNA-adapter) fra MOV10 og MOV10L1 UV-crosslinked, ikke-crosslinked, og den parrede størrelse matchede input (sminput) prøve. Ikke-kryds sammenkædede prøver viser nedsat RNA-opsving. Vi bemærkede, at CT-værdier af den ikke-kryds forbundne gruppe var generelt 5 gange mere end UV-crosslinked gruppe. Figur 4a viser PCR-forstærkning og størrelsesvalg via agopstået gel elektroforese (cut 175-350 BP). Primer-dimer produkt vises på omkring 140 BP. figur 4b viser UCSC genombrowseren visning af to repræsentative subklon-sekvenser. MOV10-bundne eCLIP-Tags findes at være placeret inden for 3 ' UTR for gen FTO; Den omtrentlige sats på 3 ' UTR-mål tegner sig for 75% (figur 4c), hvilket er i overensstemmelse med de fleste MOV10-mål i HEK293-cellerne10 og i testiklerne (data ikke vist). I modsætning hertil findes MOV10L1-bundne eCLIP-Tags, der er placeret i en piRNA-klynge, der angiver MOV10L1 mål piRNA-prækursorer. Den omtrentlige hastighed af piRNA prækursormål tegner sig for 42% (figur 4E), hvilket afspejler en tendens fra vores tidligere konventionelle Clip eksperiment20. MOV10L1 eCLIP med 40 U/mL RNase I fordøjelsen udbytter relativt flere sekvenser med mindre end 20 BP (figur 4d).

Figure 1
Figur 1 : Skematisk repræsentation af eCLIP. UV-kryds sammenkædede mus seminiferøse tubuser (trin 1) er lyseret i eclip lysis buffer og sonikeret (trin 2). Lysate behandles med RNase I for at fragmentere RNA, hvorefter protein-RNA-komplekser er immunoprecipiteret ved hjælp af anti-RBP-antistoffet (trin 3-4). Dephosphorylering af RNA-fragmenter og ligation af 3 ′ RNA-adapter udføres (trin 5-6). Protein-RNA-komplekser køres på en SDS-PAGE gel og overføres til nitrocellulose membraner (trin 7). RNA udvindes fra membranen ved at fordøje proteinet med proteinase K og urea, som efterlader et kort polypeptid tilbage på crosslink stedet. Dephosphorylering af RNA-fragmenter af input prøver og ligation af 3 ′ RNA-adapter udføres (trin 8). Udfør RT af RNA og ligation af 3 ′ DNA-adapter (trin 9-10). Udfør PCR-forstærkning af cDNA-bibliotek, gel-ekstraktion og stump-end PCR-kloning til indledende Biblioteks kvalitetskontrol (trin 11). Til sidst skal du udføre sekvensering med høj gennemløb (trin 12). Klik her for at se en større version af dette tal.

Figure 2
Figur 2 : Testis vævs høst og UV crosslinking. A) eksponeringen af musens abdomen. (B) en 0,5 cm indsnit i abdominalvæggen, der udsætter peritoneum. (C) et par testikler er taget ud ved at trække ud fedt puder. (D) testikel vævet fjernes og anbringes i en lille skål, der indeholder ISKOLD PBS. (E) Fjern forsigtigt tunika albugineen. (F) Tryk den løse Pestle for at triturere vævet i en vævs kværn dounce. G) distribuerede seminiferøse tubuser i en 10 cm bred plade. (H) UV tværbinding med 400 MJ/cm2 energi. I) de kryds sammenkædede prøver opsamles i 1,5 ml centrifugeglas. Klik her for at se en større version af dette tal.

Figure 3
Figur 3 : Repræsentative resultater af MOV10 og MOV10L1 eCLIP. (A) Western blot-validering af MOV10 og MOV10L1 immunoprecipitater. (B) qpcr på 1:10 fortyndet eclip-biblioteker af MOV10 og MOV10L1 med replikater for UV-, ikke-UV-og de parrede SMInput-prøver. Klik her for at se en større version af dette tal.

Figure 4
Figur 4 : forberedelse af ECLIP-bibliotek og kvalitetsvurdering. (A) gel-billeder af PCR-amplifikation vises. Asterisk indikerer primer dimer. Rød stiplet linje angiver områder, der er blevet exciteret for PCR-produkt af cDNA, et sted mellem 175 og 350 BP. (B) UCSC-genom-browservisning af to repræsentative subklon-sekvenser31. C) analyse af sekvensering af mindre delklon af MOV10. (D) MOV10L1-bundne Tags udviser særskilte mønstre for længde fordeling, når de behandles af to forskellige RNase-koncentrationer. (E) mindre subklon-sekvensering af MOV10L1. Klik her for at se en større version af dette tal.

Sekvensnavn Sekvens oplysninger Beskrivelse
RNA-adaptere
RNA X1A /5Phos/AUAUAGGNNNNNAGAUCGGAAGAGCGUCGUGUAG/3SpC3/ lagerbeholdning på 200 μM; arbejde ved 20 μM
RNA X1B /5Phos/AAUAGCANNNNNAGAUCGGAAGAGCGUCGUGUAG/3SpC3/ lagerbeholdning på 200 μM; arbejde ved 20 μM
RiL19 /5phos/AGAUCGGAAGAGCGUCGUG/3SpC3/ lagerbeholdning på 200 μM; arbejde ved 40 μM
DNA-adapter
Rand103tr3 /5Phos/NNNNNNNNNNAGATCGGAAGAGCACACGTCTG/3SpC3/ lagerbeholdning på 200 μM; arbejde ved 80 μM
RT-primer
AR17 Af ACACGACGCTCTTCCGA lagerbeholdning på 200 μM; arbejde ved 20 μM
PCR-grundere

PCR-F-D 501
AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATCT lagerbeholdning på 100 μM; arbejde ved 20 μM
PCR-R-D 701 CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC lagerbeholdning på 100 μM; arbejde ved 20 μM
(Se kundeservice skrivelse til Illumina for D502-508, D702-712)

Tabel 1: adapter-og primer-sekvenser. Adapteren indeholder en in-line Random-Mer (enten N5 eller N10) for at afgøre, om to identiske sekvenserede læsninger indikerer to unikke RNA-fragmenter eller PCR-duplikater af det samme RNA-fragment. "5 phos" står for 5 ' phosphorylering, som er nødvendig, hvis et oligo bruges som substrat for DNA/RNA-Ligase. "3SpC3" står for 3 ' C3 spacer, som kan forhindre ligation mellem adaptere.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Med stigende forståelse af den universelle rolle af rbps under både biologiske og patologiske sammenhænge, er klippet metoder blevet bredt udnyttet til at afsløre den molekylære funktion af rbps20,32,33, 34af35. Den protokol, der beskrives her, repræsenterer en tilpasset anvendelse af eCLIP-metoden til muse testikler.

En udfordring i at udføre eclip i testiklerne er at opretholde levedygtigheden og integriteten af friske testikel celler, hvilket også er vigtigt for effektiv Cross Linking. Klipning af testiklerne med mild mekanisk kraft ved hjælp af den løse Pestle kan forhindre celle lysis32,36. Korrekt fordøjelse af RNA er også afgørende for vellykkede eCLIP-assays. RNA-fragmenter kan være mere konvergerende efter fordøjelsen, men længden mindre end 20 BP kan fjernes via forbehandlingen af biblioteket læser. For at vedtage en ideel RNase dosering for en RBP kandidat, foreslår vi en foreløbig test baseret på resultaterne af subklon sekvensering af ECLIP biblioteker, der kan forberedes af RNase behandling med koncentrationer spænder fra 0 dig til 40 U (per milliliter af lysate). Den lille skala subklon sekventering analyse er et anbefalet skridt for en pålidelig undersøgelse af bibliotekets kvalitet i vores eclip-metoden. For det første bør den procentdel af skær, der er kortere end 20 BP, ikke være for høj, eller den efterfølgende forbehandling af eCLIP-biblioteket vil medføre et dyrt tab af læsninger. For det andet skal effektiviteten af korrekt ligation af begge adaptere kontrolleres. Substandard prøver kan elimineres uden dyb sekvensering for at sikre en vellykket dyb sekvensering, hvis resultater generelt tager meget længere tid at analysere.

Selv om gennemførligheden af ECLIP i mus testiklerne er stadig begrænset af specificiteten af antistof for det trin af immunoprecipitation, eclip er fordelagtig i forhold til konventionelle Clip metoder i flere aspekter. For det første er det en ikke-radioaktiv metode. Af eCLIP, RNA mål af RBPs er direkte fanget in vivo uden at skulle ty til arbejdskraft-intensive teknikker ved hjælp af radioaktive materialer. For det andet er metoden mindre tids intensiv. Hele proceduren tager kun 4 dage gennem eCLIP bibliotek forberedelse. For det tredje, sekvens mangfoldighed. Sammenlignet med den konventionelle samlede amplifikationscyklus af 25-35 cyklusser, eclip refererer til CT værdier af qPCR at indstille antallet af PCR cyklusser specifikt. Endelig giver det stærkere signal-støj-forhold. Den størrelses matchede indgang fungerer som en passende baggrund for autentiske mål.

Kort sagt konsoliderer vores eCLIP-resultater konklusionerne om, at MOV10 og MOV10L1 har en bindende præference for henholdsvis mRNA 3 ' UTR-og piRNA-prækursorer. Den protokol, vi beskrev heri, repræsenterer den første ansættelse af eCLIP-metoden i reproduktion, et område, hvor RNA-RBP-interaktions viden er temmelig utilstrækkelig, selv om genetiske undersøgelser har givet rigelig information om de biologiske roller for RBPs. visualisering af denne eCLIP-protokol kan hjælpe med at vejlede dens udbredte anvendelser i bredere områder.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Vi takker Eric L Van Nostrand og gene W Yeo for en god vejledning i den oprindelige protokol. K.Z. blev støttet af National Key R & D program i Kina (2016YFA0500902, 2018YFC1003500), og National Natural Science Foundation i Kina (31771653). L.Y. blev støttet af National Natural Science Foundation i Kina (81471502, 31871503) og innovative og iværksætter program af Jiangsu Province.

Materials

Name Company Catalog Number Comments
Antibodies
Anti-mouse MOV10  antibody Proteintech, China 10370-1-AP
Anti-mouse MOV10L1 antibody Zheng et al.20109 polyclonal antisera UP2175 provided by P. Jeremy Wang lab, University of Pennsylvania
HRP Goat Anti-Rabbit IgG  ABclonal AS014
Rabbit IgG Beyotime, China A7016
Equipment
Centrifuge Eppendorf, Hamburg, Germany 5242R
Digital sonifier BRANSON,USA BBV12081048A 450 Watts; 50/60 Hz
DynaMag-2 Magnet Invitrogen,USA 12321D
Mini Blot Module Invitrogen,USA B1000
Mini Gel Tank Invitrogen,USA A25977
Shaking incubator Eppendorf, Hamburg, Germany Thermomixer comfort 
Tissue Grinder, Dounce PYREX, USA 1234F35 only  the "loose" pestle is used in this protocol
TProfessional standard 96 Gradient Biometra, Germany serial no.: 2604323
Tube Revolver  Crystal, USA serial no.: 3406051
UV-light cross-linker UVP, USA CL-1000
Materials
TC-treated Culture Dish Corning, USA 430167 100 mm 
Tubes Corning, USA 430791 15 mL
Microtubes tubes AXYGEN , USA MCT-150-C 1.5 mL 
Reagents 
Acid phenol/chloroform/isoamyl alcohol  Solarbio, China P1011 25:24:01
AffinityScript Enzyme Agilent, USA 600107
Antioxidant Invitrogen,USA NP0005
DH5α competent bacteria Thermo Scientific, USA 18265017 these economical cells yield >1 x 106 transformants/µg control DNA per 50 µL reaction.
DMSO Sigma-Aldrich, USA D8418
DNA Ladder Invitrogen, USA 10416014
dNTP Sigma-Aldrich, USA DNTP100-1KT
Dynabeads Protein A  Invitrogen, USA 10002D
ECL reagent Vazyme, China E411-04
EDTA Invitrogen, USA AM9260G
EDTA free protease inhibitor cocktail Roche, USA 04693132001 add fresh
Exo-SAP-IT Affymetrix, USA 78201 PCR Product Cleanup Reagent 
FastAP enzyme Thermo Scientific, USA EF0652
LDS Sample Buffer Thermo Scientific, USA NP0007
MetaPhor Agarose  lonza, Switzerland 50180
MgCl2 Invitrogen, USA AM9530G
MiniElute gel Extraction QIAGEN, Germany 28604 column store at 4 ?; buffer QG=gel dissolving buffer; buffer PE= wash buffer(for step 14)
MyONE Silane beads Thermo Scientific, USA 37002D nucleic acids extraction magnetic beads
NaCl Invitrogen,USA AM9759
 
NP-40 Amresco, USA M158-500ML
NuPAGE Bis-Tris Protein Gels Invitrogen, USA NP0336BOX 4%–12%,1.5 mm, 15-well
NuPAGE MOPS SDS Buffer Kit  Invitrogen, USA NP0050
PBS Gibco, USA 10010023
Phase-Locked Gel (PLG) heavy tube   TIANGEN, China WM5-2302831
PowerUp SYBR Green Master Mix Applied Biosystems, USA A25742
Proteinase K NEB, New England  P8107S
Q5 PCR master mix  NEB, New England  M0492L
RLT buffer QIAGEN, Germany 79216 RNA purification lysis buffer 
RNA Clean & Concentrator-5 columns  ZYMO RESEARCH, USA R1016 RNA purification and concentration columns
RNase I  Invitrogen, USA AM2295
RNase Inhibitor Promega, USA N251B
RQ1 DNase Promega,USA M610A
Sample Reducing Agent Invitrogen,USA NP0009
SDS Solution Invitrogen, USA 15553027 10%
Sodium deoxycholate Sigma-Aldrich, USA 30970 protect from light
T4 PNK enzyme NEB, New England  M0201L
T4 RNA ligase 1 high conc NEB, New England  M0437M
TA/Blunt-Zero Cloning Mix Vazyme, China C601-01
TBE Invitrogen,USA AM9863
Tris-HCI Buffer Invitrogen, USA 15567027
Triton X-100 Sangon Biotech, China A600198 
Tween-20 Sangon Biotech, China A600560
Urea Sigma-Aldrich, USA U5378
X-ray Films Caresteam, Canada 6535876

DOWNLOAD MATERIALS LIST

References

  1. Turner, J. M., Mahadevaiah, S. K., Ellis, P. J., Mitchell, M. J., Burgoyne, P. S. Pachytene asynapsis drives meiotic sex chromosome inactivation and leads to substantial postmeiotic repression in spermatids. Developmental Cell. 10, (4), 521-529 (2006).
  2. Turner, J. M. A. Meiotic sex chromosome inactivation. Development. 134, (10), 1823-1831 (2007).
  3. Kimmins, S., Sassone-Corsi, P. Chromatin remodelling and epigenetic features of germ cells. Nature. 434, (7033), 583-589 (2005).
  4. Ule, J., et al. CLIP identifies Nova-regulated RNA networks in the brain. Science. 302, (5648), 1212-1215 (2003).
  5. Ule, J., Jensen, K., Mele, A., Darnell, R. B. CLIP: a method for identifying protein-RNA interaction sites in living cells. Methods. 37, (4), 376-386 (2005).
  6. Trifillis, P., Day, N., Kiledjian, M. Finding the right RNA: identification of cellular mRNA substrates for RNA-binding proteins. RNA. 5, (8), 1071-1082 (1999).
  7. Tenenbaum, S. A., Carson, C. C., Lager, P. J., Keene, J. D. Identifying mRNA subsets in messenger ribonucleoprotein complexes by using cDNA arrays. Proceedings of National Acadamy of Sciences U S A. 97, (26), 14085-14090 (2000).
  8. Chi, S. W., Zang, J. B., Mele, A., Darnell, R. B. Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 460, (7254), 479-486 (2009).
  9. Zheng, K., et al. Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. Proceedings of National Acadamy of Sciences U S A. 107, (26), 11841-11846 (2010).
  10. Gregersen, L. H., et al. MOV10 Is a 5' to 3' RNA helicase contributing to UPF1 mRNA target degradation by translocation along 3' UTRs. Molecular Cell. 54, (4), 573-585 (2014).
  11. Banerjee, S., Neveu, P., Kosik, K. S. A coordinated local translational control point at the synapse involving relief from silencing and MOV10 degradation. Neuron. 64, (6), 871-884 (2009).
  12. Choi, J., Hwang, S. Y., Ahn, K. Interplay between RNASEH2 and MOV10 controls LINE-1 retrotransposition. Nucleic Acids Research. 46, (4), 1912-1926 (2018).
  13. Goodier, J. L., Cheung, L. E., Kazazian, H. H. Jr MOV10 RNA helicase is a potent inhibitor of retrotransposition in cells. PLoS Genetics. 8, (10), e1002941 (2012).
  14. Haussecker, D., et al. Capped small RNAs and MOV10 in human hepatitis delta virus replication. Nature Structural & Molecular Biology. 15, (7), 714-721 (2008).
  15. Kenny, P. J., et al. MOV10 and FMRP regulate AGO2 association with microRNA recognition elements. Cell Reports. 9, (5), 1729-1741 (2014).
  16. Messaoudi-Aubert, S. E., et al. Role for the MOV10 RNA helicase in Polycomb-mediated repression of the INK4a tumor suppressor. Nature Structural & Molecular Biology. 17, (7), 862-868 (2010).
  17. Sievers, C., Schlumpf, T., Sawarkar, R., Comoglio, F., Paro, R. Mixture models and wavelet transforms reveal high confidence RNA-protein interaction sites in MOV10 PAR-CLIP data. Nucleic Acids Research. 40, (20), e160 (2012).
  18. Skariah, G., et al. Mov10 suppresses retroelements and regulates neuronal development and function in the developing brain. BMC Biology. 15, (1), 54 (2017).
  19. Zheng, K., Wang, P. J. Blockade of pachytene piRNA biogenesis reveals a novel requirement for maintaining post-meiotic germline genome integrity. PLoS Genetics. 8, (11), e1003038 (2012).
  20. Vourekas, A., et al. The RNA helicase MOV10L1 binds piRNA precursors to initiate piRNA processing. Genes & Development. 29, (6), 617-629 (2015).
  21. Hocq, R., Paternina, J., Alasseur, Q., Genovesio, A., Le Hir, H. Monitored eCLIP: high accuracy mapping of RNA-protein interactions. Nucleic Acids Research. 46, (21), 11553-11565 (2018).
  22. Huppertz, I., et al. iCLIP: protein-RNA interactions at nucleotide resolution. Methods. 65, (3), 274-287 (2014).
  23. Hafner, M., et al. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 141, (1), 129-141 (2010).
  24. Hafner, M., et al. PAR-CliP--a method to identify transcriptome-wide the binding sites of RNA binding proteins. Journal of Visualized Experiments. (41), (2010).
  25. Konig, J., et al. iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nature Structural & Molecular Biology. 17, (7), 909-915 (2010).
  26. Konig, J., et al. iCLIP--transcriptome-wide mapping of protein-RNA interactions with individual nucleotide resolution. Journal of Visualized Experiments. (50), (2011).
  27. Maticzka, D., Ilik, I. A., Aktas, T., Backofen, R., Akhtar, A. uvCLAP is a fast and non-radioactive method to identify in vivo targets of RNA-binding proteins. Nature Communications. 9, (1), 1142 (2018).
  28. Van Nostrand, E. L., et al. Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP). Nature Methods. 13, (6), 508-514 (2016).
  29. Radulovich, N., Leung, L., Tsao, M. S. Modified gateway system for double shRNA expression and Cre/lox based gene expression. BMC Biotechnology. 11, 24 (2011).
  30. Breunig, C. T., et al. A Customizable Protocol for String Assembly gRNA Cloning (STAgR). Journal of Visualized Experiments. (142), (2018).
  31. Kuhn, R. M., Haussler, D., Kent, W. J. The UCSC genome browser and associated tools. Briefings in Bioinformatics. 14, (2), 144-161 (2013).
  32. Vourekas, A., et al. Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. Nature Structural & Molecular Biology. 19, (8), 773-781 (2012).
  33. Preitner, N., et al. APC is an RNA-binding protein, and its interactome provides a link to neural development and microtubule assembly. Cell. 158, (2), 368-382 (2014).
  34. Meyer, C., et al. The TIA1 RNA-Binding Protein Family Regulates EIF2AK2-Mediated Stress Response and Cell Cycle Progression. Molecular Cell. 69, (4), 622-635 (2018).
  35. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nature Reviews Genetics. 15, (12), 829-845 (2014).
  36. Vourekas, A., Mourelatos, Z. HITS-CLIP (CLIP-Seq) for mouse Piwi proteins. Methods in Molecular Biology. 1093, 73-95 (2014).
Forbedret Cross Linking Immunoprecipitation (eCLIP) metode til effektiv identifikation af protein-bundet RNA i Mouse testis
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).More

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter