Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Bioengineering

الأعضاء العصبية البشرية لدراسة سرطان الدماغ والأمراض العصبية

doi: 10.3791/59682 Published: June 28, 2019
* These authors contributed equally

Summary

تقدم هذه الدراسة وتصف بروتوكولات لاشتقاق عضوين عصبيين بشريين محددين كنموذج ذي صلة ودقيق لدراسة 1) تطور الورم الأرومي الدبقي البشري داخل الأعضاء العصبية البشرية حصرافي البشر و 2) الدوبامين العصبية التمايز توليد العضوية ثلاثية الأبعاد.

Abstract

عدم وجود نماذج عصبية ذات صلة في المختبر هو عقبة هامة على التقدم الطبي لاعتلال الأعصاب. إنشاء النماذج الخلوية ذات الصلة أمر بالغ الأهمية على حد سواء لفهم أفضل للآليات المرضية لهذه الأمراض وتحديد الأهداف والاستراتيجيات العلاجية الجديدة. لتكون ذات صلة ، يجب أن النموذج في المختبر إعادة إنتاج السمات المرضية لمرض بشري. ومع ذلك، في سياق الأمراض العصبية، ينبغي أن يوفر نموذج ذي صلة في المختبر استبدال الخلايا العصبية كفرصة علاجية قيمة.

مثل هذا النموذج لن يسمح فقط بفحص الجزيئات العلاجية ولكن أيضا يمكن استخدامها لتحسين التمايز البروتوكول العصبي [على سبيل المثال، في سياق زرع في مرض باركنسون (PD)]. تصف هذه الدراسة اثنين من البروتوكولات في المختبر من 1) تطور الورم الأرومي الدبقي البشري داخل الأعضاء العصبية البشرية (NO) و 2) التوالد الدوبامين العصبية (DA) التمايز توليد ثلاثي الأبعاد (3D) الجهازية. ولهذا الغرض، أُنشئ بروتوكول موحد يسمح بإنتاج المجالات العصبية المعايرة بالحجم المستمدة من تمايز الخلايا الجذعية الجنينية البشرية. يمكن استخدام النموذج الأول للكشف عن الأحداث الجزيئية والخلوية التي تحدث خلال تطور الورم الأرومي الدبقي داخل الجهاز العصبي، في حين أن الجهاز العضوي DA لا يمثل فقط مصدرا مناسبا للخلايا العصبية DA للعلاج الخلوي في مرض باركنسون ولكن أيضا يمكن أن تستخدم لاختبار المخدرات.

Introduction

وتصنف منظمة الصحة العالمية الأورام النجمية على أنها درجة منخفضة (من الدرجة الأولى إلى الثانية) أو درجة عالية (الصفان الثالث والرابع). الورم الأرومي الدبقي المتعدد (GBM) هو ورم أستروسيتوما الصف الرابع، الأكثر فتكا من أورام الدماغ الأولية، التي هي مقاومة لجميع الأشكال الحالية من العلاجات1. على الرغم من معيار الرعاية العلاج بما في ذلك جراحة الأعصاب، والعلاج الكيميائي، والعلاج الإشعاعي، GBM لا يزال قاتلا ومعدل البقاء على قيد الحياة عموما لمدة 15 شهرا لم يتغير بشكل كبير على مدى السنوات ال 15 الماضية2. ولتحقيق تقدم كبير في فهم مسببات الأمراض في الـ GBM، فإن استخدام النماذج ذات الصلة أمر أساسي. حتى الآن، اعتمدت دراسة GBM على خطوط الخلايا، وشرائح القوارض organotypic، وزرع xenotransplant من الخلايا المشتقة من المريض في الفئران أو الفئران المعدلة وراثيا تطوير الأورام العفوية3،4. على الرغم من أن هذه النماذج كانت مفيدة لدراسة ورم الدماغ والعدوانية الورم، فهي مقيدة بالاختلافات بين الأنواع، والاستنتاجات الناتجة قد تترجم بشكل غير صحيح إلى الأنسجة البشرية. وعلاوة على ذلك، فإن النماذج القائمة مع الخلايا البشرية محدودة أيضا بسبب عدم وجود الأنسجة المضيفة / التفاعلات الورم3،4. النماذج التجريبية حاسمة للترجمة من العلوم الأساسية إلى الأهداف العلاجية. ولذلك، فإن وصف بروتوكول لإنتاج الأعضاء العصبية البشرية في المختبر التي تشترك في استزراعها مع الخلايا التي تبدأ GBM (GICs) يمكن أن توفر نظام ًا ذي صلة يحاكي السمات المورفولوجية والوظيفية لتطوير GBM. هذا النظام يستنسخ بعض في ملامح الجسم الحي من تطوير GBMمثل الهجرة المنتشرة من الخلايا الغازية ومناطق نخر، ويسلط الضوء على التعبير الجيني ذات الصلة بيولوجيا الورم. كما تم الكشف سابقا، يتم حث بعض microRNAs الحرجة خلال تطوير مؤسسة الخليج للاستثمار داخل الأنسجة العصبية 3D6.

PD هو اضطراب عصبي كبير ويرتبط مع انحطاط الأنواع الفرعية العصبية المتعددة7. حتى لو كان ظهور التدريجي للأعراض (على سبيل المثال، براديكينيسيا، الهزة الراحة غير المتماثلة، وصلابة وعدم استقرار الموقف) يميز المرض، لم يتم تحديد مسبباته بالضبط بوضوح. وفي الواقع، أبرزت العديد من الدراسات أدلة على أن عوامل الخطر الرئيسية يمكن أن تنجم عن مجموعة من العوامل الوراثية والبيئية. ترتبط أعراض باركنسون مع الانحطاط الثنائي للخلايا العصبية الدوبامين في نيغرا substancia (SN)، مما يؤدي إلى اختفاء الدوبامين (DA) محاور إسقاط إلى striatum8،9. ولذلك, ويرتبط الحد من مستويات الدوبامين striatal مع تطور الخلل الحركي في مرضى PD. الخلايا العصبية الدوبامين تحتوي على هيدروكسيلاز التيروزين (TH), إنزيم رئيسي في تركيب الناقلات العصبية الكاتيكولامين التحسسية التي تحول الأحماض الأمينية L-التيروزين إلى L-3,4-dihydroxyphenylalanine (L-DOPA, الدوبامين السلائف) إلى الدوبامين10. فقدان مبكر من النشاط TH تليها انخفاض في التعبير البروتين TH هو السمة المميزة للPD.

تصف هذه الدراسة بروتوكولين باستخدام الأعضاء العصبية البشرية، مع واحد موجهة على وجه التحديد نحو النمط الظاهري مثل الدماغ المتوسط المخصب مع الخلايا الإيجابية TH.

Protocol

ويتبع هذا البروتوكول المبادئ التوجيهية للجنة أخلاقيات البحوث البشرية التابعة لجامعة جنيف.

1- صيانة وثقافة الخلايا الجذعية الجنينية البشرية غير المتمايزة

  1. قم بصيانة وتوسيع hSECs في ظروف خالية من التغذية من خلال أطباق ما قبل الطلاء مع مصفوفة محددة خارج الخلية.
    1. إذابة 300 ميكرولتر من المصفوفة خارج الخلية عند 4 درجة مئوية (تركيز النطاق النموذجي 18-22 ملغ/مل، والحفاظ على الجليد) وخلط بلطف مع 15 مل من DMEM المتوسطة الباردة لتجنب الجلج المبكر للمصفوفة خارج الخلية. إضافة 7.5 مل من المصفوفة خارج الخلية إلى كل من قوارير T150.
    2. احتضان الأطباق المغلفة مع مصفوفة خارج الخلية في 37 درجة مئوية لمدة ساعة واحدة على الأقل (الحد الأقصى بين عشية وضحاها).
    3. إزالة hESCs المتوسطة والبذور إلى كثافة 6.5 × 104 خلية / سم2.
  2. الحفاظ على H1 (خط الخلية hESC) في hESC المتوسطة و 1٪ البنسلين / العقديات.
  3. تمرير الخلايا مع الإجراء الأنزيمي: إضافة 7.5 مل من الحل الأنزيمي إلى قارورة T75 سم2 على مدى فترة 1-2 دقيقة في 37 درجة مئوية. بمجرد فصل الخلايا بالكامل، أضف 7.5 مل من DMEM-F12 ثم الطرد المركزي لمدة 5 دقائق في 300 × ز. للسماح بالبقاء على قيد الحياة بشكل أفضل، إعادة طلاء الخلايا في الكثافة المطلوبة على الأطباق المغلفة بالمصفوفة خارج الخلية، في نفس الوسط الذي يحتوي على مثبط اتّصال البروتين المرتبط بـ Rho (ROCK) (10 ميكرومتر) لمدة 24 ساعة.

2. الأعضاء العصبية المستمدة من hESC لدراسات GBM

  1. 24 ساعة قبل بدء الثقافة ثلاثية المدة، استبدل وسط hESC بوسيلة خالية من المصل مكمّلة بمثبط اتّصال الصخور 10 ميكروم (كلا المكونين ضروريان لدعم بقاء الخلية وتشكيل محيط عصبي عفوي خلال مرحلة التجميع في بئر مجهرية لوحة). يجب أن تكون الخلايا في 60٪ من الملاءمة. في اليوم التالي (اليوم 0)، فصل مستعمرات hESC كخلايا واحدة: إزالة المتوسطة، ثم شطف مع PBS دون Ca2 +/ Mg2+، إضافة 5 مل من حل الانزيمية، وحضانة في 37 درجة مئوية لمدة 1-2 دقيقة.
  2. جمع الخلايا في وسط خالية من المصل مع 10 ميكرومتر من مثبطات ROCK والطرد المركزي الخلايا في 300 × ز لمدة 5 دقائق.
  3. في موازاة ذلك، شطف لوحة ميكروويل مع 2 مل من المصل خالية من المتوسطة لكل بئر والطرد المركزي لوحة في 1200 × ز لمدة 5 دقائق لإزالة جميع الفقاعات، والتي يمكن أن تمنع تشكيل neurosphere.
  4. إعداد 28.2 × 106 من الخلايا في 12.5 مل من المصل خالية من المتوسطة تستكمل مع 10 *م مثبطات ROCK. الاستغناء عن 1000 خلية / ميكروويل. طرد مركزي الخلايا في 300 × ز لمدة 5 دقائق ووضع لوحة في الحاضنة في 37 درجة مئوية بين عشية وضحاها (الحد الأقصى 36 ساعة). على سبيل المثال: للحصول على 30 الأعضاء العصبية البشرية، استخدم قارورة T150 واحدة في 70٪ -80٪ من التقاء (حوالي 30 مليون خلية).
  5. في اليوم التالي (اليوم 1)، وجمع المجالات (مع P1000) ووضعها في لوحة الآبار 6. في كل بئر, إضافة 2 مل من B27 المتوسطة وDMEM-F12 غلوماماكس والمتوسط Neurobasal (مزيج في 1:1), تستكمل مع 1% B27 ملاحق و 1% الأحماض الأمينية غير الأساسية (NEAA). لتعزيز الحث العصبي السريع، تكملة المتوسطة مع كوكتيل تثبيط المزدوج SMAD، وتتألف من 10 μM TGFβ / أكتيفين / مثبطات العقدية و 0.5 ميكرومتر مثبط بروتين مورفجينيك العظام (BMP). من هذه الخطوة إلى الأمام، يتم زراعة المجالات في التناوب (60 دورة في الدقيقة، شاكر المدارية). التناوب أمر بالغ الأهمية لمنع المجالات من التمسك معا أو إلى لوحة.
  6. تغيير المتوسط كل 2-3 أيام: ثني لوحة والسماح للمجالات تسقط لمدة 5 دقائق، وإزالة نصف المتوسطة (2 مل)، وإضافة 2 مل من B27 المتوسطة الطازجة تستكمل مع عوامل النمو ومثبطات. لا تطرد المجالات بالطرد المركزي.
  7. إجراء الحث العصبي وفقا للدورة الزمنية التالية:
    1. من أيام 1-4، ثقافة المجالات في B27 المتوسطة تستكمل مع SMAD المزدوج. الكوكتيل تثبيط المزدوج SMAD (10 μM TGFβ / Activin / مثبطات العقدية و مثبطات BMP 0.5 درجة مئوية) تعزيز الحث العصبي.
    2. من الأيام 4-11، وتعزيز انتشار الورود العصبية المستمدة من hESC (في المجالات)، عن طريق إضافة 10 نانوغرام / مل عامل نمو البشرة (EGF) و 10 نانوغرام / مل عامل الليفي الأساسي (bFGF) إلى المتوسط B27 تستكمل مع كوكتيل SMAD المزدوج.
      ملاحظة: في اليوم 11 يجب أن تكون معظم الخلايا إيجابية Nestin.
    3. من أيام 11-13، ثقافة المجالات في B27 المتوسطة تستكمل مع 0.5 ميكرومتر مثبطات BMP.
    4. من أيام 13-21, ثقافة المجالات في B27 المتوسطة تستكمل مع 10 نانوغرام / مل عامل التغذية العصبية المستمدة (GDNF), 10 نانوغرام / مل الدماغ المستمدة عامل التغذية العصبية (BDNF) و 1 μM من مثبطات γ-secretase. GDNF وBDNF تعزيز التمايز العصبي وglial. يسمح مثبط γ-secretase بنضج عصبي أكبر.
    5. في اليوم 21، لوحة المجالات (حوالي 1000 المجالات) على غشاء بولي تترافلوروإيثيلين المائية (PTFE) (6 مم قطرها، 0.4 م) المودعة على إدراج لوحة الثقافة المصممة ل6 لوحة جيدا. إيقاف أي تناوب من هذه الخطوة. وجود الورود، لوحظ مع المجهر مشرق الميدان، تشير إلى بدء التمايز العصبي. يمكن ملاحظة الورود العصبية 2-3 أيام بعد كرات الطلاء على غشاء PTFE.
    6. إضافة 1 مل من B27 المتوسطة تستكمل مع عوامل النمو ومثبطات (كما يلي) إلى كل جيدا تحت إدراج الغشاء، كل 2-3 أيام (عادة في أيام الاثنين والأربعاء والجمعة)، لمدة 3 أسابيع التالية من التمايز.
    7. من أيام 21-25، زراعة الأعضاء العصبية البشرية في نفس النضج العصبي المتوسطة (راجع الخطوة 2.7.4).
    8. من أيام 25-28، تكمل فقط B27 المتوسطة مع 1 μM γ-secretase المانع.
    9. من أيام 28-39، والتوقف عن إضافة مثبط اتسال γ ومواصلة ثقافة الأعضاء العصبية البشرية في B27 المتوسطة فقط.
      ملاحظة: بعد 3 أسابيع، تكون الأعضاء العصبية جاهزة للاستخدام لزرع مؤسسة الخليج للاستثمار. على طول النضج العصبي، لوحظ انخفاض في علامة العصبية غير ناضجة نيستين وزيادة علامات العصبية الناضجة β3-tubulin وGFAP.

3- عزل وزراعة الخلايا التي تبدأ الورم الأرومي الدبقي

  1. عزل GICs عن طريق تجزئة خزعة GBM الإنسان عالية الجودة. نقل قطعة الورم في كوب يحتوي على 0.25٪ تريبسين في 0.1 mEDTA (4:1) ويحرك ببطء في 37 درجة مئوية لمدة 30-60 دقيقة (اعتمادا على حجم الورم).
  2. لوحة الخلايا المفككة في 75 سم2 قوارير زراعة الأنسجة مطلية في 2,500-5,000 خلية لكل سم2 في مركز الخليج الدولي المتوسطة: DMEM/F-12 المتوسطة (1:1) تحتوي على 1٪ N2, 1% B27, و 1% G5 ملاحق (لصالح البقاء على قيد الحياة مؤسسة الخليج للاستثمار), تستكمل مع bFGF وEGF (كلاهما في 10 ng/Ml، لتعزيز الجذعية) و 1٪ من البنسلين / العقديات.
  3. وبمجرد أن تكون مؤسسة الخليج للاستثمار راسخة ومتنامية، قم بإزالة المكملات N2 وG5 من وسط مؤسسة الخليج للاستثمار.
  4. قبل يوم واحد من إضافة الخلايا إلى الجهاز، وفصل GICs وحساب لهم.
  5. شطف لوحة ميكروويل مع 2 مل من مؤسسة الخليج للاستثمار المتوسطة والطرد المركزي لوحة في السرعة القصوى لإزالة فقاعات (1000 × ز). ضع الـ GICs في 1000 خلية للحصول على غلاف دبقية واحد لكل ميكروويل. حضانة بين عشية وضحاها في 37 درجة مئوية (الشكل1C). هذه الخطوة هي المفتاح وتسمح GICs معايرة جيدا (مثال على GICs نخرية وكبيرةالحجم هو مبين في الشكل 2A،C).
  6. لبدء غزو GBM، إضافة واحد gliomasphere على رأس الأنسجة العصبية مع طرف كبير تتحمل pipet (الشكل1F). وضع بعناية لوحة جيدا 6 مرة أخرى في الحاضنة.

4. hESC المستمدة من الدوبامين العضوية لدراسات PD

  1. اليوم 0: تضخيم hESCs في ثقافة 2D تصل إلى 60٪ الملاءمة (اليوم 0)، ثم استبدال وسائل الإعلام الخلايا الجذعية المستخدمة للحفاظ على ميزات تعدد القوى من hESCs مع وسيلة خالية من المصل. بدء الحث العصبي عن طريق تكملة وسط الثقافة مع 0.5 ميكرومتر مثبطات BMP و 10 μM TGFβ/Activin/Nodal المانع (المزدوج SMAD تثبيط كوكتيل)، ثم إضافة 10 م مثبطات روك لمدة 24 ساعة لزيادة معدل البقاء على قيد الحياة من الخلايا أثناء المرور.
  2. اليوم 1: إعداد لوحة ميكروويل مع 2.5 مل لكل بئر من المصل خالية من المتوسطة تستكمل مع 0.5 ميكرومتر مثبطات BMP، 10 ميكرومتر TGFβ / أكتيفين / مثبطات العقدية، و 10 م مثبطات روك. لتحديد الخلايا نحو النمط البطني للأنبوب العصبي، إضافة 100 نانوغرام / مل القنفذ سونيك (SHH)، 100 نانوغرام / مل عامل نمو الخلايا الليفية 8 (FGF8)، و 2 ميكروم مؤثر ملطف. طرد مركزي لوحة (فقط مع المتوسطة وبدون خلايا) في 1200 × ز لمدة 5 دقائق لإزالة فقاعات الهواء من microwells.
    1. بعد يوم واحد من الحث العصبي في 2D، وإزالة المتوسطة وغسل بسرعة مع PBS دون كاليفورنيا2 +/ MgCl2 +. فصل المستعمرات في تعليق خلايا واحدة عن طريق إضافة 7.5 مل من محلول الأنزيمية المؤتلف في قارورة T75 cm2. حضانة لمدة 2 دقيقة في 37 درجة مئوية ثم كاملة مع 7.5 مل من DMEM-F12.
    2. جمع تعليق الخلية والطرد المركزي في 300 × ز لمدة 5 دقائق.
    3. ضبط حجم متوسط للحصول على تعليق الخلية مما يسمح لتشكيل المجالات العصبية التي تحتوي على 1000 خلية لكل ميكروويل (على سبيل المثال، لوحة ميكروويل المستخدمة هنا يحتوي على 4700 ميكروويل لكل بئر). لذلك، إعداد 4.7 مليون خلية في 2.5 مل من المتوسطة وإضافته إلى السابق 2.5 مل من المتوسطة وضعت بالفعل في لوحة.
    4. من أجل توزيع الخلايا بشكل صحيح في كل ميكروويل، يهز بلطف لوحة، والطرد المركزي لوحة ميكروويل 300 × ز لمدة 5 دقائق.
  3. اليوم 2: بلطف دافق microwells مع المتوسطة وجمع ثم نقل المجالات في الأنسجة المعالجة لوحة ستة جيدا. استبدال المتوسطة مع المتوسطة Neurobasal تستكمل مع 1٪ B27، 1X NEAA، 2 مل L-الجلوتامين، و 1٪ من البنسلين / العقديات. بالإضافة إلى ذلك، إضافة عوامل الهيكلة الإقليمية SHH، FGF8، مؤثر ممهدة، وجزيئات صغيرة تثبيط المزدوج SMAD.
    1. ضع المجالات في دوران عند 37 درجة مئوية (60 دورة في الدقيقة، شاكر المداري) وتغيير نصف المتوسطة تستكمل حديثا كل 2-3 أيام.
  4. اليوم 3: لتعزيز الحث العصبي والتحول إلى الذرية العصبية مع هوية منتصف الدماغ، تكملة المتوسطة مع 3 م GSK-3β المانع، الذي ينشط مسار Wnt / β-catenin. الحفاظ على مثبطات GSK-3β في المتوسط حتى اليوم 13. تقسيم إلى اثنين من الأنسجة الجديدة المعالجة 6 لوحات جيدا للحد من كل من كثافة المجال لكل بئر وتجنب تجميع المجال.
    ملاحظة: في اليوم 8، يجب أن تكون معظم الخلايا إيجابية Nestin.
  5. اليوم 8: بدء النضج العصبي: استبدال عوامل الهيكلة الإقليمية SHH، FGF8، مؤثر ممهدة، وكوكتيل تثبيط ثنائي SMAD مع 0.5 mM dibutyryl cAMP (لصالح النضج)، 20 مثبط اتلاس من deacetylase الهيستون (للخروج من دورة الخلية)، 1 μM γ-secretase عوامل المثبطات والنمو، 10 نانوغرام/مل GDNF، 10 نانوغرام/مل BDNF، 1 نانوغرام/مل تحويل عامل النمو β3 (TGFβ3)، و 5 نانوغرام/مل FGF20 (كلاهما لصالح بقاء ذرية DA). تغيير المتوسط كل 2-3 أيام.
  6. اليوم 21: توليد الجهاز العصبي: البذور حوالي 100 المجالات العصبية تحت ظروف واجهة الهواء السائل على غشاء PTFE (6 مم قطر). نقل الغشاء إلى إدراج لوحة الثقافة (0.4 ملم) وإضافة 1.2 مل من النضج العصبي المتوسطة المستخدمة لتمايز الغلاف العصبي كما سبق وصفه.
    1. إيقاف أي تناوب من هذه الخطوة. تغيير المتوسط كل 2-3 أيام حتى يتم تحقيق نقطة الوقت التمايز المطلوبة.
      ملاحظة: فيما يتعلق بالنضج العصبي، لوحظ انخفاض في علامة العصبية غير ناضجة نيستين وزيادة علامات العصبية الناضجة β3-tubulin وGFAP. وقد لوحظت تعبيرات عالية TH وNURR1 (الشكل3C)وتأكيد النضج العضوي العصبي11.

5. القياس الكمي للتعبير الجيني TH وNurr1 للتحقق من التمايز الدوبامين

  1. استخراج الحمض النووي الريبي: في اليوم المشار إليه من التمايز، lyse 40 المجالات العصبية مع 350 ميكرولتر من المخزن المؤقت RLT (المقدمة في مجموعة استخراج الحمض النووي الريبي) تستكمل مع 3.5 ميكرولتر من 2-mercaptoethanol. استخراج الحمض النووي الريبي من المجالات العصبية lysed باستخدام مجموعة استخراج الحمض النووي الريبي بعد تعليمات الشركة المصنعة.
  2. قياس تركيزات الحمض النووي الريبي الكلي.
  3. إجراء النسخ العكسي من 300 نانوغرام من إجمالي استخراج الحمض النووي الريبي باستخدام مجموعة النسخ العكسي لتفاعل البوليميراز المتسلسل الكمي في الوقت الحقيقي (qPCR) واتبع تعليمات الشركة المصنعة .
  4. إجراء تحليل qPCR على أنظمة الكشف عن PCR في الوقت الحقيقي، استناداً إلى الكشف عن صبغالسيان غير متناظرة. تطبيع البيانات مع الجينات التدبير المنزلي: غليسيرالديهايد-3-الفوسفات dehydrogenase (GAPDH) وعامل استطالة 1-ألفا (EF1). ويرد وصف لتسلسلات المواد التمهيدية في الجدول1.

6. ارتفاع ضغط السائل الكروماتوغرافيا (HPLC) الكشف

  1. استخدام الكروماتوغرافيا السائلة عالية الضغط (HPLC) مع الكشف الكهروكيميائية للكشف عن وجود الدوبامين. تم استخراج الدوبامين عن طريق اللِشِل ة الأعضاء العصبية في 100 مل من 0.1 N حمض البيركلويك (HClO4) لمدة 15 دقيقة عند 4 درجة مئوية مع دوامة قوية كل 5 دقائق. بعد الطرد المركزي, جمع وتخزين supernatant في -20 درجة مئوية لجرعة الدوبامين.
  2. استخدم عمود C-18 (5 ميكرومتر، 4.6 مم × 150 مم) لفصل الأناليات عن طريق HPLC عكس المرحلة في وضع isocratic بمعدل تدفق 1 مل/ دقيقة. وينبغي إجراء الكشف عن الدوبامين باستخدام كاشف كولومتري مع خلية تكييف تعيين في احتمال +200 ملفي.

7. تسجيل البيانات الخام مع مجموعة microelectode (الشرق الأوسط والأوسط وذلك) منصة

  1. استخدام مجهر تشريح لنقل المجالات العصبية إلى مركز جهاز الشرق الأوسط والشرق الأوسط وكرة الذي يسهل اختراقه.
  2. استخدام مكبر للصوت ونظام الحصول على البيانات للتسجيلات الفسيولوجية الكهربائية. قياس نسبة الإشارة إلى الضوضاء (SNR) كالانحراف المعياري للجهد أثناء تسجيل 5 دقائق، وذلك باستخدام الإشارة كمتوسط الجهد من الذروة إلى الذروة من المسامير المسجلة في نفس فترات 5 دقائق.

Representative Results

ويجب تحديد الخطوات الحاسمة لهذا البروتوكول ومعالجتها على نحو سليم. ولذلك، فإن الرسم البياني لظروف الثقافة الذي يشير إلى الفاصل الزمني لكل خطوة وكذلك المركبات المستخدمة في بروتوكول التمايز موضح في الشكل 1ألف والشكل 3ألف للرقم NO بالإضافة إلى GBM وDA الأعضاء العصبية، على التوالي. الشكل 1B،C، D، E، F يوضح الخلايا، والمجالات، وNO وتظهر مورفولوجيا نموذجية لكل خطوة. الشكل 1G،H، أنا يوضح تلطيخ المناعية مع بعض العلامات العصبية.

Figure 1
الشكل 1 الجهاز العصبي البشري (NO): بروتوكول التمايز. (أ) بروتوكول موحد لتوليد NO مشتقة من الخلايا الجذعية الجنينية البشرية (hESC). (B) يتم الاحتفاظ hESCs على مصفوفة خارج الخلية في hESC المتوسطة. (C) تم استخدام لوحات Microwell لتوليد المجالات العصبية معايرة. في 2 أسابيع، تم طلاء المجالات العصبية على إدراج يحتوي على غشاء PTFE (شريط مقياس = 50 ميكرومتر). (D) عرض ماكروسكوبي من NO في إدراج في بئر واحد من لوحة بئر 6. خلال الأيام الأولى ، لوحظت الورود (السهم الأسود) (E). (F) عرض عيان يُعنى بالمجال NO بالإضافة إلى مؤسسة الخليج للاستثمار في الأعلى.-أولا) تحليل الفلورة المناعية من NO بالإضافة إلى مجال مؤسسة الخليج للاستثمار(EGFR إيجابية؛ شريط مقياس = 50 درجة مئوية) (G) و NO وحدها، والتي أظهرت تفاعل المناعة للعلامات العصبية βIII-tubulin وإيجابية قليلا للعش. ومع ذلك، أظهر المشبك 1 إشارة ضعيفة(H,I)(قضبان مقياس = 100 ميكرومتر و 50 ميكرومتر، على التوالي). الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم. 

Figure 2
الشكل 2 رسم توضيحي للمجالات النخرية وNO غير ناضجة. يمكن أن تخضع المجالات العصبية (A) وNO (B) للنخر عندما تكون كثيرة جداً في البئر أو المتضخم (C) (شريط مقياس = 10 ميكرومتر). (د) واحد مؤسسة الخليج للاستثمار المصابة مراسل الطماطم تساعد على تتبع غزو الخلايا السرطانية في NO، شريط مقياس، 10 م. مثال على NO غير ناضجة مع الأنابيب العصبية (E) وليس أنابيب العصبية (F)(شريط مقياس = 50 ميكرومتر). الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 3
الشكل 3 بروتوكول موحد لتوليد الأعضاء العصبية DA: والتحليل الكهرولوجيولوجي والمورفولوجي. (أ) بروتوكول موحد لتوليد الأعضاء العصبية DA. (ب) تحليل الفلورة المناعية للعضو العصبي DA؛ الخلايا المناعية المناعية المشاركة في التعبير Nurr1، علامة محددة في منتصف الدماغ (شريط مقياس = 50 ميكرومتر). يتم تمثيل البيانات على أنها متوسط ± SEM (n = 3). (C) الرسوم البيانية تمثل حركية TH وNurr1 التعبير الجيني التي تم تقييمها من قبل qRT-PCR. (د) ممثل HPLC: تم الكشف عن ذروة الدوبامين (السهم) من قبل HPLC من DA اللمعة العضوية العصبية. (E) مثال على البيانات الخام المسجلة مع منصة الشرق الأوسط والأوسط والأوسط والأوسط وذلك. يتم عرض كل ارتفاع بواسطة خط عمودي (الطوابع الزمنية)، في حين أن التتبع المتبقي هو الضوضاء. (F) صورة تمثل كرة عصبية مودعة على الشرق الأوسط والأوسط ومنطقة الشرق الأوسط والمتوسط. (G) تراكب المسامير النموذجية (المنحنيات الزرقاء والحمراء) التي تم الكشف عنها من البيانات الخام. يشير المنحنى الأسود الغامق إلى متوسط المنحنيات الحمراء المقابلة. (H) مؤامرة النقطية التي تبين الطوابع الزمنية المرتبطة بكل ارتفاع الكشف عنها. الألوان المختلفة تسليط الضوء على الأقطاب الكهربائية المختلفة. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم. 

الجينات فوارد عكس
محمد الدوسري جي جي تي جي أوسيات GCCTTGT GTGAGGTCCATGCTAACTTGACA
ال GCACCTTCGCGCAGTTCT في هذا الـ401
EEF1 اجَعَاَاتَكَكَكَاتج دول مجلس التعاون الخليجي
في هذا الـ41 GCACAAGAGGAAAGAGAGAGAACC أغاجاتكاGT جي جي جي تي

الجدول 1: المواد التمهيدية المستخدمة في هذا البروتوكول.

Discussion

ومن أهم جوانب هذا البروتوكول الحفاظ على تعدد القوى في مجال hESC أثناء زراعة الخلايا والرصد الدقيق للمجالات ومورفولوجيا الأعضاء العصبية. hESCs حساسة جدا، وكل تلاعب يمكن أن يؤدي إلى التمايز في وقت مبكر غير المنضبط، فضلا عن موت الخلايا. من أجل زيادة التكرار التجريبي وتجنب حدوث أحداث النمط الكاريوتايب غير الطبيعي، ينصح بالاحتفاظ بالتبريد عدة دفعات من hESCs في الممر الأدنى بعد التحقق من استقرار كروموسومها. وعلاوة على ذلك، فمن المستحسن لإذابة قارورة جديدة لكل تجربة والتحقق من سلوك الخلايا كل يوم. إذا كانت المجالات أقل انكسارمع حجم أعلى غير طبيعي، فإنها من المرجح أن تبدأ في التجميع والموت.

أحد التحسينات على هذا النظام هو إما التسريب أو تنفيذ نظام الأوعية الدموية (عن طريق إضافة الخلايا البطانية أو داخل رقاقة سيولة 3D)12،13. ومع ذلك، فإن التحكم في سمك الجهاز العصبي (≤ 300 ميكرومتر) يسمح بضخ الأكسجين والتغذية السلبي بكفاءة ويمنع النخر. تحسين آخر هو إدخال الخلايا المناعية (microglia). ومع أخذ هذه القيود في الاعتبار، قد تكون الأعضاء العصبية بالإضافة إلى نظام مؤسسة الخليج للاستثمار أداة ذات صلة لعدة أسباب. أولا، يسمح هذا النظام فحص المخدرات لرصد كيف يمكن أن يؤثر مركب علاجي على خلية الجهازية أو الورم. ثانياً، يمكن دراسة التفاعلات بين الخلايا، ويمكن تصور المحددات البيئية الدقيقة الكامنة وراء الغزوات الفردية والجماعية واستكشافها5و6و13.

في سياق مرض باركنسون، يمكن أن يمثل الجهاز العصبي المخصب في الخلايا العصبية DA نموذج 3D ذات الصلة ودقيقة لدراسة تطور المرض. في دراسات سابقة، تم استخدام الخلايا الجذعية متعددة القوى المستحثة من مرض باركنسون والمستمدة من المرضى والمتمايزة تجاه الخلايا العصبية في DA لدراسة الأنواع الفرعية للخلايا العصبية المتأثرة. وتجدر الإشارة إلى أن بعض الأنماط الظاهرية المرتبطة بالأمراض مثل تراكم α-synuclein والحساسية للإجهاد التأكسدي قد لوحظت14،15. وعلاوة على ذلك، يمكن استخدام الجهاز العصبي كأداة لفحص الجزيئات العلاجية. ومع ذلك, ينبغي إعداد التلاوة محددة وذات الصلة لتقييم بقاء الخلايا العصبية DA والوظائف, مثل إنتاج الدوبامين والنشاط الكهربائي الفسيولوجي. وإجمالاً، يوفر هذا البروتوكول نهجين موحدين ودقيقين قائمين على الخلايا الجذعية لتوليد الأعضاء العصبية.

Disclosures

ولا يعلن صاحبا البلاغ عن أي مصالح مالية متنافسة.

Acknowledgments

ويشكر المؤلفون منظمة "لا ليج جينيفيواز لمكافحة السرطان" (جنيف، سويسرا)، ومؤسسة ISREC (لوزان، سويسرا)، ومؤسسة كلايتون للبحوث (هيوستن، تكساس، الولايات المتحدة الأمريكية) على الدعم المالي. وعلاوة على ذلك، يشكر المؤلفان HES-HO ومركز Wyss على الدعم المالي. نشكر مختبر كراوس على المناقشات المفيدة والدعم والدكتورة هالة قطيش على التدقيق.

Materials

Name Company Catalog Number Comments
6-well plate (6-well plate) Falcon / Corning 07-201-588
ABI Prism 7900 HT detection system  (Real-Time PCR detection systems) Applied Biosystems Discontinued
Aggrewell 400 (Microwell culture plates ) StemCell Technologies 34421
Amplifier (W2100-HS32)  (Amplifier) Multi Channel Systems
Anti-EGFR (phospho Y1101) antibody Abcam ab76195 1/100 dilution
Anti-GFAP Antibody Dako  Z334  1/1000 dilution
Anti-Nestin, Human Antibody Millipore  ABD69  1/400 dilution
Anti-Synapsin I Antibody Chemicon  AB1543P  1/500 dilution
B27 supplements (B27) Life Technologies / Invitrogen 1238 For both protocol, stock solution 100x, final solution 1x
Brain-derived neurotrophic factor  (BDNF) Cell Guidance GFH1-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
CHIR-99021 (GSK-3β inhibitor ) Axon Medchem ct99021 For Dopaminergic protocol,  stock solution 7.5 mM in DMSO, final solution 3 µM
Compound E a γ–secretase inhibitor (γ–secretase inhibitor) Calbiochem CAS 209986-17-4 For both protocol (gamma-secretase inhibitor XXI),  stock solution 5 mM in DMSO, final solution 1 µM
Coulochem III  (Coulometric detector parameters) Thermo scientific
Dibutyryl cyclic-AMP (Dibutyryl cAMP) Sigma D0627 For Dopaminergic protocol,  stock solution 0.5 M in DMSO, final solution 0.5 mM
Dimethyl Sulfoxide Pure (DMSO) Sigma-Aldrich C6164 Compounds solvent, ready to use
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 12491-015 For cell culture, ready to use
Dulbecco's Modified Eagle Medium Mixture F-12 (DMEM-F12) Gibco 11320033 For cell culture, ready to use
EDTA 0.1 mM (EDTA) Life Technologies AM9912 For cell culture, ready to use
Epidermal Growth Factor (EGF) Gibco PHG0313 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
Fibroblast Growth Factor 20 (FGF20) Peprotech 100-41 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 5 ng/mL
fibroblast growth factor 8  (FGF8) Peprotech GFH176-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
Fibroblast growth factor-basic (bFGF) Gibco PHG0024 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
G5 supplements (G5) Invitrogen 17503012 For GIC culture, stock solution 100x, final solution 1x
Glial cell-derived neurotrophic factor (GDNF) Cell Guidance GFH2-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
Hydrophilic polytetrafluoroethylene  membrane (PTFE membrane) BioCell-Interface Discontinued
LDN-193189 (BMP inhibitor) Axon Medchem /Stemgen 04-0072-02 /1509 Dual/Smad,  stock solution 5 mM in DMSO, final solution 0.5 µM
L-glutamine (L-glutamine) Gibco 25030081 L-Glutamine (200 mM), stock solution 200 mM, final solution 2 mM
Matrigel (extracellular matrix) BD Biosciences 354277 hESC-qualified Matrix, stock solution 18-22 mg/mL, final solution 180-220 µg/mL
Millicell-CM Culture plate insert  (0.4 µm) (Culture plate insert) Millipore PICM03050
Monoclonal Anti-β-Tubulin III antibody Sigma  T8660  1/1000 dilution
MS Orbital Shaker, MS-NOR-30 (Orbital shaker) Major Science MS-NRC-30
N2 supplements (N2) Invitrogen 17502-048 For GIC culture, stock solution 100x, final solution 1x
Nanodrop (Nanodrop) Thermo Fisher Scientific Discontinued
Neurobasal (Neurobasal) Life Technologies / Gibco 21103049 Maintenance and maturation embryonic neuronal cell populations , ready to use
Non-Essential Amino Acids  (NEAA) Gibco 11140 Non-essential Amino Acids 100X, stock solution 100x, final solution 1x
Nurr1 Antibody (M-196) Santa Cruz Sc-5568 1/100 dilution
Nutristem  (hESC medium ) Biological Industries 05-100-1A Stem cell media, ready to use
Penicilin / Streptomycin  (Penicilin / Streptomycin ) Life Technologies / Gibco 15140122 For cell culture, stock solution 5 mg/mL, final solution 50 µg/mL 
Perchloric acid 0.1N (HCLO4) Merck 100519 For HPLC, ready to use
Phosphate Buffered Saline without Ca2+/Mg2+  (PBS without Ca2+/Mg2+ ) Life Technologies 14190250 For cell culture, ready to use
PrimeScript RT-PCR Kit (Reverse transcription kit) Takara RR014A
Purmorphamin (smoothened agonist) Calbiochem SML0868 For Dopaminergic protocol,  stock solution 10 mM in DMSO, final solution 2 µM
Rho-associated Kinase Y-27632 (ROCK) Abcam Biochemicals ab120129-1 Rock Inhibitor,  stock solution 50 mM in DMSO, final solution 10 µM
RNeasy mini kit (RNA extraction kit ) Qiagen 74104
SB-431542 (TGFβ/Activin/Nodal inhibitor ) Ascent Asc- 163 Dual-Smad,  stock solution 50 mM in DMSO, final solution 10 µM
Sonic Hedgehog (SHH) Cell Guidance GFH168-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
StemPro Accutase (hESC enzymatic solution) Gibco A11105-01 hESC enzymatic solution, ready to use
Symmetry C-18,5 mm (4.6 150mm2)  (Reversed-phase column) Waters Corporation
T150 flask (T150 flask) Falcon 08-772-1F
TH Antibody (F-11) Santa Cruz Sc-25269 1/200 dilution
Transforming Growth Factors beta 3 (TGFβ3) Cell Guidance GFH109-2 For Dopaminergic protocol,  stock solution 100 µg/mL in pure ethanol , final solution 1 ng/mL
Trichostatine A (inhibitor of histone deacetylase ) Sigma T8552 For Dopaminergic protocol,  stock solution 100 µM in DMSO, final solution 20 nM
TrypLE (recombinant enzymatic solution) Invitrogen 12604021 recombinant enzymatic solution, ready to use
Trypsin 0.25% (enzymatic solution) Life Technologies 15050065 enzymatic solution, ready to use
W2100, Multi Channel Systems (Data acquisition system ) WAT045905
X-vivo (serum free medium) Lonza BE04-743Q serum free medium, ready to use

DOWNLOAD MATERIALS LIST

References

  1. Louis, D. N., et al. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary. Acta Neuropathologica. 131, (6), 803-820 (2016).
  2. Stupp, R., et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. New England Journal of Medicine. 352, (10), 987-996 (2005).
  3. Daphu, I., et al. In vivo animal models for studying brain metastasis: value and limitations. Clinical and Experimental Metastasis. 30, (5), 695-710 (2013).
  4. Huszthy, P. C., et al. In vivo models of primary brain tumors: pitfalls and perspectives. Neuro Oncology. 14, (8), 979-993 (2012).
  5. Nayernia, Z., et al. The relationship between brain tumor cell invasion of engineered neural tissues and in vivo features of glioblastoma. Biomaterials. 34, (33), 8279-8290 (2013).
  6. Cosset, E., et al. Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials. 107, 74-87 (2016).
  7. Pringsheim, T., Jette, N., Frolkis, A., Steeves, T. D. The prevalence of Parkinson's's disease: a systematic review and meta-analysis. Movement Disorders. 29, (13), 1583-1590 (2014).
  8. Rajput, A. H., et al. Globus pallidus dopamine and Parkinson's motor subtypes: clinical and brain biochemical correlation. Neurology. 70, (16 Pt 2), 1403-1410 (2008).
  9. Jellinger, K. A. Pathology of Parkinson's's disease. Changes other than the nigrostriatal pathway. Molecular and Chemical Neuropathology. 14, (3), 153-197 (1991).
  10. Bernheimer, H., Birkmayer, W., Hornykiewicz, O., Jellinger, K., Seitelberger, F. Brain dopamine and the syndromes of Parkinson’s and Huntington. Clinical, morphological and neurochemical correlations. Journal of Neurological Science. 20, (4), 415-455 (1973).
  11. Tieng, V., et al. Engineering of midbrain organoids containing long-lived dopaminergic neurons. Stem Cells and Development. 23, (13), 1535-1547 (2014).
  12. Chen, C. S. 3D Biomimetic Cultures: The Next Platform for Cell Biology. Trends in Cell Biology. 26, (11), 798-800 (2016).
  13. Friedl, P., Sahai, E., Weiss, S., Yamada, K. M. New dimensions in cell migration. Nature Reviews Molecular Cell Biology. 13, (11), 743-747 (2012).
  14. Byers, B., et al. SNCA triplication Parkinson's's patient's iPSC-derived DA neurons accumulate alpha-synuclein and are susceptible to oxidative stress. PLoS ONE. 6, (11), e26159 (2011).
  15. Flierl, A., et al. Higher vulnerability and stress sensitivity of neuronal precursor cells carrying an alpha-synuclein gene triplication. PLoS ONE. 9, (11), e112413 (2014).
الأعضاء العصبية البشرية لدراسة سرطان الدماغ والأمراض العصبية
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).More

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter