Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Bioengineering

Humane neurale Organoider til at studere hjernekræft og neurodegenerative sygdomme

doi: 10.3791/59682 Published: June 28, 2019
* These authors contributed equally

Summary

Denne undersøgelse introducerer og beskriver protokoller til at udlede to specifikke humane neurale organoider som en relevant og præcis model til at studere 1) menneskelig glioblastoma udvikling inden for humane neurale organoider udelukkende hos mennesker og 2) neuron dopaminerge differentiering genererer en tredimensionel organoid.

Abstract

Manglen på relevante in vitro neurale modeller er en vigtig hindring for medicinske fremskridt for neuropatiologier. Etablering af relevante cellulære modeller er afgørende både for bedre at forstå de patologiske mekanismer af disse sygdomme og identificere nye terapeutiske mål og strategier. For at være relevant skal en in vitro-model gengive de patologiske egenskaber ved en menneskelig sygdom. I forbindelse med neurodegenerative sygdomme bør en relevant in vitro-model imidlertid give neurale celle udskiftning som en værdifuld terapeutisk mulighed.

En sådan model ville ikke kun tillade screening af terapeutiske molekyler, men kan også anvendes til at optimere neurale protokol differentiering [for eksempel i forbindelse med transplantation i Parkinsons sygdom (PD)]. Denne undersøgelse beskriver to in vitro-protokoller af 1) Human glioblastoma udvikling inden for en menneskelig neurale organoider (NO) og 2) neuron dopaminerge (DA) differentiering genererer en tredimensionel (3D) organoid. Til dette formål blev der etableret en standardiseret protokol, som giver mulighed for at fremstille størrelses kalibrerede Neuro kugler afledt af humane embryonale stamceller (hESC)-differentiering. Den første model kan bruges til at afsløre molekylære og cellulære hændelser i løbet af glioblastoma udvikling inden for neurale organoid, mens DA organoid ikke kun repræsenterer en passende kilde til DA neuroner for Celleterapi i Parkinsons sygdom, men også kan anvendes til lægemiddel testning.

Introduction

Verdenssundhedsorganisationen (WHO) klassificerer astrocytomer som lav kvalitet (grad I til II) eller høj kvalitet (grad III og IV). Glioblastoma multiforme (GBM) er en astrocytoma grade IV, den mest dødbringende af primære hjernetumorer, der er modstandsdygtig over for alle nuværende former for behandlinger1. Trods standardbehandling, herunder neurosurgery, kemoterapi og strålebehandling, er GBM fortsat dødelig, og den samlede overlevelsesrate på 15 måneder har ikke ændret sig dramatisk i løbet af de sidste 15 år2. For at gøre betydelige fremskridt med hensyn til at forstå GBM patogenesen er brugen af relevante modeller nøglen. Indtil videre har studiet af GBM påberåbt sig cellelinjer, gnaver organotypiske skiver og xenotransplantation af patient afledte celler til mus eller Transgene mus, som udvikler spontane tumorer3,4. Selv om disse modeller har været nyttige til at studere hjernemetastaser og tumor aggressivitet, de er begrænset af forskelle mellem arter, og resulterende konklusioner kan være forkert oversat til humane væv. Desuden er eksisterende modeller med humane celler også begrænset af fravær af vært væv/tumor interaktioner3,4. Eksperimentelle modeller er afgørende for oversættelsen fra grundforskning til terapeutiske mål. Derfor, at beskrive en protokol til at producere in vitro humane neurale organoider Co-kultiveret med GBM-initierende celler (GICs) kan give et relevant system, der efterligner morfologiske og funktionelle funktioner i GBM udvikling. Dette system gengiver nogle in vivo funktioner i GBM developmentsåsom diffus migration af invaderende celler og nekrose områder, og det fremhæver genekspression relevant for tumor biologi. Som tidligere afsløret, nogle kritiske micrornas er induceret under GIC udvikling inden for 3D nerve væv5,6.

PD er en stor neurodegenerative lidelse og forbundet med degeneration af flere neuronal undertyper7. Selv om en progressiv indtræden af symptomer (f. eks bradykinesia, asymmetrisk hvile tremor, stivhed og holdning ustabilitet) karakteriserer sygdommen, dens nøjagtige ætiologi er ikke klart fastslået. Faktisk har mange undersøgelser fremhævet beviser for, at store risikofaktorer kan skyldes en kombination af genetiske og miljømæssige faktorer. Parkinson symptomer er forbundet med den bilaterale degeneration af dopaminerge neuroner i stoffer nigra (SN), hvilket fører til forsvinden af dopaminerge (da) axoner projicering til striatum8,9. Derfor er reduktionen af striatal dopamin niveauer korreleret med progression af motorisk dysfunktion hos PD patienter. Dopaminerge neuroner indeholder tyrosin hydroxylase (TH), et vigtigt enzym i syntesen af catecholaminerge neurotransmittere, der omdanner aminosyren L-tyrosin til L-3, 4-dihydroxyphenylalanin (L-DOPA, en dopamin forløber) til dopamin10. Tidlig tab af TH aktivitet efterfulgt af et fald i TH protein udtryk er et kendetegn for PD.

Denne undersøgelse beskriver to protokoller ved hjælp af humane neurale organoider, med en specifikt orienteret mod en midbrain-lignende fænotype beriget med TH-positive celler.

Protocol

Denne protokol følger retningslinjerne fra universitetet i Genèves etiske komité for human forskning.

1. vedligeholdelse og kultur af udifferentierede humane embryonale stamceller (hESCs)

  1. Udfør vedligeholdelse og udvidelse af hSECs på feeder-fri betingelser ved forbelægnings retter med en specifik ekstracellulær matrix.
    1. Tø 300 μl ekstracellulær matrix ved 4 °c (typisk koncentrations koncentration 18-22 mg/ml, hold på is) og bland forsigtigt med 15 ml koldt DMEM-medium for at undgå en for tidlig gelering af den ekstracellulære matrix. Tilsæt 7,5 mL af den ekstracellulære Matric til begge T150 kolber.
    2. De retter, som er belagt med ekstracellulær matrix, inkubateres ved 37 °C i mindst 1 time (maks. overnatning).
    3. Fjern mediet og Seed hESCs til en tæthed på 6,5 x 104 celle/cm2.
  2. Vedligehold H1 (hESC cellelinje) i hESC medium og 1% penicillin/streptomycin.
  3. Cellerne skal passere med enzymatisk procedure: Tilsæt 7,5 mL enzymatisk opløsning til en T75 cm2 kolbe over en periode på 1-2 min ved 37 °c. Når cellerne er helt løsrevet, tilsættes 7,5 mL DMEM-F12 og centrifugeres i 5 minutter ved 300 x g. For at give mulighed for bedre overlevelse, re-Plate celler med den ønskede tæthed på ekstracellulære matrix-belagte retter, i samme medium indeholdende Rho-associeret protein kinase (ROCK) inhibitor (10 μM) for 24 h.

2. hESC-afledte neurale organoider til GBM-undersøgelser

  1. 24 h før du starter 3D-kulturen, skal du udskifte hesc-mediet med et serumfrit medium suppleret med 10 μM-klippe hæmmer (begge komponenter er nødvendige for at understøtte cellens overlevelse og spontane sfære dannelse under aggregerings fasen i en strips med mikrobrønde plade). Cellerne skal være på 60% konfluency. Den næste dag (dag 0) frigør hESC-kolonierne som enkeltceller: Fjern mediet, skyl derefter med PBS uden ca2 +/mg2 +, tilsæt 5 ml enzymatisk opløsnings opløsning, og Inkuber ved 37 °c i 1-2 min.
  2. Cellerne opsamles i serumfrit medium med 10 μM klippe hæmmer, og cellerne centrifugeres ved 300 x g i 5 min. Fjern supernatanten, og Tæl cellerne i 10 ml serumfrit medium suppleret med 10 μM klippe hæmmer.
  3. Parallelt skylles mikrobrønd pladen med 2 ml serumfrit medium pr. brønd og centrifugeres pladen ved 1200 x g i 5 minutter for at fjerne alle bobler, hvilket kan forhindre sfære dannelse.
  4. Forbered 28,2 x 106 af cellerne i 12,5 ml serumfrit medium suppleret med 10 μM rock hæmmer. Dispensere 1000 celler/microwell. Cellerne centrifugeres ved 300 x g i 5 minutter, og pladen placeres i inkubator ved 37 °c natten over (maksimum 36 h). For eksempel: for at opnå 30 humane neurale organoider, brug en T150 kolbe ved 70%-80% af sammenløbet (ca. 30.000.000 celler).
  5. Den næste dag (dag 1), indsamle de kugler (med en P1000) og placere dem i en 6 brønd plade. I hver brønd tilsættes 2 mL B27 medium og DMEM-F12 GlutaMAX og Neurobasal medium (mix ved 1:1), suppleret med 1% B27 kosttilskud og 1% ikke-essentielle aminosyrer (NEAA). For at fremme hurtig neurale induktion, supplere mediet med Dual-SMAD hæmning cocktail, sammensat af 10 μM TGFβ/Activin/nodal-hæmmer og 0,5 μM knogle morfogenic protein (BMP) hæmmer. Fra dette skridt fremad, er sfærerne kultiveret i rotation (60 rpm, orbital shaker). Rotationen er afgørende for at forhindre, at sfærerne klæber sammen eller til pladen.
  6. Skift medium hver 2-3 dage: bøje pladen og lad sfærerne falde ned i 5 min, fjerne halvdelen af mediet (2 mL), og tilsæt 2 mL frisk B27 medium suppleret med vækstfaktorer og hæmmere. Centrifuger ikke på sfærerne.
  7. Udfør neurale induktion i henhold til følgende tidsforløb:
    1. Fra dage 1-4, kultur sfærerne i B27 medium suppleret med Dual-SMAD. Dual-SMAD-hæmnings cocktailen (10 μM TGFβ/Activin/nodal-hæmmer og 0,5 μM BMP-hæmmer) fremmer neurale induktion.
    2. Fra dag 4-11, fremme spredning af hESC-afledte neurale rosetter (ind i sfærer), ved at tilføje 10 ng/mL epidermal vækstfaktor (EGF) og 10 ng/mL grundlæggende fibroblast faktor (bFGF) til B27 medium suppleret med Dual-SMAD cocktail.
      Bemærk: på dag 11 skal de fleste celler være positive for Nestin.
    3. Fra dage 11-13, kultur kugler i B27 medium suppleret med 0,5 μM BMP-hæmmer.
    4. Fra dage 13-21, kultur sfærerne i B27 medium suppleret med 10 ng/mL gliaceller afledt neurotrofisk faktor (GDNF), 10 ng/mL hjernen afledt neurotrofisk faktor (BDNF) og 1 μM af γ-sekretase inhibitor. GDNF og BDNF fremmer neuronal og gliaceller differentiering. Γ-sekretase-hæmmer giver mulighed for større neurale modning.
    5. På dag 21, plade kugler (ca. 1.000 kugler) på en hydrofile polytetrafluorethylen (PTFE) membran (6 mm diameter, 0,4 μm) deponeret på en kultur plade indsætte designet til 6 brønd plade. Stop enhver rotation fra dette trin. Tilstedeværelsen af rosetter, observeret med en lys-felt mikroskop, indikerer indledningen af neurale differentiering. De neurale rosetter kan observeres 2-3 dage efter plating kugler på PTFE-membranen.
    6. Tilsæt 1 mL B27 medium suppleret med vækstfaktorer og hæmmere (som følger) til hver brønd under membranen indsats, hver 2-3 dage (normalt mandag, onsdag og fredag), for en følgende 3 ugers differentiering.
    7. Fra dag 21-25, dyrke humane neurale organoider i samme neurale modnings medium (CF. trin 2.7.4).
    8. Fra dag 25-28, kun supplere B27 medium med 1 μM γ-sekretasehæmmer.
    9. Fra dage 28-39, stoppe med at tilføje γ-sekretase inhibitor og fortsætte Human neurale organoid kultur i B27 medium kun.
      Bemærk: efter 3 uger er neurale organoider klar til brug til GIC implantation. Langs neurale modning blev der observeret et fald i neurale umoden markør Nestin og øgning af modne neurale markører β3-Tubulin og GFAP.

3. isolering og dyrkning af glioblastoma-initierende celler (GICs)

  1. Isolere GICs ved at fragmentere en høj kvalitet Human GBM biopsi. Overføre tumoren i et bægerglas indeholdende 0,25% trypsin i 0,1 mM EDTA (4:1) og langsomt røre ved 37 °C for 30-60 min (afhængigt af tumorstørrelse).
  2. Plade de dissocierede celler i 75 cm2 vævskultur kolber belagt ved 2500-5000 celler pr cm2 i GIC medium: DMEM/F-12 medium (1:1) indeholdende 1% N2, 1% B27, og 1% G5 kosttilskud (til fordel for GIC overlevelse), suppleret med BFGF og EGF (begge på 10 ng/ml, for at fremme stemthed) og 1% penicillin/streptomycin.
  3. Når den GIC er veletableret og voksende, fjerne N2 og G5 kosttilskud fra GIC medium.
  4. En dag før du tilføjer cellerne på organoid, dissocierer GICs og tælle dem.
  5. Mikrobrønd pladen skylles med 2 mL GIC medium, og pladen centrifugeres med den maksimale hastighed for at fjerne bobler (1000 x g). Placer GICs på 1.000 celler for at opnå en gliomasphere pr. mikrobrønd. Inkuber natten over ved 37 °C (figur 1c). Dette trin er nøglen og giver mulighed for velkalibrerede GICs (et eksempel på nekrotiske og over dimensionerede GICs er vist i figur 2a,C).
  6. For at starte GBM invasion, tilsættes en gliomasphere på toppen af neurale væv med en stor bore pipet spids (figur 1f). Placer forsigtigt 6-brønd pladen tilbage i inkubator.

4. hESC-afledte dopaminerge organoider for PD-undersøgelser

  1. Dag 0: Amplify hESCs i 2D-kultur op til 60% konfluency (dag 0), og erstat derefter stamcelle medier, der bruges til at vedligeholde pluripotens funktioner i hESCs med et serumfrit medium. Start neurale induktion ved at supplere dyrkningsmediet med 0,5 μM BMP-hæmmer og 10 μM TGFβ/Activin/nodal-hæmmer (dual-SMAD hæmning cocktail), og tilsæt derefter 10 μM ROCK inhibitor til 24 timer for at øge overlevelsesraten for celler under passage.
  2. Dag 1: klargør mikrobrønd pladen med 2,5 mL pr. brønd af serumfrit medium suppleret med 0,5 μM BMP-hæmmer, 10 μM TGFβ/Activin/nodal-hæmmer og 10 μM-klippe hæmmer. For at specificere celler mod det ventrale mønster af neurale rør, tilsættes 100 ng/mL Sonic pindsvin (SHH), 100 ng/mL fibroblast vækstfaktor 8 (FGF8), og 2 μM udglatter agonist. Centrifuger pladen (kun med medium og uden celler) ved 1200 x g i 5 minutter for at fjerne luftbobler fra mikrobrøndene.
    1. Efter 1 dag med neurale induktion i 2D, Fjern mediet og vask hurtigt med PBS uden ca2 +/Mgcl2 +. Kolonierne i enkelt cellesuspension adskilles ved tilsætning af 7,5 mL rekombinant enzymatisk opløsning i en T75 cm2 kolbe. Inkuber i 2 min ved 37 °C og derefter komplet med 7,5 mL DMEM-F12.
    2. Saml cellesuspensionen og centrifugeres ved 300 x g i 5 min. Fjern supernatanten og Tæl cellerne i det samme medium, der bruges til at tilberede mikrobrønd pladen.
    3. Juster medium volumen for at opnå en cellesuspension gør det muligt at danne Neuro kugler indeholder 1000 celler pr strips med mikrobrønde (for eksempel, strips med mikrobrønde pladen anvendes her indeholder 4.700 mikrobrønde per brønd). Så Forbered 4.700.000 celler i 2,5 mL medium og tilsæt det til den tidligere 2,5 mL medium allerede placeret i pladen.
    4. For at distribuere cellerne korrekt i hver mikrobrønd rystes pladen forsigtigt, og mikrobrønd pladen centrifugeres 300 x g i 5 min. Inkuber pladen ved 37 °c i 24 timer for at generere kugler.
  3. Dag 2: Skyl forsigtigt mikrobrøndene med mediet, og saml derefter sfærerne i den vævs behandlede seks-brønd plade. Udskift medium med Neurobasal medium suppleret med 1% B27, 1x NEAA, 2 mM L-glutamin, og 1% af penicillin/streptomycin. Derudover tilsættes regionaliserings faktorer SHH, FGF8, udjævnet agonist og Dual-SMAD hæmning små molekyler.
    1. Placer kugler i rotation ved 37 °C (60 rpm, orbital shaker) og Skift halv-medium frisk suppleret hver 2-3 dage.
  4. Dag 3: for at forbedre neurale induktion og konvertere til neurale Stam forfædre med en mellemhjernens identitet, supplere mediet med 3 μM GSK-3β-hæmmer, som aktiverer WNT/β-køreledningen i pathway. Vedligehold GSK-3β-hæmmer i mediet op til dag 13. Opdelt i to nye væv-behandlede 6 brønd plader til at reducere både sfære tæthed per brønd og undgå sfære sammenlægning.
    Bemærk: på dag 8 skal de fleste celler være positive for Nestin.
  5. Dag 8: Start neurale modning: Erstat regionaliserings faktorer Shh, FGF8, udjævnet agonist, og Dual-SMAD hæmning cocktail med 0,5 mm dibutyryl Camp (til fordel modning), 20 Nm hæmmer af Histon deacetylase (for celle cyklus exit), 1 μM γ-sekretase hæmmer og vækstfaktorer, 10 ng/mL GDNF, 10 ng/mL BDNF, 1 ng/mL omdanne vækstfaktor β3 (TGFβ3), og 5 ng/mL FGF20 (begge favorisere DA progenitorceller overlevelse). Skift mellem mediet hver 2-3 dage.
  6. Dag 21: Generer neurale organoid: frø omkring 100 Neuro kugler under Air-Liquid interface betingelser på PTFE membran (6 mm diameter). Membranen overføres til en kultur plade indsats (0,4 mm) og tilsættes 1,2 ml neurale modnings medium, der anvendes til sfære differentiering som tidligere beskrevet.
    1. Stop enhver rotation fra dette trin. Skift mediet hver 2-3 dage, indtil det ønskede differentierings tidspunkt er opnået.
      Bemærk: med hensyn til neurale modning blev der observeret et fald i den neurale umodne markør Nestin og øgning af modne neurale markører β3-Tubulin og GFAP. Høje TH og NURR1 udtryk blev observeret (figur 3c) og bekræfte neurale organoid modenhed11.

5. kvantificering af TH og Nurr1 genekspression til validering af dopaminerge differentiering

  1. RNA ekstraktion: på den angivne differentierings dag, lyse 40 Neuro kugler med 350 μL RLT buffer (leveres i RNA ekstraktions Kit) suppleret med 3,5 μL 2-mercaptoethanol. Udpak RNA fra de lyserede Neuro kugler ved hjælp af et RNA-ekstraktions udstyr efter producentens anvisninger.
  2. Kvantificere totale RNA-koncentrationer.
  3. Udfør reverse transkriptionen af 300 ng af den totale RNA-ekstraktion ved hjælp af reverse transkriptionssæt til kvantitativ realtids-polymerasekæde reaktion (qPCR), og følg producentens anvisninger.
  4. Udfør qPCR-analyse på realtids PCR-detekteringssystemer baseret på asymmetrisk cyanine-farvedetektering. Normalisere data med husholdning gener: glyceraldehyd-3-fosfat dehydrogenase (GAPDH) og forlængelse faktor 1-alpha (EF1). Sekvenser af primere er beskrevet i tabel 1.

6. detektion af højtryksvæskekromatografi (HPLC)

  1. Brug højtryksvæskekromatografi (HPLC) med elektrokemisk detektion til påvisning af tilstedeværelsen af dopamin. Dopamin blev ekstraheret ved at lyserende neurale organoider i 100 ml af 0,1 N perklorsyre (HClO4) i 15 min ved 4 °c med en kraftig vortexning hver 5 min. Efter centrifugering, indsamle og opbevare supernatanten ved-20 °C for dopamin dosis.
  2. Brug en C-18 kolonne (5 μm, 4,6 mm x 150 mm) til at adskille analytterne ved omvendt fase HPLC i isokratisk tilstand med en strømningshastighed på 1 mL/minut. Påvisning af dopamin bør udføres ved hjælp af en coulometrisk detektor med konditionerings cellen sat til et potentiale på + 200 mV.

7. rå Dataoptagelse med microelectode array (MEA) platform

  1. Brug en dissektion mikroskop til at overføre Neuro kugler til midten af en porøs MEA enhed.
  2. Brug en forstærker og et dataindsamlingssystem til elektrofysiologiske optagelser. Mål signal-støj-forholdet (SNR) som standardafvigelsen for spændingen under en 5 min-optagelse ved hjælp af signalet som den gennemsnitlige peak-to-peak-spænding på de pigge, der er registreret i de samme 5 min. perioder.

Representative Results

De kritiske trin i denne protokol skal være velidentificerede og håndteres korrekt. Derfor er et diagram over dyrkningsbetingelser, der angiver tidsforskydning for hvert trin, samt de forbindelser, som anvendes til differentierings protokollen, illustreret i figur 1a og figur 3a for henholdsvis No plus GBM og da neurale organoider. Figur 1b, C, D, E, F illustrerer cellerne, SFÆRERNE og nej og viser den typiske morfologi for hvert trin. Figur 1G, H, jeg illustrerer immunofluorescens farvning med nogle neurale markører.

Figure 1
Figur 1 : Humant neurale organoid (Nej) differentierings protokol. A) standardiseret protokol for generering af No afledt af humane embryonale stamceller (hesc). B) hESCs vedligeholdes på ekstracellulær matrix i hesc-medium. (C) mikrobrønd plader blev anvendt til at generere kalibrerede Neuro kugler. På 2 uger blev Neuro kugler belagt på skæret indeholdende en PTFE-membran (Scale bar = 50 μm). (D) makroskopisk visning af No i skæret i en brønd af en 6 brønd plade. I løbet af de første dage blev der observeret rosetter (sort pil) (E). F) makroskopisk visning af en no plus GIC-kugle på toppen. (G-I) Immunofluorescens analyse af NO plus GIC Sphere (EGFR-positive; Scale bar = 50 μm) (G) og ingen alene, som viste immun reaktivitet for neuronal markør βiii-Tubulin og svagt positiv for nestin; Men, synapsin 1 viste et svagt signal (H, I) (skala stænger = 100 μm og 50 μm, hhv.). Venligst klik her for at se en større version af dette tal. 

Figure 2
Figur 2 : Illustration af nekrotiske kugler og UMODNE nej. Neuro kugler (A) og No (B) kan undergå nekrose, når de er for talrige i brønden eller overdimensioneret (C) (skala bar = 10 μm). D) en GIC inficeret med en tomat reporter hjælper med at spore tumor celle invasion i No, Scale bar, 10 μm. eksempel på UMODNE No med neurale rør (E) og ingen neurale rør (F) (skala bar = 50 μm). Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3 : Standardiseret protokol til generering af da neurale organoid og elektrofysiologisk og morfologisk analyse. (A) standardiseret protokol for generering af da neurale organoider. B) immunofluorescens analyse af det neurale organoid TH-immunoreaktive celler Co-udtrykker Nurr1, en midt hjerne specifik markør (skala bar = 50 μm). Data er repræsenteret som middelværdien ± SEM (n = 3). (C) grafer repræsenterer kinetik af th og Nurr1 genekspression evalueret af QRT-PCR. D) repræsentativt HPLC: dopamin Peak (Arrow) blev detekteret af HPLC fra da neurale organoid lysat. E) eksempel på rådata, som er registreret med MEA-platformen. Hver spids vises af en lodret linje (tidsstempler), mens det resterende spor er støj. F) billede, der repræsenterer en sfære deponeret på MEA. (G) superposition af typiske pigge (blå og røde kurver) opdaget fra de rå data. Den sorte, dristige kurve angiver gennemsnittet af de tilsvarende røde kurver. (H) raster plot, der viser tidsstempler forbundet med hvert Spike detekteret. De forskellige farver fremhæver de forskellige elektroer. Venligst klik her for at se en større version af dette tal. 

Gen Foward Omvendt
Nurr1 GGCTGAAGCCATGCCTTGT GTGAGGTCCATGCTAAACTTGACA
TH GCACCTTCGCGCAGTTCT CCCGAACTCCACCGTGAA
EEF1 AGCAAAAATGACCAATG GCCTGGATGGTTCAGGATA
GAPDH GCACAAGAGGAAAGAGAGAGAACC AGGGGAGATTCAGTGTGGGT

Tabel 1: primere anvendt i denne protokol.

Discussion

En af de mest kritiske aspekter af denne protokol omfatter vedligeholdelse af hESC pluripotens under celledyrkning og tæt overvågning af sfærer og neurale organoid morfologi. hESCs er meget følsomme, og enhver manipulation kan føre til tidlig ukontrolleret differentiering samt celledød. For at øge eksperimentel reproducerbarhed og undgå forekomsten af unormale karyotype hændelser, anbefales det at kryopreservere flere partier af hESCs ved den laveste passage efter validering af deres kromosom stabilitet. Desuden anbefales det at tø et nyt hætteglas for hvert eksperiment og kontrollere funktionsmåden af cellerne hver dag. Hvis sfærerne er mindre refraktive med unormal højere størrelse, vil de sandsynligvis begynde at aggregere og dø.

En forbedring på dette system er enten perfusion eller gennemførelse af et vaskulariseret system (ved at tilføje endotelceller eller inden for en 3D Fluidic mikrochip)12,13. Men kontrol af tykkelsen af neurale organoid (≤ 300 μm) giver effektiv passiv perfusion af ilt og næringsstoffer og forebygger nekrose. En anden forbedring er indførelsen af immunceller (microglia). Med disse begrænsninger i tankerne, neurale organoider plus et GIC system kan være et relevant værktøj af flere grunde. Første, dette system tillader Drug screening for at overvåge, hvordan en terapeutisk sammensatte kan påvirke en organoid eller tumor celle. For det andet kan celle-til-celle-interaktioner undersøges, og mikro-miljømæssige determinanter underliggende individuelle og kollektive invasioner kan visualiseres og udforskes5,6,13.

I forbindelse med Parkinsons sygdom, en neurale organoid beriget i DA neuroner kan repræsentere en relevant og nøjagtig 3D-model til at studere sygdomsudvikling. I tidligere undersøgelser, Parkinsons patient-afledte induceret pluripotente stamceller differentieret over for DA neuroner er blevet brugt til at studere de berørte neuronal undertyper. Bemærk, at nogle sygdomsrelaterede fænotyper såsom akkumulering af α-synuclein og følsomhed over for oxidativt stress er blevet observeret14,15. Desuden, den neurale organoid kan bruges som et værktøj til at screene terapeutiske molekyler. Der bør dog fastsættes specifikke og relevante udlæsninger for at evaluere DA neuron overlevelse og funktionalitet, såsom dopamin produktion og elektrofysiologisk aktivitet. I alt, denne protokol giver to standardiserede og nøjagtige stamcelle-baserede tilgange til at generere neurale organoider.

Disclosures

Forfatterne erklærer ikke konkurrerende finansielle interesser.

Acknowledgments

Forfatterne takker La Ligue genevoise contre Le cancer (Genève, Schweiz), ISREC Foundation (Lausanne, Schweiz) og Clayton Foundation for Research (Houston, TX, USA) for økonomisk støtte. Desuden forfatterne tak HES-HO og Wyss Center for økonomisk støtte. Vi takker krau's Lab for nyttige diskussioner og støtte og Dr. Halah Kutaish til korrekturlæsning.

Materials

Name Company Catalog Number Comments
6-well plate (6-well plate) Falcon / Corning 07-201-588
ABI Prism 7900 HT detection system  (Real-Time PCR detection systems) Applied Biosystems Discontinued
Aggrewell 400 (Microwell culture plates ) StemCell Technologies 34421
Amplifier (W2100-HS32)  (Amplifier) Multi Channel Systems
Anti-EGFR (phospho Y1101) antibody Abcam ab76195 1/100 dilution
Anti-GFAP Antibody Dako  Z334  1/1000 dilution
Anti-Nestin, Human Antibody Millipore  ABD69  1/400 dilution
Anti-Synapsin I Antibody Chemicon  AB1543P  1/500 dilution
B27 supplements (B27) Life Technologies / Invitrogen 1238 For both protocol, stock solution 100x, final solution 1x
Brain-derived neurotrophic factor  (BDNF) Cell Guidance GFH1-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
CHIR-99021 (GSK-3β inhibitor ) Axon Medchem ct99021 For Dopaminergic protocol,  stock solution 7.5 mM in DMSO, final solution 3 µM
Compound E a γ–secretase inhibitor (γ–secretase inhibitor) Calbiochem CAS 209986-17-4 For both protocol (gamma-secretase inhibitor XXI),  stock solution 5 mM in DMSO, final solution 1 µM
Coulochem III  (Coulometric detector parameters) Thermo scientific
Dibutyryl cyclic-AMP (Dibutyryl cAMP) Sigma D0627 For Dopaminergic protocol,  stock solution 0.5 M in DMSO, final solution 0.5 mM
Dimethyl Sulfoxide Pure (DMSO) Sigma-Aldrich C6164 Compounds solvent, ready to use
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 12491-015 For cell culture, ready to use
Dulbecco's Modified Eagle Medium Mixture F-12 (DMEM-F12) Gibco 11320033 For cell culture, ready to use
EDTA 0.1 mM (EDTA) Life Technologies AM9912 For cell culture, ready to use
Epidermal Growth Factor (EGF) Gibco PHG0313 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
Fibroblast Growth Factor 20 (FGF20) Peprotech 100-41 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 5 ng/mL
fibroblast growth factor 8  (FGF8) Peprotech GFH176-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
Fibroblast growth factor-basic (bFGF) Gibco PHG0024 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
G5 supplements (G5) Invitrogen 17503012 For GIC culture, stock solution 100x, final solution 1x
Glial cell-derived neurotrophic factor (GDNF) Cell Guidance GFH2-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
Hydrophilic polytetrafluoroethylene  membrane (PTFE membrane) BioCell-Interface Discontinued
LDN-193189 (BMP inhibitor) Axon Medchem /Stemgen 04-0072-02 /1509 Dual/Smad,  stock solution 5 mM in DMSO, final solution 0.5 µM
L-glutamine (L-glutamine) Gibco 25030081 L-Glutamine (200 mM), stock solution 200 mM, final solution 2 mM
Matrigel (extracellular matrix) BD Biosciences 354277 hESC-qualified Matrix, stock solution 18-22 mg/mL, final solution 180-220 µg/mL
Millicell-CM Culture plate insert  (0.4 µm) (Culture plate insert) Millipore PICM03050
Monoclonal Anti-β-Tubulin III antibody Sigma  T8660  1/1000 dilution
MS Orbital Shaker, MS-NOR-30 (Orbital shaker) Major Science MS-NRC-30
N2 supplements (N2) Invitrogen 17502-048 For GIC culture, stock solution 100x, final solution 1x
Nanodrop (Nanodrop) Thermo Fisher Scientific Discontinued
Neurobasal (Neurobasal) Life Technologies / Gibco 21103049 Maintenance and maturation embryonic neuronal cell populations , ready to use
Non-Essential Amino Acids  (NEAA) Gibco 11140 Non-essential Amino Acids 100X, stock solution 100x, final solution 1x
Nurr1 Antibody (M-196) Santa Cruz Sc-5568 1/100 dilution
Nutristem  (hESC medium ) Biological Industries 05-100-1A Stem cell media, ready to use
Penicilin / Streptomycin  (Penicilin / Streptomycin ) Life Technologies / Gibco 15140122 For cell culture, stock solution 5 mg/mL, final solution 50 µg/mL 
Perchloric acid 0.1N (HCLO4) Merck 100519 For HPLC, ready to use
Phosphate Buffered Saline without Ca2+/Mg2+  (PBS without Ca2+/Mg2+ ) Life Technologies 14190250 For cell culture, ready to use
PrimeScript RT-PCR Kit (Reverse transcription kit) Takara RR014A
Purmorphamin (smoothened agonist) Calbiochem SML0868 For Dopaminergic protocol,  stock solution 10 mM in DMSO, final solution 2 µM
Rho-associated Kinase Y-27632 (ROCK) Abcam Biochemicals ab120129-1 Rock Inhibitor,  stock solution 50 mM in DMSO, final solution 10 µM
RNeasy mini kit (RNA extraction kit ) Qiagen 74104
SB-431542 (TGFβ/Activin/Nodal inhibitor ) Ascent Asc- 163 Dual-Smad,  stock solution 50 mM in DMSO, final solution 10 µM
Sonic Hedgehog (SHH) Cell Guidance GFH168-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
StemPro Accutase (hESC enzymatic solution) Gibco A11105-01 hESC enzymatic solution, ready to use
Symmetry C-18,5 mm (4.6 150mm2)  (Reversed-phase column) Waters Corporation
T150 flask (T150 flask) Falcon 08-772-1F
TH Antibody (F-11) Santa Cruz Sc-25269 1/200 dilution
Transforming Growth Factors beta 3 (TGFβ3) Cell Guidance GFH109-2 For Dopaminergic protocol,  stock solution 100 µg/mL in pure ethanol , final solution 1 ng/mL
Trichostatine A (inhibitor of histone deacetylase ) Sigma T8552 For Dopaminergic protocol,  stock solution 100 µM in DMSO, final solution 20 nM
TrypLE (recombinant enzymatic solution) Invitrogen 12604021 recombinant enzymatic solution, ready to use
Trypsin 0.25% (enzymatic solution) Life Technologies 15050065 enzymatic solution, ready to use
W2100, Multi Channel Systems (Data acquisition system ) WAT045905
X-vivo (serum free medium) Lonza BE04-743Q serum free medium, ready to use

DOWNLOAD MATERIALS LIST

References

  1. Louis, D. N., et al. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary. Acta Neuropathologica. 131, (6), 803-820 (2016).
  2. Stupp, R., et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. New England Journal of Medicine. 352, (10), 987-996 (2005).
  3. Daphu, I., et al. In vivo animal models for studying brain metastasis: value and limitations. Clinical and Experimental Metastasis. 30, (5), 695-710 (2013).
  4. Huszthy, P. C., et al. In vivo models of primary brain tumors: pitfalls and perspectives. Neuro Oncology. 14, (8), 979-993 (2012).
  5. Nayernia, Z., et al. The relationship between brain tumor cell invasion of engineered neural tissues and in vivo features of glioblastoma. Biomaterials. 34, (33), 8279-8290 (2013).
  6. Cosset, E., et al. Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials. 107, 74-87 (2016).
  7. Pringsheim, T., Jette, N., Frolkis, A., Steeves, T. D. The prevalence of Parkinson's's disease: a systematic review and meta-analysis. Movement Disorders. 29, (13), 1583-1590 (2014).
  8. Rajput, A. H., et al. Globus pallidus dopamine and Parkinson's motor subtypes: clinical and brain biochemical correlation. Neurology. 70, (16 Pt 2), 1403-1410 (2008).
  9. Jellinger, K. A. Pathology of Parkinson's's disease. Changes other than the nigrostriatal pathway. Molecular and Chemical Neuropathology. 14, (3), 153-197 (1991).
  10. Bernheimer, H., Birkmayer, W., Hornykiewicz, O., Jellinger, K., Seitelberger, F. Brain dopamine and the syndromes of Parkinson’s and Huntington. Clinical, morphological and neurochemical correlations. Journal of Neurological Science. 20, (4), 415-455 (1973).
  11. Tieng, V., et al. Engineering of midbrain organoids containing long-lived dopaminergic neurons. Stem Cells and Development. 23, (13), 1535-1547 (2014).
  12. Chen, C. S. 3D Biomimetic Cultures: The Next Platform for Cell Biology. Trends in Cell Biology. 26, (11), 798-800 (2016).
  13. Friedl, P., Sahai, E., Weiss, S., Yamada, K. M. New dimensions in cell migration. Nature Reviews Molecular Cell Biology. 13, (11), 743-747 (2012).
  14. Byers, B., et al. SNCA triplication Parkinson's's patient's iPSC-derived DA neurons accumulate alpha-synuclein and are susceptible to oxidative stress. PLoS ONE. 6, (11), e26159 (2011).
  15. Flierl, A., et al. Higher vulnerability and stress sensitivity of neuronal precursor cells carrying an alpha-synuclein gene triplication. PLoS ONE. 9, (11), e112413 (2014).
Humane neurale Organoider til at studere hjernekræft og neurodegenerative sygdomme
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).More

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter