Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Bioengineering

Organoïdes neuronaux humains pour étudier le cancer du cerveau et les maladies neurodégénératives

doi: 10.3791/59682 Published: June 28, 2019
* These authors contributed equally

Summary

Cette étude introduit et décrit des protocoles pour dériver deux organoïdes neuronaux humains spécifiques comme modèle pertinent et précis pour étudier 1) le développement humain de glioblastoma dans les organoïdes neuronaux humains exclusivement chez l'homme et 2) dopaminergique neuronal différenciation générant un organoïde tridimensionnel.

Abstract

L'absence de modèles neuronaux in vitro pertinents est un obstacle important sur le progrès médical pour les neuropathologies. L'établissement de modèles cellulaires pertinents est crucial à la fois pour mieux comprendre les mécanismes pathologiques de ces maladies et identifier de nouvelles cibles et stratégies thérapeutiques. Pour être pertinent, un modèle in vitro doit reproduire les caractéristiques pathologiques d'une maladie humaine. Cependant, dans le contexte de la maladie neurodégénérative, un modèle in vitro pertinent devrait fournir le remplacement de cellules neurales comme occasion thérapeutique valable.

Un tel modèle permettrait non seulement le dépistage des molécules thérapeutiques, mais pourrait également être utilisé pour optimiser la différenciation du protocole neuronal [par exemple, dans le contexte de la transplantation dans la maladie de Parkinson (PD)]. Cette étude décrit deux protocoles in vitro de 1) développement humain de glioblastoma dans un organoïde neural humain (NO) et 2) la différenciation dopaminergique de neurone (DA) générant un organoïde tridimensionnel (3D). À cette fin, un protocole bien normalisé a été établi qui permet la production de neurosphères calibrées de taille dérivées de la différenciation des cellules souches embryonnaires humaines (HESC). Le premier modèle peut être utilisé pour révéler les événements moléculaires et cellulaires se produisant pendant le développement du glioblastome dans l'organoïde neural, tandis que l'organoïde DA représente non seulement une source appropriée de neurones DA pour la thérapie cellulaire dans la maladie de Parkinson, mais peut également être utilisé pour le dépistage des drogues.

Introduction

L'Organisation mondiale de la Santé (OMS) classe les astrocytomes comme de faible grade (catégorie I à II) ou de qualité supérieure (catégorie III et IV). Glioblastoma multiforme (GBM) est un astrocytoma de grade IV, le plus mortel des tumeurs cérébrales primaires, qui est résistant à toutes les formes actuelles de traitements1. Malgré la thérapie de standard de soins, y compris la neurochirurgie, la chimiothérapie et la radiothérapie, la GBM demeure fatale et le taux de survie global sur 15 mois n'a pas changé de façon spectaculaire au cours des 15 dernières années2. Pour faire des progrès significatifs dans la compréhension de la pathogénie GBM, l'utilisation de modèles pertinents est la clé. Jusqu'à présent, l'étude de GBM s'est appuyée sur des lignées cellulaires, des tranches organotypiques de rongeurs, et la xénotransplantation de cellules dérivées du patient chez des souris ou des souris transgéniques développant des tumeurs spontanées3,4. Bien que ces modèles aient été utiles pour étudier la métastes de cerveau et l'agressivité de tumeur, ils sont limités par des différences entre les espèces, et les conclusions résultantes peuvent être incorrectement traduites aux tissus humains. En outre, les modèles existants avec des cellules humaines sont également limités par l'absence d'interactions tissulaire/tumeurhôte 3,4. Les modèles expérimentaux sont essentiels pour la traduction de la science fondamentale vers des cibles thérapeutiques. Par conséquent, la description d'un protocole pour produire des organoïdes neuronaux humains in vitro co-cultivés avec des cellules initiatrices de GBM (GIC) peut fournir un système pertinent qui imite les caractéristiques morphologiques et fonctionnelles du développement de GBM. Ce système reproduit certaines caractéristiques in vivo du développement de GBM telles que la migration diffuse des cellules envahissantes et des secteurs de nécrose, et il accentue l'expression de gène pertinente à la biologie de tumeur. Comme indiqué précédemment, quelques microARN critiques sont induits pendant le développement de GIC dans le tissu nerveux 3D5,6.

La est un trouble neurodégénératif majeur et associée à la dégénérescence de multiples sous-types neuronaux7. Même si un surset progressif des symptômes (par exemple, bradykinésie, tremblement de repos asymétrique, rigidité et instabilité de la posture) caractérise la maladie, son étiologie exacte n'est pas clairement établie. En effet, de nombreuses études ont mis en évidence des preuves que les principaux facteurs de risque peuvent résulter d'une combinaison de facteurs génétiques et environnementaux. Les symptômes parkinsoniens sont associés à la dégénérescence bilatérale des neurones dopaminergiques dans le nigra substancia (SN), conduisant à la disparition des axones dopaminergiques (DA) se projetant au striatum8,9. Par conséquent, la réduction des niveaux striatal de dopamine est corrélée avec la progression du dysfonctionnement moteur dans des patients de. Les neurones dopaminergiques contiennent de la tyrosine hydroxylase (TH), une enzyme clé dans la synthèse des neurotransmetteurs catécholaminergiques qui convertit l'acide aminé L-tyrosine en L-3,4-dihydroxyphenylalanine (L-DOPA, un précurseur de la dopamine) à la dopamine10. La perte précoce de l'activité de TH suivie d'une baisse de l'expression de protéine de TH est une marque de.

Cette étude décrit deux protocoles utilisant des organoïdes neuronaux humains, avec un spécifiquement orienté vers un phénotype mi-cerveau-comme enrichi avec des cellules TH-positives.

Protocol

Ce protocole suit les directives du comité d'éthique de la recherche humaine de l'Université de Genève.

1. Entretien et culture de cellules souches embryonnaires humaines indifférenciées (HESC)

  1. Effectuer l'entretien et l'expansion des HSEC dans des conditions sans mangeoire en pré-enrobant les plats avec une matrice extracellulaire spécifique.
    1. Décongeler 300 oL de matrice extracellulaire à 4 oC (concentration de portée typique 18-22 mg/mL, garder sur la glace) et mélanger délicatement avec 15 ml de milieu DMEM froid pour éviter une gélation prématurée de la matrice extracellulaire. Ajouter 7,5 ml du matrique extracellulaire aux deux flacons T150.
    2. Incuber les plats recouverts d'une matrice extracellulaire à 37 oC pendant au moins 1 h (maximum pendant la nuit).
    3. Enlever le milieu et les hESC sémineux à une densité de 6,5 x 104 cellules/cm2.
  2. Maintenir H1 (ligne cellulaire hESC) dans le milieu hESC et 1% pénicilline/streptomycine.
  3. Passer les cellules avec une procédure enzymatique: ajouter 7,5 ml de solution enzymatique à un flacon T75 cm2 sur une période de 1-2 min à 37 oC. Une fois les cellules complètement détachées, ajouter 7,5 ml de DMEM-F12, puis centrifugeuse pendant 5 min à 300 x g. Pour permettre une meilleure survie, re-plaquer les cellules à la densité désirée sur des plats extracellulaires recouverts de matrice, dans le même milieu contenant l'inhibiteur de la kinase protéine Rho-associée (ROCK) (10 'M) pendant 24 h.

2. organoïdes neuronaux dérivés du hESC pour les études sur la GBM

  1. 24 h avant de commencer la culture 3D, remplacer le milieu hESC par un milieu sans sérum complété par un inhibiteur de 10 M ROCK (les deux composants sont nécessaires pour soutenir la survie cellulaire et la formation spontanée de neurosphère pendant la phase d'agrégation dans un micropuits plaque). Les cellules doivent être à 60% de confluence. Le lendemain (jour 0), détachez les colonies de hESC en cellules simples : retirez le milieu, puis rincez avec du PBS sans Ca2/Mg2,ajoutez 5 mL de solution de dissolution enzymatique, et incubez à 37 oC pendant 1-2 min.
  2. Recueillir les cellules dans un milieu sans sérum avec 10 Md d'inhibiteur ROCK et centrifuger les cellules à 300 x g pendant 5 min. Enlevez le supernatant et comptez les cellules dans 10 ml de milieu sans sérum complété par 10 m d'inhibiteur ROCK.
  3. En parallèle, rincer la plaque de micropuits avec 2 ml de milieu sans sérum par puits et centrifuger la plaque à 1200 x g pendant 5 min pour enlever toutes les bulles, ce qui peut empêcher la formation de neurosphère.
  4. Préparer 28,2 x 106 de cellules dans 12,5 ml de milieu sans sérum complété par un inhibiteur de 10 M ROCK. Distribuer 1000 cellules/micropuits. Centrifuger les cellules à 300 x g pendant 5 min et placer la plaque dans l'incubateur à 37 oC pendant la nuit (maximum 36 h). Par exemple : pour obtenir 30 organoïdes neuronaux humains, utilisez un flacon T150 à 70 % à 80 % de la confluence (environ 30 millions de cellules).
  5. Le lendemain (jour 1), collectez les sphères (avec un P1000) et placez-les dans une plaque de 6 puits. Dans chaque puits, ajouter 2 ml de milieu B27 et d'acide GlutaMAX et Neurobasal (mélange à 1:1), complété par 1 % de suppléments B27 et 1 % d'acides aminés non essentiels (NEAA). Pour favoriser l'induction neuronale rapide, complétez le milieu par un cocktail d'inhibition double-SMAD, composé d'un inhibiteur de 10 M TGGMD/Activin/Nodal et d'un inhibiteur de la protéine morphogène osseuse (BMP) de 0,5 M. A partir de ce pas en avant, les sphères sont cultivées en rotation (60 tr/min, shaker orbital). La rotation est essentielle pour empêcher les sphères de coller ensemble ou à la plaque.
  6. Changer le milieu tous les 2-3 jours: plier la plaque et laisser les sphères tomber pendant 5 min, enlever la moitié du milieu (2 ml), et ajouter 2 ml de B27 moyen frais complété par des facteurs de croissance et des inhibiteurs. Ne pas centrifuger les sphères.
  7. Effectuer l'induction neuronale selon le cours de temps suivant :
    1. Du jour 1-4, la culture des sphères dans Le milieu B27 complété par dual-SMAD. Le cocktail d'inhibition dual-SMAD (10 'M Inhibiteur TGF/Activin/Nodal et inhibiteur de 0,5 M BMP) favorise l'induction neuronale.
    2. Des jours 4-11, favorisez la prolifération des rosettes neurales hESC-dérivées (dans les sphères), en ajoutant le facteur épidermique de 10 ng/mL (EGF) et le facteur de fibroblaste de base de 10 ng/mL (bFGF) au milieu de B27 complété avec le cocktail dual-SMAD.
      REMARQUE : Le jour 11, la plupart des cellules devraient être positives pour Nestin.
    3. Du jour 11-13, la culture des sphères dans le milieu B27 complété par un inhibiteur de 0,5 M BMP.
    4. Des jours 13-21, culture les sphères dans le milieu de B27 complétés avec 10 ng/mL facteur neurotrophique dérivé de glial (GDNF), 10 ng/mL facteur neurotrophique dérivé de cerveau (BDNF) et 1 M m de l'inhibiteur de la sécréase. GDNF et BDNF favorisent la différenciation neuronale et gliale. L'inhibiteur de la sécrétase permet une plus grande maturation neuronale.
    5. Le jour 21, plaquer les sphères (environ 1 000 sphères) sur une membrane hydrophile de polytétrafluoroéthylène (PTFE) (6 mm de diamètre, 0,4 m) déposée sur un insert de plaque de culture conçu pour 6 plaques de puits. Arrêtez toute rotation à partir de cette étape. La présence de rosettes, observée avec un microscope lumineux, indique l'initiation de la différenciation neuronale. Les rosettes neurales peuvent être observées 2-3 jours après des sphères de placage sur la membrane de PTFE.
    6. Ajouter 1 ml de milieu B27 complété par des facteurs de croissance et des inhibiteurs (comme suit) à chaque puits sous l'insert de membrane, tous les 2-3 jours (généralement le lundi, le mercredi et le vendredi), pour les 3 semaines suivantes de différenciation.
    7. Des jours 21-25, cultivez les organoïdes neuronaux humains dans le même milieu de maturation neural (Cf. étape 2.7.4).
    8. Du 25 au 28 jours, ne compléter le milieu B27 qu'avec un inhibiteur de 1 M de sécrétase.
    9. À partir des jours 28-39, arrêtez d'ajouter l'inhibiteur de la sécrétase et continuez la culture d'organoïdes neuronaux humains dans le milieu B27 seulement.
      REMARQUE : Après 3 semaines, les organoïdes neuronaux sont prêts à l'emploi pour l'implantation de GIC. Le long de la maturation neurale, une diminution du marqueur immature neural Nestin et l'augmentation des marqueurs neuronaux mûrs -3-tubulin et GFAP ont été observées.

3. Isolement et culture des cellules initiatrices du glioblastome (CPG)

  1. Isolez les CPG en fragmentant une biopsie humaine de GBM de haute qualité. Transférer le morceau de tumeur dans un bécher contenant 0,25% de trypsine dans 0,1 mM EDTA (4:1) et remuer lentement à 37 oC pendant 30-60 min (selon la taille de la tumeur).
  2. Plaquer les cellules dissociées dans des flacons de culture tissulaire de 75 cm2 plaqués à 2 500 à 5 000 cellules par cm2 dans le milieu du GIC : milieu DMEM/F-12 (1:1) contenant 1 % De N2, 1 % De B27 et 1 % de suppléments G5 (pour favoriser la survie du GIC), complétés par bFGF et EGF (tous deux à 10 ng/Ml, pour favoriser la séminité) et 1% de pénicilline/streptomycine.
  3. Une fois que le CPG est bien établi et en croissance, retirer les suppléments N2 et G5 du milieu du CPG.
  4. Un jour avant d'ajouter les cellules sur l'organoïde, dissocier les CPG et les compter.
  5. Rincer la plaque micropuits avec 2 ml de milieu de GIC et centrifuger la plaque à la vitesse maximale pour enlever les bulles (1000 x g). Placez les CPG à 1 000 cellules pour obtenir une gliomasphère par micropuits. Incuber toute la nuit à 37 oC (figure1C). Cette étape est essentielle et permet des CPG bien calibrés (un exemple de CPG nécrotiques et surdimensionnés est montré dans la figure 2A,C).
  6. Pour initier l'invasion de GBM, ajoutez une gliomasphère au-dessus du tissu neural avec une grande pointe de tuyauterie de perle (figure 1F). Placer délicatement la plaque de 6 puits dans l'incubateur.

4. organoïdes dopaminergiques dérivés du HESC pour les études sur la

  1. Jour 0: Amplifiez les HESC dans la culture 2D jusqu'à 60% de confluence (jour 0), puis remplacez les milieux de cellules souches utilisés pour maintenir les caractéristiques de la pluripotence des HESC par un milieu sans sérum. Démarrer l'induction neuronale en complétant le milieu de culture avec un inhibiteur de 0,5 M BMP et 10 'M Inhibiteur TGGMD/Activin/Nodal (cocktail d'inhibition dual-SMAD), puis ajoutez 10 'M inhibiteur de ROCK pendant 24 h pour augmenter le taux de survie des cellules pendant le passage.
  2. Jour 1 : Préparer la plaque de micropuits avec 2,5 ml par puits de milieu sans sérum complété par un inhibiteur de 0,5 M BMP, 10 'M inhibiteur TGGM/Activin/Nodal, et 10 'M inhibiteur de ROCK. Pour spécifier les cellules vers le modèle ventral du tube neural, ajoutez 100 ng/mL Sonic Hedgehog (SHH), 100 ng/mL fibroblaste facteur de croissance 8 (FGF8), et 2 'M agoniste lissé. Centrifuger la plaque (seulement avec moyen et sans cellules) à 1200 x g pendant 5 min pour enlever les bulles d'air des micropuits.
    1. Après 1 jour d'induction neuronale en 2D, retirer le milieu et laver rapidement avec du PBS sans Ca2/MgCl2 . Dissocier les colonies en suspension de cellules individuelles en ajoutant 7,5 ml de solution enzymatique recombinante dans un flacon T75 cm 2. Incuber pendant 2 min à 37 oC puis compléter avec 7,5 ml de DMEM-F12.
    2. Recueillir la suspension cellulaire et la centrifugeuse à 300 x g pendant 5 min. Retirez le supernatant et comptez les cellules dans le même milieu utilisé pour préparer la plaque de micropuits.
    3. Ajuster le volume moyen pour obtenir une suspension cellulaire permettant de former des neurosphères contenant 1000 cellules par micropuits (par exemple, la plaque de micropuits utilisée ici contient 4 700 micropuitss par puits). Préparer donc 4,7 millions de cellules dans 2,5 ml de milieu et l'ajouter aux 2,5 ml de milieu antérieur s'est déjà placé dans la plaque.
    4. Afin de répartir correctement les cellules dans chaque micropuits, agitez doucement la plaque et centrifugez la plaque de micropuits 300 x g pendant 5 min. Incuber la plaque à 37 oC pendant 24 h pour générer des sphères.
  3. Jour 2 : Rincer délicatement les micropuits avec le milieu et recueillir, puis transférer les sphères dans une plaque de six puits traitée par les tissus. Remplacer le milieu par neurobasal milieu complété par 1% B27, 1x NEAA, 2 mM L-glutamine, et 1% de pénicilline / streptomycine. En outre, ajoutez des facteurs de régionalisation SHH, FGF8, agoniste lisse, et double-SMAD inhibition de petites molécules.
    1. Placer les sphères en rotation à 37 oC (60 tr/min, shaker orbital) et changer de demi-moyen fraîchement complété tous les 2-3 jours.
  4. Jour 3 : Pour améliorer l'induction neuronale et les convertir en progéniteurs neuronaux avec une identité cérébrale, complétez le milieu par un inhibiteur de 3 M GSK-3, qui active la voie Wnt/-caténine. Maintenir l'inhibiteur GSK-3MD dans le milieu jusqu'au jour 13. Diviser en deux nouvelles plaques de puits traitées par les tissus pour réduire la densité de la sphère par puits et éviter l'agrégation de sphère.
    REMARQUE : Au jour 8, la plupart des cellules devraient être positives pour Nestin.
  5. Jour 8: Démarrer la maturation neuronale: remplacer les facteurs de régionalisation SHH, FGF8, agoniste lissé, et cocktail d'inhibition dual-SMAD avec 0,5 mM dibutyryl cAMP (pour favoriser la maturation), 20 nM inhibiteur de l'histone deacetylase (pour la sortie du cycle cellulaire), 1 M -sécrétase facteurs inhibiteurs et de croissance, 10 ng/mL GDNF, 10 ng/mL BDNF, 1 ng/mL transformant le facteur de croissance 3 (TGF-3), et 5 ng/mL FGF20 (les deux favorisent la survie de l'ancêtre DA). Changer le milieu tous les 2-3 jours.
  6. Jour 21: Générer l'organoïde neural: graines autour de 100 neurosphères sous des conditions d'interface air-liquide sur la membrane PTFE (6 mm de diamètre). Transférer la membrane à un insert de plaque de culture (0,4 mm) et ajouter 1,2 ml de milieu de maturation neuronale utilisé pour la différenciation de la neurosphère telle que décrite précédemment.
    1. Arrêtez toute rotation à partir de cette étape. Changez le milieu tous les 2-3 jours jusqu'à ce que le point de différenciation requis soit atteint.
      REMARQUE : En ce qui concerne la maturation neuronale, une diminution du marqueur immature neural Nestin et l'augmentation des marqueurs neuronaux matures 3-tubulin et GFAP ont été observées. Des expressions TH et NURR1 élevées ont été observées (Figure 3C) et confirment la maturité organoïde neurale11.

5. Quantification de l'expression du gène TH et Nurr1 pour la validation de la différenciation dopaminergique

  1. Extraction de l'ARN : Le jour indiqué de la différenciation, lysez 40 neurosphères avec 350 L de tampon RLT (fourni dans le kit d'extraction d'ARN) complétée par 3,5 l de 2-mercaptoethanol. Extraire l'ARN des neurosphères lysées à l'aide d'un kit d'extraction d'ARN suivant les instructions du fabricant.
  2. Quantifier les concentrations totales d'ARN.
  3. Effectuer la transcription inverse de 300 ng de l'extraction totale de l'ARN à l'aide du kit de transcription inversée pour la réaction quantitative en temps réel de la chaîne de polymérase (qPCR) et suivre les instructions du fabricant .
  4. Effectuer une analyse qPCR sur les systèmes de détection PCR en temps réel, basé sur la détection asymétrique de colorant cyanine. Normalisez les données avec des gènes d'entretien ménager : glycéraldéhyde-3-phosphate dehydrogenase (GAPDH) et facteur d'allongement 1-alpha (EF1). Les séquences d'amorces sont décrites dans le tableau 1.

6. Détection de la chromatographie liquide à haute pression (HPLC)

  1. Utilisez la chromatographie liquide à haute pression (HPLC) avec détection électrochimique pour détecter la présence de dopamine. La dopamine a été extraite en lysant les organoïdes neuronaux dans 100 ml d'acide perchlorique de 0,1 N (HClO4) pendant 15 min à 4 oC avec un tourbillon vigoureux toutes les 5 min. Après la centrifugation, recueillir et stocker le supernatant à -20 oC pour la dose de dopamine.
  2. Utilisez une colonne C-18 (5 m, 4,6 mm x 150 mm) pour séparer les analytes en HPLC en phase inversée en mode isocratique à un débit de 1 ml/minute. La détection de la dopamine doit être effectuée à l'aide d'un détecteur coulométrique avec la cellule de conditionnement fixée à un potentiel de 200 mV.

7. Enregistrement brut de données avec la plate-forme de tableau de micro-electode (MEA)

  1. Utilisez un microscope à dissection pour transférer les neurosphères au centre d'un dispositif MEA poreux.
  2. Utilisez un amplificateur et un système d'acquisition de données pour les enregistrements électrophysiologiques. Mesurer le rapport signal-bruit (RNS) comme déviation standard de la tension au cours d'un enregistrement de 5 minutes, en utilisant le signal comme la tension moyenne de pointe à pic des pics enregistrés dans les mêmes périodes de 5 minutes.

Representative Results

Les étapes critiques de ce protocole doivent être bien identifiées et traitées correctement. Par conséquent, un diagramme des conditions de culture indiquant le laps de temps pour chaque étape ainsi que les composés utilisés pour le protocole de différenciation sont illustrés dans la figure 1A et la figure 3A pour LES organoïdes neuronaux NO plus GBM et DA, respectivement. Figure 1B,C,D,E,F illustre les cellules, les sphères, et NON et montrent la morphologie typique pour chaque étape. Figure 1G,H, j'illustre la coloration d'immunofluorescence avec quelques marqueurs neuraux.

Figure 1
Figure 1 : Organoïde neuronal humain (NO) protocole de différenciation. (A) Protocole normalisé pour la génération de NO dérivé des cellules souches embryonnaires humaines (HESC). (B) hESCs sont maintenus sur la matrice extracellulaire dans le milieu hESC. (C) Les plaques micropuits ont été utilisées pour générer des neurosphères calibrées. À 2 semaines, les neurosphères ont été plaquées sur l'insert contenant une membrane PTFE (barre d'échelle de 50 m). (D) Vue macroscopique de NON dans l'insert dans un puits d'une plaque de 6 puits. Pendant les premiers jours, des rosettes ont été observées (flèche noire) (E). (F) Vue macroscopique d'une sphère NON plus GIC sur le dessus. (G-I) Analyse d'immunofluorescence de la sphère NO plus GIC (EGFR-positive; barre d'échelle de 50 m) (G) et NO seul, qui a montré la réactivité immunitaire pour le marqueur neuronal III-tubulin et légèrement positif pour la nestine; cependant, la synapsine 1 a montré un signal faible (H,I) (barres d'échelle de 100 m et 50 m, respectivement). Veuillez cliquer ici pour voir une version plus grande de ce chiffre. 

Figure 2
Figure 2 : Illustration de sphères nécrotiques et NO immature. Les neurosphères (A) et NO (B) peuvent subir une nécrose lorsqu'elles sont trop nombreuses dans le puits ou surdimensionnées (C) (barre d'échelle de 10 m). (D) Un CPG infecté par un journaliste de tomate aider à suivre l'invasion des cellules tumorales dans NO, barre d'échelle, 10 m. Exemple de NON immature avec des tubes neuronaux (E) et pas de tubes neuronaux (F) (barre d'échelle de 50 'm). Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Figure 3
Figure 3 : Protocole normalisé pour la génération d'organoïde neuronal DA et l'analyse électrophysiologique et morphologique. (A) Protocole normalisé pour la génération d'organoïdes neuronaux DA. (B) Analyse d'immunofluorescence de l'organoïde neural dA ; Les cellules TH-immunoréactives co-expriment Nurr1, un marqueur spécifique du cerveau moyen (barre d'échelle de 50 m). Les données sont représentées en moyenne au SEM (n ' 3). (C) Les graphiques représentent la cinétique de l'expression du gène TH et Nurr1 évaluée par qRT-PCR. (D) Représentant HPLC : Le pic de dopamine (flèche) a été détecté par HPLC du lysate d'organoïde neural de DA. (E) Exemple de données brutes enregistrées avec la plate-forme MEA. Chaque pointe est affichée par une ligne verticale (horodateurs), alors que la trace restante est le bruit. (F) Image représentant une neurosphère déposée sur le MEA. (G) Superposition de pointes typiques (courbes bleues et rouges) détectées à partir des données brutes. La courbe noire en gras indique la moyenne des courbes rouges correspondantes. (H) Parcelle Raster montrant les horodateurs associés à chaque pointe détectée. Les différentes couleurs mettent en valeur les différentes électrodes. Veuillez cliquer ici pour voir une version plus grande de ce chiffre. 

gène Foward (en) revenir sur
Nurr1 (en) GGCTGAAGCCATGCCTTGT GTGAGGTCCATGCTAACTTGACA
E GCACCTTCGCGCTTTT CCCGAACTCCACCGTGAA
EEF1 (en) AGCAAAAATGACCCATG AGCAAAAATGACCCATG GCCTGGATGGTCAGGATA
GAPDH (EN) GCACAAGAGGAAAGAGAGAGAACC AGGGGAGATTCAGTGTGGGTGT

Tableau 1 : Amorces utilisées dans ce protocole.

Discussion

L'un des aspects les plus critiques de ce protocole comprend le maintien de la pluripotence hESC pendant la culture cellulaire et la surveillance étroite des sphères et de la morphologie organoïde neuronale. les hESC sont très sensibles, et chaque manipulation peut conduire à une différenciation incontrôlée précoce ainsi qu'à la mort cellulaire. Afin d'augmenter la reproductibilité expérimentale et d'éviter l'occurrence d'événements karyotypes anormaux, il est conseillé de cryoconserver plusieurs lots de HESC au passage le plus bas après validation de leur stabilité chromosomique. En outre, il est recommandé de décongeler une nouvelle fiole pour chaque expérience et de vérifier le comportement des cellules tous les jours. Si les sphères sont moins réfractives avec une taille anormale plus élevée, elles commenceront probablement à s'agréger et à mourir.

Une amélioration sur ce système est soit la perfusion ou la mise en œuvre d'un système vascularisé (en ajoutant des cellules endothéliales ou dans une puce fluide 3D)12,13. Cependant, le contrôle de l'épaisseur de l'organoïde neural (300 m) permet une perfusion passive efficace d'oxygène et de nutriments et prévient la nécrose. Une autre amélioration est l'introduction de cellules immunitaires (microglies). Avec ces limitations à l'esprit, organoïdes neuronaux plus un système de GIC peut être un outil pertinent pour plusieurs raisons. Tout d'abord, ce système permet le dépistage des médicaments pour surveiller la façon dont un composé thérapeutique peut affecter un organoïde ou une cellule tumorale. Deuxièmement, les interactions de cellule à cellule peuvent être étudiées, et les déterminants micro-environnementaux sous-jacents aux invasions individuelles et collectives peuvent être visualisés et explorés5,6,13.

Dans le contexte de la maladie de Parkinson, un organoïde neural enrichi dans les neurones DA peut représenter un modèle 3D pertinent et précis pour étudier le développement de la maladie. Dans des études précédentes, les cellules souches pluripotentes induites par le patient de Parkinson différenciées vers des neurones da d'A ont été employées pour étudier les sous-types neuronaux affectés. Il convient de noter que certains phénotypes liés à la maladie, comme l'accumulation de synucléine et la sensibilité au stress oxydatif, ont été observés14,15. En outre, l'organoïde neural peut être utilisé comme un outil pour l'écran des molécules thérapeutiques. Cependant, des lectures spécifiques et pertinentes devraient être mis en place pour évaluer la survie et la fonctionnalité des neurones DA, telles que la production de dopamine et l'activité électrophysiologique. Au total, ce protocole fournit deux approches normalisées et précises à base de cellules souches pour générer des organoïdes neuronaux.

Disclosures

Les auteurs ne déclarent aucun intérêt financier concurrent.

Acknowledgments

Les auteurs remercient la Ligue Genevoise Contre le Cancer (Genève, Suisse), la Fondation ISREC (Lausanne, Suisse) et la Clayton Foundation for Research (Houston, TX, USA) pour leur soutien financier. En outre, les auteurs remercient HES-HO et le Wyss Center pour leur soutien financier. Nous remercions le laboratoire de Krause pour les discussions et le soutien utiles et le Dr Halah Kutaish pour la relecture.

Materials

Name Company Catalog Number Comments
6-well plate (6-well plate) Falcon / Corning 07-201-588
ABI Prism 7900 HT detection system  (Real-Time PCR detection systems) Applied Biosystems Discontinued
Aggrewell 400 (Microwell culture plates ) StemCell Technologies 34421
Amplifier (W2100-HS32)  (Amplifier) Multi Channel Systems
Anti-EGFR (phospho Y1101) antibody Abcam ab76195 1/100 dilution
Anti-GFAP Antibody Dako  Z334  1/1000 dilution
Anti-Nestin, Human Antibody Millipore  ABD69  1/400 dilution
Anti-Synapsin I Antibody Chemicon  AB1543P  1/500 dilution
B27 supplements (B27) Life Technologies / Invitrogen 1238 For both protocol, stock solution 100x, final solution 1x
Brain-derived neurotrophic factor  (BDNF) Cell Guidance GFH1-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
CHIR-99021 (GSK-3β inhibitor ) Axon Medchem ct99021 For Dopaminergic protocol,  stock solution 7.5 mM in DMSO, final solution 3 µM
Compound E a γ–secretase inhibitor (γ–secretase inhibitor) Calbiochem CAS 209986-17-4 For both protocol (gamma-secretase inhibitor XXI),  stock solution 5 mM in DMSO, final solution 1 µM
Coulochem III  (Coulometric detector parameters) Thermo scientific
Dibutyryl cyclic-AMP (Dibutyryl cAMP) Sigma D0627 For Dopaminergic protocol,  stock solution 0.5 M in DMSO, final solution 0.5 mM
Dimethyl Sulfoxide Pure (DMSO) Sigma-Aldrich C6164 Compounds solvent, ready to use
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 12491-015 For cell culture, ready to use
Dulbecco's Modified Eagle Medium Mixture F-12 (DMEM-F12) Gibco 11320033 For cell culture, ready to use
EDTA 0.1 mM (EDTA) Life Technologies AM9912 For cell culture, ready to use
Epidermal Growth Factor (EGF) Gibco PHG0313 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
Fibroblast Growth Factor 20 (FGF20) Peprotech 100-41 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 5 ng/mL
fibroblast growth factor 8  (FGF8) Peprotech GFH176-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
Fibroblast growth factor-basic (bFGF) Gibco PHG0024 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
G5 supplements (G5) Invitrogen 17503012 For GIC culture, stock solution 100x, final solution 1x
Glial cell-derived neurotrophic factor (GDNF) Cell Guidance GFH2-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
Hydrophilic polytetrafluoroethylene  membrane (PTFE membrane) BioCell-Interface Discontinued
LDN-193189 (BMP inhibitor) Axon Medchem /Stemgen 04-0072-02 /1509 Dual/Smad,  stock solution 5 mM in DMSO, final solution 0.5 µM
L-glutamine (L-glutamine) Gibco 25030081 L-Glutamine (200 mM), stock solution 200 mM, final solution 2 mM
Matrigel (extracellular matrix) BD Biosciences 354277 hESC-qualified Matrix, stock solution 18-22 mg/mL, final solution 180-220 µg/mL
Millicell-CM Culture plate insert  (0.4 µm) (Culture plate insert) Millipore PICM03050
Monoclonal Anti-β-Tubulin III antibody Sigma  T8660  1/1000 dilution
MS Orbital Shaker, MS-NOR-30 (Orbital shaker) Major Science MS-NRC-30
N2 supplements (N2) Invitrogen 17502-048 For GIC culture, stock solution 100x, final solution 1x
Nanodrop (Nanodrop) Thermo Fisher Scientific Discontinued
Neurobasal (Neurobasal) Life Technologies / Gibco 21103049 Maintenance and maturation embryonic neuronal cell populations , ready to use
Non-Essential Amino Acids  (NEAA) Gibco 11140 Non-essential Amino Acids 100X, stock solution 100x, final solution 1x
Nurr1 Antibody (M-196) Santa Cruz Sc-5568 1/100 dilution
Nutristem  (hESC medium ) Biological Industries 05-100-1A Stem cell media, ready to use
Penicilin / Streptomycin  (Penicilin / Streptomycin ) Life Technologies / Gibco 15140122 For cell culture, stock solution 5 mg/mL, final solution 50 µg/mL 
Perchloric acid 0.1N (HCLO4) Merck 100519 For HPLC, ready to use
Phosphate Buffered Saline without Ca2+/Mg2+  (PBS without Ca2+/Mg2+ ) Life Technologies 14190250 For cell culture, ready to use
PrimeScript RT-PCR Kit (Reverse transcription kit) Takara RR014A
Purmorphamin (smoothened agonist) Calbiochem SML0868 For Dopaminergic protocol,  stock solution 10 mM in DMSO, final solution 2 µM
Rho-associated Kinase Y-27632 (ROCK) Abcam Biochemicals ab120129-1 Rock Inhibitor,  stock solution 50 mM in DMSO, final solution 10 µM
RNeasy mini kit (RNA extraction kit ) Qiagen 74104
SB-431542 (TGFβ/Activin/Nodal inhibitor ) Ascent Asc- 163 Dual-Smad,  stock solution 50 mM in DMSO, final solution 10 µM
Sonic Hedgehog (SHH) Cell Guidance GFH168-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
StemPro Accutase (hESC enzymatic solution) Gibco A11105-01 hESC enzymatic solution, ready to use
Symmetry C-18,5 mm (4.6 150mm2)  (Reversed-phase column) Waters Corporation
T150 flask (T150 flask) Falcon 08-772-1F
TH Antibody (F-11) Santa Cruz Sc-25269 1/200 dilution
Transforming Growth Factors beta 3 (TGFβ3) Cell Guidance GFH109-2 For Dopaminergic protocol,  stock solution 100 µg/mL in pure ethanol , final solution 1 ng/mL
Trichostatine A (inhibitor of histone deacetylase ) Sigma T8552 For Dopaminergic protocol,  stock solution 100 µM in DMSO, final solution 20 nM
TrypLE (recombinant enzymatic solution) Invitrogen 12604021 recombinant enzymatic solution, ready to use
Trypsin 0.25% (enzymatic solution) Life Technologies 15050065 enzymatic solution, ready to use
W2100, Multi Channel Systems (Data acquisition system ) WAT045905
X-vivo (serum free medium) Lonza BE04-743Q serum free medium, ready to use

DOWNLOAD MATERIALS LIST

References

  1. Louis, D. N., et al. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary. Acta Neuropathologica. 131, (6), 803-820 (2016).
  2. Stupp, R., et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. New England Journal of Medicine. 352, (10), 987-996 (2005).
  3. Daphu, I., et al. In vivo animal models for studying brain metastasis: value and limitations. Clinical and Experimental Metastasis. 30, (5), 695-710 (2013).
  4. Huszthy, P. C., et al. In vivo models of primary brain tumors: pitfalls and perspectives. Neuro Oncology. 14, (8), 979-993 (2012).
  5. Nayernia, Z., et al. The relationship between brain tumor cell invasion of engineered neural tissues and in vivo features of glioblastoma. Biomaterials. 34, (33), 8279-8290 (2013).
  6. Cosset, E., et al. Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials. 107, 74-87 (2016).
  7. Pringsheim, T., Jette, N., Frolkis, A., Steeves, T. D. The prevalence of Parkinson's's disease: a systematic review and meta-analysis. Movement Disorders. 29, (13), 1583-1590 (2014).
  8. Rajput, A. H., et al. Globus pallidus dopamine and Parkinson's motor subtypes: clinical and brain biochemical correlation. Neurology. 70, (16 Pt 2), 1403-1410 (2008).
  9. Jellinger, K. A. Pathology of Parkinson's's disease. Changes other than the nigrostriatal pathway. Molecular and Chemical Neuropathology. 14, (3), 153-197 (1991).
  10. Bernheimer, H., Birkmayer, W., Hornykiewicz, O., Jellinger, K., Seitelberger, F. Brain dopamine and the syndromes of Parkinson’s and Huntington. Clinical, morphological and neurochemical correlations. Journal of Neurological Science. 20, (4), 415-455 (1973).
  11. Tieng, V., et al. Engineering of midbrain organoids containing long-lived dopaminergic neurons. Stem Cells and Development. 23, (13), 1535-1547 (2014).
  12. Chen, C. S. 3D Biomimetic Cultures: The Next Platform for Cell Biology. Trends in Cell Biology. 26, (11), 798-800 (2016).
  13. Friedl, P., Sahai, E., Weiss, S., Yamada, K. M. New dimensions in cell migration. Nature Reviews Molecular Cell Biology. 13, (11), 743-747 (2012).
  14. Byers, B., et al. SNCA triplication Parkinson's's patient's iPSC-derived DA neurons accumulate alpha-synuclein and are susceptible to oxidative stress. PLoS ONE. 6, (11), e26159 (2011).
  15. Flierl, A., et al. Higher vulnerability and stress sensitivity of neuronal precursor cells carrying an alpha-synuclein gene triplication. PLoS ONE. 9, (11), e112413 (2014).
Organoïdes neuronaux humains pour étudier le cancer du cerveau et les maladies neurodégénératives
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).More

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter