Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Bioengineering

Menselijke neurale Organoïden voor het bestuderen van hersenkanker en neurodegeneratieve ziekten

doi: 10.3791/59682 Published: June 28, 2019
* These authors contributed equally

Summary

Deze studie introduceert en beschrijft protocollen voor het afleiden van twee specifieke menselijke neurale organoïden als een relevant en nauwkeurig model voor het bestuderen van 1) menselijke multiform glioblastoom ontwikkeling binnen menselijke neurale organoïden uitsluitend bij de mens en 2) neuron Dopaminerge differentiatie die een driedimensionale organoïde genereert.

Abstract

Het ontbreken van relevante in vitro neurale modellen is een belangrijk obstakel voor medische vooruitgang voor neuro pathologieën. De oprichting van relevante cellulaire modellen is van cruciaal belang om de pathologische mechanismen van deze ziekten beter te begrijpen en nieuwe therapeutische doelen en strategieën te identificeren. Om relevant te zijn, moet een in vitro model de pathologische kenmerken van een menselijke ziekte reproduceren. Echter, in de context van neurodegeneratieve ziekte, een relevante in vitro model moet voorzien neurale cel vervanging als een waardevolle therapeutische kans.

Een dergelijk model zou niet alleen de screening van therapeutische moleculen mogelijk maken, maar kan ook worden gebruikt om de neurale protocol differentiatie te optimaliseren [bijvoorbeeld in de context van transplantatie bij de ziekte van Parkinson (PD)]. Deze studie beschrijft twee in vitro protocollen van 1) menselijke multiform glioblastoom ontwikkeling binnen een menselijke neurale organoïden (no) en 2) neuron Dopaminerge (da) differentiatie genereren van een driedimensionale (3D) organoid. Hiertoe werd een goed gestandaardiseerd protocol vastgesteld dat de productie van maat-gekalibreerde neuro sferen mogelijk maakt, afgeleid van de menselijke embryonale stamcel (hESC) differentiatie. Het eerste model kan worden gebruikt om moleculaire en cellulaire gebeurtenissen te onthullen die zich voordoen tijdens de ontwikkeling van multiform glioblastoom binnen de neurale organoïde, terwijl de da organoïde niet alleen een geschikte bron van da-neuronen voor celtherapie in de ziekte van Parkinson vertegenwoordigt, maar ook kan worden gebruikt voor het testen van geneesmiddelen.

Introduction

De World Health Organization (WHO) classificeert astrocytomen als lage graad (graad I tot II) of hoge graad (graad III en IV). Glioblastoma multiforme (GBM) is een astrocytoom grade IV, de meest dodelijke van primaire hersentumoren, die resistent is tegen alle huidige vormen van behandelingen1. Ondanks Standard-of-Care-therapie, waaronder Neurochirurgie, chemotherapie en radiotherapie, blijft GBM fataal en is de totale overlevings snelheid van 15 maanden niet drastisch veranderd in de afgelopen 15 jaar2. Om aanzienlijke vooruitgang te maken in het begrijpen van de pathogenese van GBM, is het gebruik van relevante modellen essentieel. Tot nu toe, de studie van GBM heeft vertrouwd op cellijnen, knaagdier organotypic plakjes, en xenotransplantatie van patiënt-afgeleide cellen in muizen of transgene muizen ontwikkelen spontane tumoren3,4. Hoewel deze modellen nuttig zijn voor het bestuderen van hersenmetastasen en tumor agressiviteit, ze worden beperkt door verschillen tussen soorten, en daaruit voortvloeiende conclusies kunnen onjuist worden vertaald naar menselijke weefsels. Bovendien, bestaande modellen met menselijke cellen worden ook beperkt door de afwezigheid van gastheer weefsel/tumor interacties3,4. Experimentele modellen zijn van cruciaal belang voor de vertaling van basiswetenschap naar therapeutische doelen. Daarom, het beschrijven van een protocol voor de productie in vitro menselijke neurale organoïden co-gekweekte met GBM-initiëren cellen (GICs) kan een relevant systeem dat de morfologische en functionele kenmerken van GBM ontwikkeling nabootst bieden. Dit systeem reproduceert sommige in vivo kenmerken van GBM developmentzoals diffuse migratie van binnenvallende cellen en necrose gebieden, en het markeert genexpressie relevant voor tumor biologie. Zoals eerder onthuld, worden sommige kritische microrna's geïnduceerd tijdens de GIC ontwikkeling binnen 3D zenuwweefsel5,6.

PD is een belangrijke neurodegeneratieve aandoening en geassocieerd met de degeneratie van meerdere neuronale subtypen7. Zelfs als een progressief begin van symptomen (bijv. bradykinesie, asymmetrische rust tremor, stijfheid en houdingsinstabiliteit) de ziekte karakteriseert, is de exacte etiologie niet duidelijk vastgesteld. Inderdaad, veel studies hebben aangetoond dat belangrijke risicofactoren kunnen voortvloeien uit een combinatie van genetische en omgevingsfactoren. Parkinsonische symptomen worden geassocieerd met de bilaterale degeneratie van Dopaminerge neuronen in de substancia nigra (SN), wat leidt tot het verdwijnen van Dopaminerge (da) axonen die projecteren naar het striatum8,9. Daarom is de reductie van striatale dopamine niveaus gecorreleerd met progressie van motorische disfunctie bij PD-patiënten. Dopaminerge neuronen bevatten Tyrosine hydroxylase (TH), een belangrijk enzym in de synthese van catecholaminerge neurotransmitters dat het aminozuur L-tyrosine converteert naar L-3, 4-dihydroxyphenylalanine (levodopa, een voorloper van dopamine) dopamine10. Vroegtijdig verlies van de activiteit gevolgd door een afname van de eiwit expressie is een kenmerk van PD.

Deze studie beschrijft twee protocollen met behulp van menselijke neurale organoïden, met een specifiek gericht op een midbrain-achtige fenotype verrijkt met TH-positieve cellen.

Protocol

Dit protocol volgt de richtlijnen van de ethische commissie ethiek van de Universiteit van Genève.

1. instandhouding en cultuur van ongedifferentieerde menselijke embryonale stamcellen (hESCs)

  1. Voer onderhoud en uitbreiding van hSECs uit op feeder-vrije condities door voorbekledings gerechten met een specifieke extracellulaire matrix.
    1. Ontdooi 300 μL extracellulaire matrix bij 4 °C (typische bereik concentratie 18-22 mg/mL, blijf op ijs) en meng zachtjes met 15 mL koud DMEM-medium om een voortijdige gelatie van de extracellulaire matrix te voorkomen. Voeg 7,5 ml extracellulaire Vochtspanningspotentiaal toe aan beide T150 kolven.
    2. Inbroed de met extracellulaire matrix gecoate gerechten bij 37 °C gedurende ten minste 1 uur (maximaal 's nachts).
    3. Verwijder het medium en de zaad hESCs tot een dichtheid van 6,5 x 104 cel/cm2.
  2. Handhaven H1 (hESC cellijn) in hESC medium en 1% penicilline/streptomycine.
  3. Geef de cellen een enzymatische procedure: Voeg 7,5 mL enzymatische oplossing toe aan een kolf van T75 cm2 over een periode van 1-2 min bij 37 °c. Zodra de cellen volledig zijn losgekoppeld, voegt u 7,5 mL DMEM-F12 toe en centrifugeer dan 5 min bij 300 x g. Om betere overleving mogelijk te maken, herplaat cellen op de gewenste dichtheid op extracellulaire matrix-gecoate gerechten, in hetzelfde medium met Rho-geassocieerde proteïne kinase (GESTEENTE) remmer (10 μM) voor 24 h.

2. door hESC afgeleide neurale organoïden voor GBM-studies

  1. 24 h voordat de 3D-cultuur wordt gestart, vervangt u het hESC-medium door een serumvrij medium, aangevuld met 10 μM-ROTSREMMER (beide componenten zijn noodzakelijk om de overleving van cellen en spontane neurosphere vorming te ondersteunen tijdens de aggregatie fase in een micro well plaat). De cellen moeten op 60% confluency staan. De volgende dag (dag 0), ontkoppel hESC-kolonies als enkelvoudige cellen: Verwijder het medium, spoel het vervolgens af met PBS zonder CA2 +/mg2 +, voeg 5 ml enzymatische oplossing toe en inincuberen bij 37 °c gedurende 1-2 minuten.
  2. Verzamel de cellen in serumvrij medium met 10 μM ROTSREMMER en centrifugeer de cellen bij 300 x g gedurende 5 minuten. Verwijder de supernatant en Tel de cellen in 10 ml serumvrij medium aangevuld met 10 μM rotsremmer.
  3. In parallel, spoel de titer plaat met 2 ml serumvrij medium per goed en centrifugeer de plaat bij 1200 x g gedurende 5 minuten om alle bubbels te verwijderen, wat neurosphere vorming kan voorkomen.
  4. Bereid 28,2 x 106 cellen in 12,5 ml serumvrij medium aangevuld met 10 μM rotsremmer. Doseer 1000 cellen/microwell. Centrifugeer de cellen gedurende 5 minuten bij 300 x g en plaats de plaat in de incubator bij 37 °c 's nachts (maximaal 36 uur). Bijvoorbeeld: voor het verkrijgen van 30 menselijke neurale organoïden, gebruik een T150 kolf bij 70%-80% van de samenvloeiing (over 30.000.000 cellen).
  5. De volgende dag (dag 1), verzamel de bollen (met een P1000) en plaats ze in een 6 goed bord. In elk goed, voeg 2 mL B27 medium en DMEM-F12 GlutaMAX en Neurobasal medium (mengen op 1:1), aangevuld met 1% B27 supplementen en 1% niet-essentiële aminozuren (NEAA). Ter bevordering van snelle neurale inductie, aanvulling op het medium met Dual-SMAD remming cocktail, samengesteld uit 10 μM TGFβ/Activin/nodal inhibitor en 0,5 μM bot morfogenic eiwit (BMP) inhibitor. Vanaf deze stap voorwaarts worden de bollen gecultiveerde in rotatie (60 rpm, orbitaal Shaker). De rotatie is van cruciaal belang om te voorkomen dat de bollen aan elkaar kleven of aan de plaat.
  6. Verander het medium elke 2-3 dagen: buig de plaat en laat de bollen naar beneden vallen gedurende 5 minuten, verwijder de helft van het medium (2 mL) en voeg 2 mL vers B27 medium toe, aangevuld met groeifactoren en remmers. De bollen niet centrifugeren.
  7. Voer neurale inductie uit volgens de volgende tijdsduur:
    1. Van dagen 1-4, cultuur de bollen in B27 medium aangevuld met Dual-SMAD. De Dual-SMAD remmings cocktail (10 μM TGFβ/Activin/nodal inhibitor en 0,5 μM BMP-remmer) bevordert de neurale inductie.
    2. Vanaf dagen 4-11, bevordering van proliferatie van hESC-afgeleide neurale rozetten (in de bollen), door toevoeging van 10 ng/mL epidermale groeifactor (EGF) en 10 ng/mL basis fibroblast factor (bFGF) aan de B27 medium aangevuld met Dual-SMAD cocktail.
      Opmerking: op dag 11 moeten de meeste cellen positief zijn voor Nestin.
    3. Van dagen 11-13, cultuur de bollen in B27 medium aangevuld met 0,5 μM BMP-remmer.
    4. Van dagen 13-21, cultuur de bollen in B27 medium aangevuld met 10 ng/mL gliacellen afgeleide neurotrophic factor (GDNF), 10 ng/mL hersenen afgeleide neurotrophic factor (BDNF) en 1 μM van γ-secretase remmer. GDNF en BDNF bevorderen neuronale en gliacellen differentiatie. De γ-secretase remmer zorgt voor een grotere neurale rijping.
    5. Op dag 21, plaat de bollen (over 1.000 bollen) op een hydrofiele polytetrafluorethyleen (PTFE) membraan (6 mm diameter, 0,4 μm) afgezet op een kweek plaat insert ontworpen voor 6 goed plaat. Stop de rotatie van deze stap. De aanwezigheid van rozetten, waargenomen met een heldere-veld Microscoop, geven de initiatie van neurale differentiatie. De neurale rozetten kunnen worden waargenomen 2-3 dagen na het bekleden van bollen op het PTFE-membraan.
    6. Voeg 1 mL B27 medium toe, aangevuld met groeifactoren en remmers (zoals gevolgd) tot elke put onder het membraan inzetstuk, elke 2-3 dagen (meestal op maandag, woensdag en vrijdag), voor een volgende 3 weken van differentiatie.
    7. Vanaf dagen 21-25 cultiveer je menselijke neurale organoïden in hetzelfde neurale rijpings medium (cf. stap 2.7.4).
    8. Vanaf dagen 25-28, alleen complement B27 medium met 1 μM γ-secretase remmer.
    9. Vanaf dagen 28-39, stoppen met het toevoegen van de γ-secretase remmer en voortzetten van de menselijke neurale organoïde cultuur in B27 medium alleen.
      Opmerking: na 3 weken zijn neurale organoïden klaar voor gebruik voor GIC implantatie. Langs de neurale rijping, een afname van neurale onvolgroeide marker Nestin en verhoging van volwassen neurale markers β3-tubulin en GFAP werden waargenomen.

3. isolatie en teelt van glioblastoma-initiërende cellen (GICs)

  1. Isoleer GICs door een hoge graad humane GBM biopsie te fragmenteren. Breng het stuk tumor over in een bekerglas met 0,25% trypsine in 0,1 mM EDTA (4:1) en roer langzaam tot 37 °C gedurende 30-60 min (afhankelijk van de tumorgrootte).
  2. Plaat de gedissocieerde cellen in 75 cm2 weefselkweek kolven verguld bij 2500-5000 cellen per cm2 in GIC medium: DMEM/F-12 medium (1:1) met 1% N2, 1% B27 en 1% G5 supplementen (voor de gunst van GIC Survival), aangevuld met bFGF en EGF (beide op 10 ng/ml, ter bevordering van de stemdheid) en 1% van penicillaire/streptomycine.
  3. Zodra de GIC goed is opgebouwd en groeit, verwijdert u de N2-en G5-supplementen uit het GIC-medium.
  4. Op een dag voor het toevoegen van de cellen op de organoid, dissociëren de GICs en tellen ze.
  5. Spoel de titer plaat af met 2 ml GIC medium en centrifugeer de plaat op de maximumsnelheid om bubbels te verwijderen (1000 x g). Plaats de GICs op 1.000 cellen om één gliomasphere per microwell te verkrijgen. Inincuberen op 37 °C (figuur 1c). Deze stap is essentieel en zorgt voor goed gekalibreerde GICs (een voorbeeld van necrotische en over-sized GICs wordt weergegeven in Figuur 2a,C).
  6. Om te starten GBM invasie, voeg een gliomasphere bovenop het zenuwweefsel met een grote boring pipetpunt (Figuur 1f). Plaats de 6 goed plaat voorzichtig terug in de incubator.

4. hESC-afgeleide Dopaminerge organoïden voor PD-studies

  1. Dag 0: amplify hescs in 2D-cultuur tot 60% confluentie (dag 0), vervang vervolgens stamcel media die worden gebruikt om de pluripotentie-functies van hescs te behouden met een serumvrij medium. Start neurale inductie door het aanvullen van cultuurmedium met 0,5 μM BMP-remmer en 10 μM TGFβ/Activin/nodal inhibitor (Dual-SMAD-remmings cocktail), voeg vervolgens 10 μM-ROTSREMMER toe voor 24 uur om de overlevings snelheid van cellen tijdens de passage te verhogen.
  2. Dag 1: bereid de titer plaat met 2,5 ml per goed serumvrij medium aangevuld met 0,5 μM bmp-remmer, 10 μm tgfβ/activin/nodal inhibitor en 10 μm rotsremmer. Om cellen op te geven in de richting van het ventrale patroon van de neurale buis, voegt u 100 ng/mL Sonic Hedgehog (SHH), 100 ng/mL fibroblast growth factor 8 (FGF8) en 2 μM gladgestreende agonist toe. Centrifugeer de plaat (alleen met medium en zonder cellen) bij 1200 x g gedurende 5 minuten om luchtbellen uit de micro putten te verwijderen.
    1. Na 1 dag van neurale inductie in 2D, verwijder het medium en spoel snel met PBS zonder CA2 +/MgCl2 +. Dissociëren de kolonies in enkelvoudige cellen suspensie door toevoeging van 7,5 mL recombinant enzymatische oplossing in een kolf van T75 cm2 . Inbroed gedurende 2 minuten bij 37 °C en vul vervolgens aan met 7,5 mL DMEM-F12.
    2. Verzamel de celsuspensie en centrifugeer bij 300 x g gedurende 5 minuten. Verwijder de supernatant en Tel de cellen in hetzelfde medium dat wordt gebruikt om de titer plaat te bereiden.
    3. Pas het medium volume aan om een celsuspensie te verkrijgen waardoor neurosferen met 1000 cellen per titer kunnen worden verkregen (bijvoorbeeld, de titer Plate die hier wordt gebruikt bevat 4.700 micro putten per putje). Bereid dus 4.700.000 cellen in 2,5 mL medium en voeg het toe aan de vorige 2,5 mL medium die al in de plaat is geplaatst.
    4. Om de cellen correct te verdelen in elke micro well, schud de plaat zachtjes en centrifugeer de titer Plate 300 x g gedurende 5 min. inbroed de plaat bij 37 °c gedurende 24 uur om bollen te genereren.
  3. Dag 2: Spoel de micro putten zachtjes met het medium en Verzamel ze en breng de bollen over in een met een tissue behandeld 6-Wells bord. Vervang medium door Neurobasal medium aangevuld met 1% B27, 1x NEAA, 2 mM L-glutamine en 1% penicillaire/streptomycine. Bovendien, toevoegen regionalisatie factoren SHH, FGF8, gladgestreende agonist, en Dual-SMAD remming van kleine moleculen.
    1. Plaats bollen in rotatie bij 37 °C (60 rpm, orbitaal Shaker) en verander half-medium vers aangevuld elke 2-3 dagen.
  4. Dag 3: om de neurale inductie te verbeteren en om te zetten in neurale voorlopercellen met een veroorzaakt-identiteit, het medium aanvullen met 3 μM GSK-3β-remmer, die de Wnt/β-Bovenlijn in het traject activeert. Behoud de GSK-3β-remmer in het medium tot dag 13. Splitsen in twee nieuwe met weefsel behandelde 6-goed platen om beide boldichtheid per put te verminderen en Sphere Aggregation te vermijden.
    Opmerking: op dag 8 moeten de meeste cellen positief zijn voor Nestin.
  5. Dag 8: Start de neurale rijping: Vervang regionalisatie factoren SHH, FGF8, gladgestreende agonist en Dual-SMAD remmings cocktail met 0,5 mM dibutyryl cAMP (om rijping te gunst), 20 nM remmer van histon deacetylase (voor celcyclus uitgang), 1 μM γ-secretase remmer en groeifactoren, 10 ng/mL GDNF, 10 ng/mL BDNF, 1 ng/mL transformerende groeifactor β3 (TGFβ3), en 5 ng/mL FGF20 (beide gunst DA voorlopercellen overleven). Verander het medium elke 2-3 dagen.
  6. Dag 21: genereren van de neurale organoid: zaad rond 100 neurosferen onder lucht-vloeistof interface voorwaarden op PTFE-membraan (diameter 6 mm). Breng het membraan over naar een kweek plaat insert (0,4 mm) en voeg 1,2 mL van het neurale rijpings medium toe dat wordt gebruikt voor neurosphere-differentiatie zoals eerder beschreven.
    1. Stop de rotatie van deze stap. Verander het medium elke 2-3 dagen tot het vereiste tijdpunt voor differentiatie is bereikt.
      Opmerking: met betrekking tot neurale rijping, een afname van de neurale onvolgroeide marker Nestin en verhoging van volwassen neurale markers β3-tubulin en GFAP werden waargenomen. Hoge TH-en NURR1-uitdrukkingen werden waargenomen (figuur 3c) en bevestigen neurale organoïde maturiteit11.

5. kwantificering van de e-en Nurr1-genexpressie voor de validering van Dopaminerge differentiatie

  1. RNA-extractie: op de aangegeven dag van differentiatie, lyse 40 neurosferen met 350 μL RLT buffer (geleverd in RNA extraction Kit) aangevuld met 3,5 μL 2-mercaptoethanol. Extract het RNA van de gelyseerd neuro sferen met behulp van een RNA extraction Kit volgens de instructies van de fabrikant.
  2. Totale RNA-concentraties kwantificeren.
  3. Voer reverse transcriptie uit van 300 ng van de totale RNA-extractie met reverse transcriptie Kit voor kwantitatieve real-time polymerase kettingreactie (qPCR) en volg de instructies van de fabrikant.
  4. Voer qPCR-analyse uit op real-time PCR-detectiesystemen, gebaseerd op asymmetrische detectie van cyanine Dye. Normaliseer de gegevens met huishoudelijk genen: Glyceraldehyde-3-fosfaat dehydrogenase (GAPDH) en rek factor 1-alpha (EF1). Sequenties van primers worden beschreven in tabel 1.

6. hogedrukvloeistof chromatografie (HPLC) detectie

  1. Gebruik hogedrukvloeistofchromatografie (HPLC) met elektrochemische detectie om de aanwezigheid van dopamine te detecteren. Dopamine werd geëxtraheerd door het lyserende neurale organoïden in 100 ml 0,1 N perchloorzuur (HClO4) gedurende 15 minuten bij 4 °c met een krachtige grondig elke 5 min. Na centrifugeren, verzamelen en opslaan van de supernatant bij-20 °C voor dopamine dosering.
  2. Gebruik een C-18-kolom (5 μm, 4,6 mm x 150 mm) om de analyten te scheiden door omgekeerde fase HPLC in de isocratische modus met een debiet van 1 mL/minuut. Detectie van dopamine moet worden uitgevoerd met behulp van een coulometrische detector met de conditionerings-cel ingesteld op een potentiaal van + 200 mV.

7. RAW data Recording met microelectode array (MEA) platform

  1. Gebruik een dissectie-Microscoop om neuro sferen over te brengen naar het midden van een poreus MEA-apparaat.
  2. Gebruik een versterker en data-acquisitie systeem voor elektrofysiologische opnames. Meet de signaal-ruis verhouding (SRV) als de standaarddeviatie van de spanning tijdens een opname van 5 min, waarbij het signaal wordt gebruikt als de gemiddelde piek-naar-piekspanning van de pieken die in dezelfde 5 min perioden zijn geregistreerd.

Representative Results

De kritieke stappen van dit protocol moeten goed worden geïdentificeerd en correct worden afgehandeld. Daarom wordt een diagram van cultuuromstandigheden die de time-lapse voor elke stap en de verbindingen die voor het differentiatie protocol worden gebruikt, geïllustreerd in Figuur 1a en Figuur 3a voor respectievelijk no plus GBM en da neurale organoïden. Figuur 1b, C, D, E, F illustreert de cellen, bollen en Nee en toont de typische morfologie voor elke stap. Figuur 1g, H, ik illustreert immunofluorescentie kleuring met sommige neurale markers.

Figure 1
Figuur 1 : Menselijke neurale organoïde (no) differentiatie protocol. A) gestandaardiseerd protocol voor het genereren van niet-afgeleide menselijke stamcellen (hesc). B) hescs worden gehandhaafd op extracellulaire matrix in hesc-medium. C) micro well-platen werden gebruikt om gekalibreerde neuro sferen te genereren. Na 2 weken werden er neurosferen geplateerd op de wisselplaat met een PTFE-membraan (schaalbalk = 50 μm). D) macroscopische weergave van Nee in de wisselplaat in één put van een 6-put. Tijdens de eerste dagen werden rozetten waargenomen (zwarte pijl) (E). F) macroscopische weergave van een no-plus GIC-bol op de top. (G-I) Immunofluorescentie analyse van NO plus GIC Sphere (EGFR-positief; schaalbalk = 50 μm) (G) en niet alleen, die toonde Immuunreactiviteit voor de neuronale marker βiii-tubulin en enigszins positief voor nestin; echter, synapsin 1 toonde een zwak signaal (H, I) (scale bars = 100 μm en 50 μm, respectievelijk). Klik hier om een grotere versie van dit cijfer te bekijken. 

Figure 2
Figuur 2 : Illustratie van necrotische bollen en onvolgroeide No. De neuro sferen (a) en No (B) kunnen necrose ondergaan wanneer ze te talrijk zijn in de put of oversized (C) (schaalbalk = 10 μm). D) een GIC geïnfecteerd met een tomaten reporter helpt bij het opsporen van tumor CELINVASIE in no, Scale Bar, 10 μm. voorbeeld van ONVOLGROEIDE Nee met neurale buisjes (E) en geen neurale buisjes (F) (schaalbalk = 50 μm). Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3 : Gestandaardiseerd protocol voor het genereren van de da neurale organoïde en elektrofysiologische en morfologische analyse. A) gestandaardiseerd protocol voor de opwekking van da neurale organoïden. B) immunofluorescentie analyse van da neurale organoïde; TH-immunoreactieve cellen die co-expressie Nurr1, een veroorzaakt specifieke marker (schaal Bar = 50 μm). De gegevens worden weergegeven als gemiddelde ± SEM (n = 3). C) grafieken vertegenwoordigen kinetiek van de e-en Nurr1 genexpressie geëvalueerd door QRT-PCR. (D) representatieve HPLC: dopamine piek (pijl) werd gedetecteerd door HPLC van da neurale organoïde lysaat. (E) voorbeeld van onbewerkte gegevens die met mea platform zijn geregistreerd. Elke piek wordt weergegeven door een verticale lijn (tijdstempels), terwijl de resterende Trace ruis is. F) beeld van een neurosphere die op de mea is afgezet. G) superpositie van typische pieken (blauwe en rode curven) gedetecteerd uit de onbewerkte gegevens. De zwarte vetgedrukte curve geeft het gemiddelde van de corresponderende rode curven aan. (H) raster plot met de tijdstempels die zijn gekoppeld aan elke gevonden piek. De verschillende kleuren markeren de verschillende elektroden. Klik hier om een grotere versie van dit cijfer te bekijken. 

Gen Door Omgekeerde
Nurr1 GGCTGAAGCCATGCCTTGT EEN van de meest GEDINDE
Th GCACCTTCGCGCAGTTCT EEN van de meest GEKKEN
EEF1 GEASPTE, Nederland GCCTGGATGGTTCAGGATA
GAPDH GCACAAGAGGAAAGAGAGAGAACC AGGGGAGATTCAGTGTGGGT

Tabel 1: primers die in dit protocol worden gebruikt.

Discussion

Een van de meest kritische aspecten van dit protocol omvat het onderhoud van hESC pluripotentie tijdens celculturing en nauwste monitoring van de bollen en neurale organoïde morfologie. hESCs zijn zeer gevoelig en elke manipulatie kan leiden tot vroegtijdige ongecontroleerde differentiatie en celdood. Om de experimentele reproduceerbaarheid te verhogen en het optreden van abnormale karyotype-gebeurtenissen te voorkomen, wordt het aangeraden om meerdere batches van hescs bij de laagste passage te invriezen na validatie van hun chromosoom stabiliteit. Bovendien wordt aanbevolen om voor elk experiment een nieuwe injectieflacon te ontdooien en het gedrag van de cellen elke dag te controleren. Als de bollen minder refractieve met abnormale hogere grootte, zullen ze waarschijnlijk beginnen te aggregeren en sterven.

Een verbetering op dit systeem is ofwel perfusie of het implementeren van een gevasculariseerde systeem (door toevoeging van endotheliale cellen of binnen een 3D fluidic microchip)12,13. Echter, het beheersen van de dikte van de neurale organoïde (≤ 300 μm) maakt efficiënte passieve perfusie van zuurstof en voedingsstoffen mogelijk en voorkomt necrose. Een andere verbetering is de introductie van immuuncellen (Microglia). Met deze beperkingen in het achterhoofd, neurale organoïden plus een GIC systeem kan een relevant instrument om verschillende redenen. Ten eerste, dit systeem maakt het mogelijk drug screening om te controleren hoe een therapeutische verbinding kan invloed hebben op een organoïde of tumor cel. Tweede, cel-naar-cel interacties kunnen worden bestudeerd, en micro-milieu determinanten onderliggende individuele en collectieve invasies kunnen worden gevisualiseerd en verkend5,6,13.

In het kader van de ziekte van Parkinson kan een neurale organoïde verrijkt in DA-neuronen een relevant en nauwkeurig 3D-model vormen om de ontwikkeling van de ziekte te bestuderen. In eerdere studies, Parkinson door de patiënt afgeleide geïnduceerde pluripotente stamcellen gedifferentieerd naar DA neuronen zijn gebruikt voor het bestuderen van de getroffen neuronale subtypes. Van noot, sommige ziektegerelateerde fenotypes zoals de accumulatie van α-synuclein en gevoeligheid voor oxidatieve stress zijn waargenomen14,15. Bovendien, de neurale organoïde kan worden gebruikt als een instrument om therapeutische moleculen te schermen. Echter, specifieke en relevante uitlezingen moeten worden ingesteld om te evalueren van de overleving en functionaliteit van DA neuron, zoals dopamine productie en elektrofysiologische activiteit. In totaal, dit protocol biedt twee gestandaardiseerde en nauwkeurige stamcel gebaseerde benaderingen voor het genereren van neurale organoïden.

Disclosures

De auteurs verklaren geen concurrerende financiële belangen.

Acknowledgments

De auteurs bedanken la Ligue Genevoise contre le Cancer (Genève, Zwitserland), ISREC Foundation (Lausanne, Zwitserland), en de Clayton Foundation for Research (Houston, TX, USA) voor financiële ondersteuning. Bovendien danken de auteurs HES-HO en het Wyss Center voor financiële steun. We bedanken het lab van Krause voor nuttige discussies en ondersteuning en Dr. Halah Kutaish voor proeflezen.

Materials

Name Company Catalog Number Comments
6-well plate (6-well plate) Falcon / Corning 07-201-588
ABI Prism 7900 HT detection system  (Real-Time PCR detection systems) Applied Biosystems Discontinued
Aggrewell 400 (Microwell culture plates ) StemCell Technologies 34421
Amplifier (W2100-HS32)  (Amplifier) Multi Channel Systems
Anti-EGFR (phospho Y1101) antibody Abcam ab76195 1/100 dilution
Anti-GFAP Antibody Dako  Z334  1/1000 dilution
Anti-Nestin, Human Antibody Millipore  ABD69  1/400 dilution
Anti-Synapsin I Antibody Chemicon  AB1543P  1/500 dilution
B27 supplements (B27) Life Technologies / Invitrogen 1238 For both protocol, stock solution 100x, final solution 1x
Brain-derived neurotrophic factor  (BDNF) Cell Guidance GFH1-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
CHIR-99021 (GSK-3β inhibitor ) Axon Medchem ct99021 For Dopaminergic protocol,  stock solution 7.5 mM in DMSO, final solution 3 µM
Compound E a γ–secretase inhibitor (γ–secretase inhibitor) Calbiochem CAS 209986-17-4 For both protocol (gamma-secretase inhibitor XXI),  stock solution 5 mM in DMSO, final solution 1 µM
Coulochem III  (Coulometric detector parameters) Thermo scientific
Dibutyryl cyclic-AMP (Dibutyryl cAMP) Sigma D0627 For Dopaminergic protocol,  stock solution 0.5 M in DMSO, final solution 0.5 mM
Dimethyl Sulfoxide Pure (DMSO) Sigma-Aldrich C6164 Compounds solvent, ready to use
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 12491-015 For cell culture, ready to use
Dulbecco's Modified Eagle Medium Mixture F-12 (DMEM-F12) Gibco 11320033 For cell culture, ready to use
EDTA 0.1 mM (EDTA) Life Technologies AM9912 For cell culture, ready to use
Epidermal Growth Factor (EGF) Gibco PHG0313 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
Fibroblast Growth Factor 20 (FGF20) Peprotech 100-41 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 5 ng/mL
fibroblast growth factor 8  (FGF8) Peprotech GFH176-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
Fibroblast growth factor-basic (bFGF) Gibco PHG0024 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
G5 supplements (G5) Invitrogen 17503012 For GIC culture, stock solution 100x, final solution 1x
Glial cell-derived neurotrophic factor (GDNF) Cell Guidance GFH2-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
Hydrophilic polytetrafluoroethylene  membrane (PTFE membrane) BioCell-Interface Discontinued
LDN-193189 (BMP inhibitor) Axon Medchem /Stemgen 04-0072-02 /1509 Dual/Smad,  stock solution 5 mM in DMSO, final solution 0.5 µM
L-glutamine (L-glutamine) Gibco 25030081 L-Glutamine (200 mM), stock solution 200 mM, final solution 2 mM
Matrigel (extracellular matrix) BD Biosciences 354277 hESC-qualified Matrix, stock solution 18-22 mg/mL, final solution 180-220 µg/mL
Millicell-CM Culture plate insert  (0.4 µm) (Culture plate insert) Millipore PICM03050
Monoclonal Anti-β-Tubulin III antibody Sigma  T8660  1/1000 dilution
MS Orbital Shaker, MS-NOR-30 (Orbital shaker) Major Science MS-NRC-30
N2 supplements (N2) Invitrogen 17502-048 For GIC culture, stock solution 100x, final solution 1x
Nanodrop (Nanodrop) Thermo Fisher Scientific Discontinued
Neurobasal (Neurobasal) Life Technologies / Gibco 21103049 Maintenance and maturation embryonic neuronal cell populations , ready to use
Non-Essential Amino Acids  (NEAA) Gibco 11140 Non-essential Amino Acids 100X, stock solution 100x, final solution 1x
Nurr1 Antibody (M-196) Santa Cruz Sc-5568 1/100 dilution
Nutristem  (hESC medium ) Biological Industries 05-100-1A Stem cell media, ready to use
Penicilin / Streptomycin  (Penicilin / Streptomycin ) Life Technologies / Gibco 15140122 For cell culture, stock solution 5 mg/mL, final solution 50 µg/mL 
Perchloric acid 0.1N (HCLO4) Merck 100519 For HPLC, ready to use
Phosphate Buffered Saline without Ca2+/Mg2+  (PBS without Ca2+/Mg2+ ) Life Technologies 14190250 For cell culture, ready to use
PrimeScript RT-PCR Kit (Reverse transcription kit) Takara RR014A
Purmorphamin (smoothened agonist) Calbiochem SML0868 For Dopaminergic protocol,  stock solution 10 mM in DMSO, final solution 2 µM
Rho-associated Kinase Y-27632 (ROCK) Abcam Biochemicals ab120129-1 Rock Inhibitor,  stock solution 50 mM in DMSO, final solution 10 µM
RNeasy mini kit (RNA extraction kit ) Qiagen 74104
SB-431542 (TGFβ/Activin/Nodal inhibitor ) Ascent Asc- 163 Dual-Smad,  stock solution 50 mM in DMSO, final solution 10 µM
Sonic Hedgehog (SHH) Cell Guidance GFH168-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
StemPro Accutase (hESC enzymatic solution) Gibco A11105-01 hESC enzymatic solution, ready to use
Symmetry C-18,5 mm (4.6 150mm2)  (Reversed-phase column) Waters Corporation
T150 flask (T150 flask) Falcon 08-772-1F
TH Antibody (F-11) Santa Cruz Sc-25269 1/200 dilution
Transforming Growth Factors beta 3 (TGFβ3) Cell Guidance GFH109-2 For Dopaminergic protocol,  stock solution 100 µg/mL in pure ethanol , final solution 1 ng/mL
Trichostatine A (inhibitor of histone deacetylase ) Sigma T8552 For Dopaminergic protocol,  stock solution 100 µM in DMSO, final solution 20 nM
TrypLE (recombinant enzymatic solution) Invitrogen 12604021 recombinant enzymatic solution, ready to use
Trypsin 0.25% (enzymatic solution) Life Technologies 15050065 enzymatic solution, ready to use
W2100, Multi Channel Systems (Data acquisition system ) WAT045905
X-vivo (serum free medium) Lonza BE04-743Q serum free medium, ready to use

DOWNLOAD MATERIALS LIST

References

  1. Louis, D. N., et al. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary. Acta Neuropathologica. 131, (6), 803-820 (2016).
  2. Stupp, R., et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. New England Journal of Medicine. 352, (10), 987-996 (2005).
  3. Daphu, I., et al. In vivo animal models for studying brain metastasis: value and limitations. Clinical and Experimental Metastasis. 30, (5), 695-710 (2013).
  4. Huszthy, P. C., et al. In vivo models of primary brain tumors: pitfalls and perspectives. Neuro Oncology. 14, (8), 979-993 (2012).
  5. Nayernia, Z., et al. The relationship between brain tumor cell invasion of engineered neural tissues and in vivo features of glioblastoma. Biomaterials. 34, (33), 8279-8290 (2013).
  6. Cosset, E., et al. Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials. 107, 74-87 (2016).
  7. Pringsheim, T., Jette, N., Frolkis, A., Steeves, T. D. The prevalence of Parkinson's's disease: a systematic review and meta-analysis. Movement Disorders. 29, (13), 1583-1590 (2014).
  8. Rajput, A. H., et al. Globus pallidus dopamine and Parkinson's motor subtypes: clinical and brain biochemical correlation. Neurology. 70, (16 Pt 2), 1403-1410 (2008).
  9. Jellinger, K. A. Pathology of Parkinson's's disease. Changes other than the nigrostriatal pathway. Molecular and Chemical Neuropathology. 14, (3), 153-197 (1991).
  10. Bernheimer, H., Birkmayer, W., Hornykiewicz, O., Jellinger, K., Seitelberger, F. Brain dopamine and the syndromes of Parkinson’s and Huntington. Clinical, morphological and neurochemical correlations. Journal of Neurological Science. 20, (4), 415-455 (1973).
  11. Tieng, V., et al. Engineering of midbrain organoids containing long-lived dopaminergic neurons. Stem Cells and Development. 23, (13), 1535-1547 (2014).
  12. Chen, C. S. 3D Biomimetic Cultures: The Next Platform for Cell Biology. Trends in Cell Biology. 26, (11), 798-800 (2016).
  13. Friedl, P., Sahai, E., Weiss, S., Yamada, K. M. New dimensions in cell migration. Nature Reviews Molecular Cell Biology. 13, (11), 743-747 (2012).
  14. Byers, B., et al. SNCA triplication Parkinson's's patient's iPSC-derived DA neurons accumulate alpha-synuclein and are susceptible to oxidative stress. PLoS ONE. 6, (11), e26159 (2011).
  15. Flierl, A., et al. Higher vulnerability and stress sensitivity of neuronal precursor cells carrying an alpha-synuclein gene triplication. PLoS ONE. 9, (11), e112413 (2014).
Menselijke neurale Organoïden voor het bestuderen van hersenkanker en neurodegeneratieve ziekten
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).More

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter