Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Bioengineering

Human neurale Organoide zur Untersuchung von Hirntumor und neurodegenerativen Erkrankungen

doi: 10.3791/59682 Published: June 28, 2019
* These authors contributed equally

Summary

Diese Studie stellt Protokolle vor und beschreibt Protokolle, um zwei spezifische menschliche neurale Organoide als relevantes und genaues Modell für die Untersuchung von 1) der Entwicklung des menschlichen Glioblastoms innerhalb menschlicher neuronaler Organoide ausschließlich beim Menschen und 2) neuronendopaminergen Organoiden abzuleiten. Differenzierung, die ein dreidimensionales Organoid erzeugt.

Abstract

Das Fehlen relevanter in vitro neuronaler Modelle ist ein wichtiges Hindernis für den medizinischen Fortschritt für Neuropathologien. Die Erstellung relevanter zellulärer Modelle ist entscheidend, um sowohl die pathologischen Mechanismen dieser Krankheiten besser zu verstehen als auch neue therapeutische Ziele und Strategien zu identifizieren. Um relevant zu sein, muss ein In-vitro-Modell die pathologischen Merkmale einer menschlichen Krankheit reproduzieren. Im Kontext neurodegenerativer Erkrankungen sollte jedoch ein relevantes In-vitro-Modell den Neurozellersatz als wertvolle therapeutische Chance bieten.

Ein solches Modell würde nicht nur das Screening therapeutischer Moleküle ermöglichen, sondern kann auch zur Optimierung der differenzierungsabhängigen Protokolle verwendet werden [z. B. im Zusammenhang mit der Transplantation bei der Parkinson-Krankheit (PD)]. Diese Studie beschreibt zwei In-vitro-Protokolle der Entwicklung des menschlichen Glioblastoms innerhalb eines menschlichen neuralen Organoids (NO) und 2) neuronendopaminergen (DA) Differenzierung, die ein dreidimensionales (3D) Organoid erzeugt. Zu diesem Zweck wurde ein gut standardisiertes Protokoll erstellt, das die Produktion größenkalibrierter Neurosphären ermöglicht, die aus der Differenzierung menschlicher embryonaler Stammzellen (hESC) abgeleitet sind. Das erste Modell kann verwendet werden, um molekulare und zelluläre Ereignisse zu offenbaren, die während der Glioblastom-Entwicklung innerhalb des neuronalen Organoids auftreten, während das DA-Organoid nicht nur eine geeignete Quelle von DA-Neuronen für die Zelltherapie bei Parkinson darstellt, sondern auch für Drogentests verwendet werden.

Introduction

Die Weltgesundheitsorganisation (WHO) stuft Astrozytome als minderwertig (Grad I bis II) oder hochgradig (Klasse III und IV) ein. Glioblastom multiforme (GBM) ist ein Astrozytom Grad IV, der tödlichste der primären Hirntumoren, das gegen alle aktuellen Behandlungsformen resistent ist1. Trotz der Standardtherapie einschließlich Neurochirurgie, Chemotherapie und Strahlentherapie bleibt GBM tödlich und die 15-monatige Gesamtüberlebensrate hat sich in den letzten 15 Jahren nicht dramatisch verändert2. Um signifikante Fortschritte beim Verständnis der GBM-Pathogenese zu erzielen, ist die Verwendung relevanter Modelle von entscheidender Bedeutung. Bisher stützte sich die Studie von GBM auf Zelllinien, organotypische Nagetierscheiben und Xenotransplantation von patientenabgeleiteten Zellen in Mäuse oder transgene Mäuse, die spontane Tumoren entwickeln3,4. Obwohl diese Modelle nützlich waren, um Gehirnmetastasen und Tumoraggressivität zu untersuchen, sind sie durch Unterschiede zwischen den Arten eingeschränkt, und daraus resultierende Schlussfolgerungen können falsch in menschliches Gewebe übersetzt werden. Darüber hinaus werden bestehende Modelle mit menschlichen Zellen auch durch das Fehlen von Wirtsgewebe/Tumor-Wechselwirkungen3,4begrenzt. Experimentelle Modelle sind entscheidend für die Übersetzung von der Grundlagenforschung in therapeutische Ziele. Daher kann die Beschreibung eines Protokolls zur Herstellung von in vitro humanen neuralen Organoiden, die mit GBM-initiierenden Zellen (GICs) kokultiviert sind, ein relevantes System bereitstellen, das morphologische und funktionelle Merkmale der GBM-Entwicklung imitiert. Dieses System reproduziert einige In-vivo-Merkmale der GBM-Entwicklung, wie die diffuse Migration von eindringenden Zellen und Nekrosebereichen, und es hebt die für die Tumorbiologie relevante Genexpression hervor. Wie bereits gezeigt, werden einige kritische microRNAs während der GIC-Entwicklung innerhalb des 3D-Nervengewebes5,6induziert.

PD ist eine wichtige neurodegenerative Erkrankung und mit der Degeneration mehrerer neuronaler Subtypenverbunden 7. Auch wenn ein fortschreitender Auftreten der Symptome (z. B. Bradykinesie, asymmetrisches Restzittern, Steifigkeit und Haltungsinstabilität) die Krankheit charakterisiert, ist ihre genaue Ätiologie nicht eindeutig erwiesen. Tatsächlich haben viele Studien Gezeigt, dass wichtige Risikofaktoren aus einer Kombination von genetischen und ökologischen Faktoren resultieren können. Parkinson-Symptome sind mit der bilateralen Degeneration von dopaminergen Neuronen in der Substancia nigra (SN) verbunden, was zum Verschwinden von dopaminergen (DA) Axonen führt, die auf das Striatum8,9projizieren. Daher ist die Reduktion der striatalen Dopaminspiegel mit dem Fortschreiten der motorischen Dysfunktion bei PD-Patienten korreliert. Dopaminerge Neuronen enthalten Tyrosinhydroxylase (TH), ein Schlüsselenzym bei der Synthese von katecholaminergen Neurotransmittern, die die Aminosäure L-Tyrosin in L-3,4-Dihydroxyphenylalanin (L-DOPA, ein Dopamin-Vorläufer) in Dopamin10umwandelt. Der frühe Verlust der TH-Aktivität gefolgt von einem Rückgang der TH-Proteinexpression ist ein Kennzeichen von PD.

Diese Studie beschreibt zwei Protokolle mit menschlichen neuronalen Organoiden, wobei eines speziell auf einen Midbrain-ähnlichen Phänotyp ausgerichtet ist, der mit TH-positiven Zellen angereichert ist.

Protocol

Dieses Protokoll folgt den Richtlinien der Ethikkommission für Humanforschung der Universität Genf.

1. Erhaltung und Kultur undifferenzierter menschlicher embryonaler Stammzellen (hESCs)

  1. Führen Sie die Wartung und Erweiterung von hSECs unter feederfreien Bedingungen durch Vorbeschichtung von Geschirr mit einer spezifischen extrazellulären Matrix durch.
    1. 300 l extrazelluläre Matrix bei 4 °C auftauen (typische Bereichskonzentration 18-22 mg/ml, auf Eis halten) und vorsichtig mit 15 ml kaltem DMEM-Medium mischen, um eine vorzeitige Gelation der extrazellulären Matrix zu vermeiden. Fügen Sie den beiden T150-Flaschen 7,5 ml der extrazellulären Matrize hinzu.
    2. Inkubieren Sie die mit extrazellulärer Matrix beschichteten Gerichte mindestens 1 h (maximal über Nacht) bei 37 °C.
    3. Entfernen Sie die mittleren und Samen-HESCs auf eine Dichte von 6,5 x 104 Zellen/cm2.
  2. Bewahren Sie H1 (hESC-Zelllinie) in hESC medium und 1% Penicillin/Streptomycin auf.
  3. Passieren Sie die Zellen mit enzymatischem Verfahren: 7,5 ml enzymatische Lösung zu einem T75cm2 Kolben über einen Zeitraum von 1-2 min bei 37 °C hinzufügen. Sobald die Zellen vollständig abgetrennt sind, 7,5 ml DMEM-F12 hinzufügen und dann zentrifugieren für 5 min bei 300 x g. Um ein besseres Überleben zu ermöglichen, re-plate Zellen mit der gewünschten Dichte auf extrazelluläre Matrix-beschichtete Gerichte, im gleichen Medium mit Rho-assoziierten Proteinkinase (ROCK) Inhibitor (10 'M) für 24 h.

2. hESC-abgeleitete neuronale Organoide für GBM-Studien

  1. 24 h vor Beginn der 3D-Kultur, ersetzen Sie das hESC-Medium durch ein serumfreies Medium, das durch 10 M ROCK-Hemmer ergänzt wird (beide Komponenten sind notwendig, um das Zellüberleben und die spontane Neurosphärenbildung während der Aggregationsphase in einem Mikrowell zu unterstützen Platte). Die Zellen sollten bei 60% Konfluenz sein. Am nächsten Tag (Tag 0) hESC-Kolonien als Einzelzellen ablösen: das Medium entfernen, dann mit PBS ohne Ca2+/Mg2+abspülen, 5 ml enzymatische Auflösungslösung hinzufügen und bei 37 °C für 1-2 min brüten.
  2. Sammeln Sie die Zellen in serumfreiem Medium mit 10 M ROCK-Hemmer und zentrifugieren Sie die Zellen bei 300 x g für 5 min. Entfernen Sie den Überstand und zählen Sie die Zellen in 10 ml serumfreies Medium, ergänzt mit 10 'M ROCK-Hemmer.
  3. Parallel dazu spülen Sie die Mikrowellplatte mit 2 ml serumfreiem Medium pro Brunnen ab und zentrifugieren Sie die Platte bei 1200 x g für 5 min, um alle Blasen zu entfernen, was die Bildung von Neurosphären verhindern kann.
  4. Bereiten Sie 28,2 x 106 Zellen in 12,5 ml serumfreiem Medium vor, ergänzt durch 10 'M ROCK-Hemmer. Verteilen Sie 1000 Zellen/Mikrowell. Zentrifugieren Sie die Zellen bei 300 x g für 5 min und legen Sie die Platte über Nacht bei 37 °C (maximal 36 h) in den Inkubator. Zum Beispiel: Um 30 menschliche neuronale Organoide zu erhalten, verwenden Sie einen T150-Kolben bei 70%-80% des Zusammenflusses (ca. 30 Millionen Zellen).
  5. Am nächsten Tag (Tag 1) sammeln Sie die Kugeln (mit einem P1000) und legen Sie sie in eine 6-Brunnen-Platte. In jedem Brunnen, fügen Sie 2 ml B27 medium und DMEM-F12 GlutaMAX und Neurobasal Medium (Mix bei 1:1), ergänzt mit 1% B27 Ergänzungen und 1% nicht-essentielle Aminosäuren (NEAA). Um eine schnelle neuronale Induktion zu fördern, ergänzen Sie das Medium mit einem Dual-SMAD-Hemmungscocktail, der aus 10 M TGF/Activin/Nodal-Inhibitor und einem 0,5-M-Knochenmorphogenprotein-Inhibitor (BMP) besteht. Von diesem Schritt vorwärts werden die Kugeln in Rotation kultiviert (60 Rpm, Orbital-Shaker). Die Drehung ist entscheidend, um zu verhindern, dass die Kugeln zusammen oder an der Platte kleben.
  6. Ändern Sie das Medium alle 2-3 Tage: biegen Sie die Platte und lassen Sie die Kugeln fallen für 5 min, entfernen Sie die Hälfte des Mediums (2 ml), und fügen Sie 2 ml frisches B27 Medium mit Wachstumsfaktoren und Inhibitoren ergänzt. Zentrifugieren Sie die Kugeln nicht.
  7. Führen Sie die neuronale Induktion gemäß dem folgenden Zeitverlauf durch:
    1. Von den Tagen 1-4 Kultur die Kugeln in B27 Medium mit Dual-SMAD ergänzt. Der Dual-SMAD-Hemmungscocktail (10 M TGF/Activin/Nodal-Inhibitor und 0,5 M BMP-Hemmer) fördert die neuronale Induktion.
    2. Von den Tagen 4-11, fördern die Proliferation von hESC-abgeleiteten neuronalen Rosetten (in die Sphären), durch Zugabe von 10 ng/ml epidermalen Wachstumsfaktor (EGF) und 10 ng/ml Basis-Fibroblastenfaktor (bFGF) zum B27-Medium, ergänzt mit Dual-SMAD-Cocktail.
      HINWEIS: Am 11. Tag sollten die meisten Zellen positiv für Nestin sein.
    3. Von den Tagen 11-13, Kultur die Kugeln in B27 Medium mit 0,5 M BMP-Hemmer ergänzt.
    4. Von den Tagen 13-21, Kultur die Kugeln in B27 Medium ergänzt mit 10 ng/mL glial abgeleiteten neurotrophen Faktor (GDNF), 10 ng/mL Gehirn abgeleitetneurotrophen Faktor (BDNF) und 1 'M von '-Sekretase-Hemmer. GDNF und BDNF fördern die neuronale und gliale Differenzierung. Der Inhibitor der S-Sekretase ermöglicht eine größere neuronale Reifung.
    5. Am 21. Tag die Kugeln (ca. 1.000 Kugeln) auf eine hydrophile Polytetrafluorethylenmembran (PTFE) (6 mm Durchmesser, 0,4 m) auf einem Kulturplatteneinsatz für 6 Brunnenplatten ablagern. Beenden Sie jede Drehung aus diesem Schritt. Das Vorhandensein von Rosetten, beobachtet mit einem Hellfeldmikroskop, deutet auf die Einleitung einer neuronalen Differenzierung hin. Die neuronalen Rosetten können 2-3 Tage nach der Beschichtung von Kugeln auf der PTFE-Membran beobachtet werden.
    6. Fügen Sie 1 ml B27 Medium mit Wachstumsfaktoren und Inhibitoren (wie folgt) zu jedem Bohrplatz unter der Membraneinsatz, alle 2-3 Tage (in der Regel am Montag, Mittwoch und Freitag), für eine folgende 3 Wochen der Differenzierung.
    7. Von den Tagen 21-25 kultivieren menschliche neurale Organoide im selben neuronalen Reifungsmedium (vgl. Schritt 2.7.4).
    8. Von den Tagen 25-28 nur b27 medium mit 1 'M'-Sekesehemmer ergänzen.
    9. Ab den Tagen 28-39, hören Sie auf, den Sekretase-Inhibitor hinzuzufügen und setzen Sie die humane neuronale Organoidkultur nur im B27-Medium fort.
      HINWEIS: Nach 3 Wochen sind neuronale Organoide bereit für die GIC-Implantation. Entlang der neuronalen Reifung wurden eine Abnahme des neuronalunen unreifen Markers Nestin und eine Zunahme der reifen neuronalen Marker 3-Tubulin und GFAP beobachtet.

3. Isolierung und Kultivierung von glioblastom-initiierenden Zellen (GICs)

  1. Isolieren Sie GICs, indem Sie eine hochwertige menschliche GBM-Biopsie fragmentieren. Übertragen Sie das Tumorstück in ein Becher, das 0,25% Trypsin in 0,1 mM EDTA (4:1) enthält, und rühren Sie es langsam bei 37 °C für 30-60 min (je nach Tumorgröße).
  2. Die dissoziierten Zellen in 75 cm2 Gewebekulturkolben mit 2.500-5.000 Zellen pro cm2 in GIC-Medium: DMEM/F-12 medium (1:1) mit 1% N2, 1% B27 und 1% G5-Ergänzungen (zur Begünstigung des GIC-Überlebens), ergänzt mit bFGF und EGF (beide bei 10 ng/Ml, zur Förderung der Stängel) und 1% von Penicillin/Streptomycin.
  3. Sobald der GIC etabliert ist und wächst, entfernen Sie die N2 und G5 Ergänzungen aus dem GIC-Medium.
  4. Einen Tag vor dem Hinzufügen der Zellen auf das Organoid, dissoziieren Sie die GICs und zählen Sie sie.
  5. Spülen Sie die Mikrowell-Platte mit 2 ml GIC-Medium und zentrifugieren Sie die Platte mit der maximalen Geschwindigkeit, um Blasen zu entfernen (1000 x g). Platzieren Sie die GICs bei 1.000 Zellen, um eine Gliosphäre pro Mikrowell zu erhalten. Über Nacht bei 37 °C inkubieren (Abbildung 1C). Dieser Schritt ist der Schlüssel und ermöglicht gut kalibrierte GICs (ein Beispiel für nekrotische und übergroße GICs ist in Abbildung 2A,C) dargestellt.
  6. Um eine GBM-Invasion zu initiieren, fügen Sie eine Gliomasphäre auf das Neuralgewebe mit einer großen Rohrleitungsspitze mit einer großen Bohrung (Abbildung 1F) hinzu. Legen Sie die 6 Brunnenplatte vorsichtig wieder in den Inkubator.

4. hESC-abgeleitete dopaminerge Organoide für PD-Studien

  1. Tag 0: Amplify hESCs in 2D-Kultur bis zu 60% Konfluenz (Tag 0), dann ersetzen Stammzellmedien verwendet, um Pluripotenz-Features von hESCs durch ein Serum-freies Medium zu erhalten. Beginnen Sie die neuronale Induktion, indem Sie das Kulturmedium mit einem 0,5-M-BMP-Hemmer und einem 10-M-TGF-/Activin/Nodal-Inhibitor (Dual-SMAD-Inhibitionscocktail) ergänzen und dann 10-M-ROCK-Hemmer für 24 h hinzufügen, um die Überlebensrate der Zellen während des Durchgangs zu erhöhen.
  2. Tag 1: Bereiten Sie die Mikrowell-Platte mit 2,5 ml pro Brunnen serumfreies Medium vor, ergänzt durch 0,5 M BMP-Hemmer, 10 M TGF/Activin/Nodal-Inhibitor und 10-M-ROCK-Hemmer. Um Zellen in Richtung des ventralen Musters des Neuralrohrs anzugeben, fügen Sie 100 ng/mL Sonic Hedgehog (SHH), 100 ng/mL Fibroblasten-Wachstumsfaktor 8 (FGF8) und 2 m geglätteten Agonisten hinzu. Zentrifugieren Sie die Platte (nur mit medium und ohne Zellen) bei 1200 x g für 5 min, um Luftblasen aus den Mikrobrunnen zu entfernen.
    1. Nach 1 Tag neuronaler Induktion in 2D, entfernen Sie das Medium und waschen Sie schnell mit PBS ohne Ca2+/MgCl2+. Dissoziieren Sie die Kolonien in Einzelzellen Suspension durch Zugabe von 7,5 ml rekombinante enzymatische Lösung in einem T75cm2 Kolben. 2 min bei 37 °C inkubieren und dann mit 7,5 ml DMEM-F12 komplettieren.
    2. Sammeln Sie die Zellsuspension und Zentrifuge bei 300 x g für 5 min. Entfernen Sie den Überstand und zählen Sie die Zellen in dem gleichen Medium, das verwendet wird, um die Mikrowellplatte vorzubereiten.
    3. Passen Sie das mittlere Volumen an, um eine Zellsuspension zu erhalten, die es ermöglicht, Neurosphären mit 1000 Zellen pro Mikrowell zu bilden (z. B. enthält die hier verwendete Mikrowellplatte 4.700 Mikrobrunnen pro Brunnen). So bereiten Sie 4,7 Millionen Zellen in 2,5 ml Medium vor und fügen Sie es zu den vorherigen 2,5 ml Medium bereits in der Platte platziert.
    4. Um die Zellen in jedem Mikrobrunnen richtig zu verteilen, schütteln Sie die Platte vorsichtig und zentrifugieren Sie die Mikrowellplatte 300 x g für 5 min. Inkubieren Sie die Platte bei 37 °C für 24 h, um Kugeln zu erzeugen.
  3. Tag 2: Spülen Sie die Mikrobrunnen vorsichtig mit dem Medium und sammeln Sie dann die Kugeln in gewebebehandelte Sechs-Brunnen-Platte übertragen. Ersetzen Sie Medium durch neurobasales Medium, ergänzt durch 1% B27, 1x NEAA, 2 mM L-Glutamin und 1% Penicillin/Streptomycin. Zusätzlich, Fügen Sie Regionalisierungsfaktoren SHH, FGF8, geglättete Agonist, und Dual-SMAD Hemmung kleine Moleküle.
    1. Kugelkugeln bei 37 °C (60 Rpm, Orbitalshaker) in Rotation platzieren und alle 2-3 Tage halbmittel frisch ergänzt wechseln.
  4. Tag 3: Um die neuronale Induktion zu verbessern und in neuronale Vorläufer mit einer Midbrain-Identität umzuwandeln, ergänzen Sie das Medium mit 3 'M GSK-3'-Hemmer, der den Wnt/-Catenin-Weg aktiviert. Halten Sie den GSK-3-Inhibitor im Medium bis zum 13. Tag auf. Aufgeteilt in zwei neue gewebebehandelte 6 Brunnenplatten, um beide Kugeldichten pro Brunnen zu reduzieren und eine Kugelaggregation zu vermeiden.
    HINWEIS: An Tag 8 sollten die meisten Zellen positiv für Nestin sein.
  5. Tag 8: Beginn der neuronalen Reifung: Ersetzen Sie die Regionalisierungsfaktoren SHH, FGF8, geglätteter Agonist und Dual-SMAD-Hemmungscocktail mit 0,5 mM Dibutyryl-cAMP (zur Begünstigung der Reifung), 20 nM-Inhibitor der Histondeacetylase (für den Zellzyklusaustritt), 1 M-Sekresäse Inhibitor- und Wachstumsfaktoren, 10 ng/mL GDNF, 10 ng/mL BDNF, 1 ng/mL transformierender Wachstumsfaktor 3 (TGF3) und 5 ng/mL FGF20 (beide bevorzugen das Überleben von DA-Vorläufern). Ändern Sie das Medium alle 2-3 Tage.
  6. Tag 21: Generieren Sie das neuronale Organoid: Samen um 100 Neurosphären unter luft-flüssigen Grenzbedingungen auf PTFE-Membran (6 mm Durchmesser). Übertragen Sie die Membran auf einen Kulturplatteneinsatz (0,4 mm) und fügen Sie 1,2 ml neuronales Reifungsmedium hinzu, das für die Neurosphärendifferenzierung verwendet wird, wie zuvor beschrieben.
    1. Beenden Sie jede Drehung aus diesem Schritt. Ändern Sie das Medium alle 2-3 Tage, bis der erforderliche Differenzierungszeitpunkt erreicht ist.
      HINWEIS: In Bezug auf die neuronale Reifung wurden eine Abnahme des neuronalunen unreifen Markers Nestin und eine Zunahme der reifen neuronalen Marker 3-Tubulin und GFAP beobachtet. Hohe TH- und NURR1-Ausdrücke wurden beobachtet (Abbildung 3C) und bestätigen die neuronale organoide Reife11.

5. Quantifizierung der TH- und Nurr1-Genexpression zur Validierung der dopaminergen Differenzierung

  1. RNA-Extraktion: Am angegebenen Tag der Differenzierung lyse 40 Neurosphären mit 350 L RLT-Puffer (im RNA-Extraktionskit enthalten) ergänzt mit 3,5 l 2-Mercaptoethanol. Extrahieren Sie die RNA aus den lysierten Neurosphären mit einem RNA-Extraktionskit nach den Anweisungen des Herstellers.
  2. Quantifizieren Sie die gesamten RNA-Konzentrationen.
  3. Führen Sie die Umgekehrte Transkription von 300 ng der gesamten RNA-Extraktion mit Reverse-Transkriptions-Kit für quantitative Echtzeit-Polymerase-Kettenreaktion (qPCR) durch und befolgen Sie die Anweisungen des Herstellers.
  4. Führen Sie qPCR-Analysen auf Echtzeit-PCR-Erkennungssystemen durch, basierend auf der asymmetrischen Cyanin-Farbstoff-Erkennung. Normalisieren Sie die Daten mit Haushaltsgenen: Glyceraldehyd-3-Phosphat-Dehydrogenase (GAPDH) und Dehnungsfaktor 1-alpha (EF1). Sequenzen von Primern sind in Tabelle 1beschrieben.

6. Hochdruck-Flüssigkeitschromatographie (HPLC) Detektion

  1. Verwenden Sie Hochdruck-Flüssigkeitschromatographie (HPLC) mit elektrochemischer Detektion, um das Vorhandensein von Dopamin zu erkennen. Dopamin wurde durch Lysing neuronaler Organoide in 100 ml 0,1 N Perchlorsäure (HClO4) für 15 min bei 4 °C mit einem kräftigen Wirbeln alle 5 min extrahiert. Nach der Zentrifugation den Überstand bei -20 °C für Dopamin-Dosierung sammeln und lagern.
  2. Verwenden Sie eine C-18-Säule (5 m, 4,6 mm x 150 mm), um die Analyten durch umgekehrte Phase HPLC im isokratischen Modus mit einer Durchflussrate von 1 ml/Minute zu trennen. Der Nachweis von Dopamin sollte mit einem coulometrischen Detektor mit einer Konditionierungszelle von +200 mV durchgeführt werden.

7. Rohdatenaufzeichnung mit Microelectode-Array -Plattform (MEA)

  1. Verwenden Sie ein Seziermikroskop, um Neurosphären in die Mitte eines porösen MEA-Geräts zu übertragen.
  2. Verwenden Sie einen Verstärker und ein Datenerfassungssystem für elektrophysiologische Aufnahmen. Messen Sie das Signal-Rausch-Verhältnis (SNR) als Standardabweichung der Spannung während einer 5-min-Aufnahme, indem Sie das Signal als durchschnittliche Spitzenspannung der in den gleichen 5 min Perioden aufgezeichneten Spitzen verwenden.

Representative Results

Die kritischen Schritte dieses Protokolls müssen gut identifiziert und ordnungsgemäß behandelt werden. Daher ist in Abbildung 1A und Abbildung 3A für NO plus GBM und DA neurale Organoide ein Diagramm der Kulturbedingungen dargestellt, das den Zeitraffer für jeden Schritt sowie die für das Differenzierungsprotokoll verwendeten Verbindungen angibt. Abbildung 1B,C,D,E,F zeigt die Zellen, Kugeln und NEin und zeigt die typische Morphologie für jeden Schritt. Abbildung1G,H,I veranschaulicht Die Immunfluoreszenzfärbung mit einigen neuronalen Markern.

Figure 1
Abbildung 1 : Menschliches neurales Organoid (NO) Differenzierungsprotokoll. (A) Standardisiertes Protokoll zur Erzeugung von NO aus menschlichen embryonalen Stammzellen (hESC). (B) hESCs werden auf extrazellulärer Matrix im hESC-Medium gepflegt. (C) Microwell-Platten wurden verwendet, um kalibrierte Neurosphären zu erzeugen. Nach 2 Wochen wurden Neurosphären auf den Einsatz mit einer PTFE-Membran (Skala bar = 50 m) plattiert. (D) Makroskopische Ansicht von NO in den Einsatz in einem Brunnen einer 6-Well-Platte. In den ersten Tagen wurden Rosetten beobachtet (schwarzer Pfeil) (E). (F) Makroskopische Ansicht einer NO plus GIC Kugel auf der Oberseite. (G-I) Immunfluoreszenzanalyse der NO plus GIC-Kugel (EGFR-positiv; Skalenbar = 50 m) (G) und NO allein, die eine Immunreaktivität für den neuronalen Marker III-Tubulin und leicht positiv für Nestin zeigte; Synapsin 1 zeigte jedoch ein schwaches Signal (H,I) (Skalenstäbe = 100 bzw. 50 m). Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen. 

Figure 2
Abbildung 2 : Abbildung von nekrotischen Kugeln und unreifes NEIN. Die Neurosphären (A) und NO (B) können einer Nekrose unterzogen werden, wenn sie im Brunnen zu zahlreich oder überdimensioniert sind (C) (Skala bar = 10 m). (D) Ein mit einem Tomatenreporter infizierter GIC hilft, die Tumorzellinvasion in NO, Scale bar, 10 'm zu verfolgen. Beispiel für unreifes NO mit Neuralrohren (E) und ohne Neuralrohre (F) (Skala bar = 50 m). Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 3
Abbildung 3 : Standardisiertes Protokoll zur Erzeugung von DA-Neuralorganoid elektrophysiologische und morphologische Analysen. (A) Standardisiertes Protokoll zur Erzeugung von DA-Neuralorganoiden. (B) Immunfluoreszenzanalyse von DA-Neuralorganoid; TH-immunreaktive Zellen, die Nurr1, einen Midbrain-spezifischen Marker (Skala bar = 50 m), mitexkieren. Die Daten werden als Mittelwert dargestellt: SEM (n = 3). (C) Graphen stellen die Kinetik der TH- und Nurr1-Genexpression dar, die von qRT-PCR ausgewertet wird. (D) Vertreter HPLC: Dopamin-Peak (Pfeil) wurde von HPLC von DA neuralem organoidem Lysat nachgewiesen. (E) Beispiel für Rohdaten, die mit der MEA-Plattform aufgezeichnet wurden. Jede Spitze wird durch eine vertikale Linie (Zeitstempel) angezeigt, während die verbleibende Spur Rauschen ist. (F) Bild, das eine Neurosphäre darstellt, die auf dem MEA abgelagert ist. (G) Überlagerung typischer Spitzen (blaue und rote Kurven), die aus den Rohdaten erfasst wurden. Die schwarze Fettkurve gibt den Durchschnitt der entsprechenden roten Kurven an. (H) Rasterdiagramm mit den Zeitstempeln, die jeder erkannten Spitze zugeordnet sind. Die verschiedenen Farben heben die verschiedenen Elektroden hervor. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen. 

gen Foward Rückwärts
Nurr1 GGCTGAAGCCATGCCTTGT GTGAGGTCCATGCTAAACTTGACA
Th GCACCTTCGCGCAGTTCT CCCGAACTCCACCGTGAA
EEF1 AGCAAAAAGACCCACCAATG GCCTGGATGGTTCAGGATA
GAPDH GCACAAGAGGAAAAGAGAGAGAACC AGGGGAGATTCAGTGTGGGT

Tabelle 1: In diesem Protokoll verwendete Primer.

Discussion

Einer der kritischsten Aspekte dieses Protokolls umfasst die Aufrechterhaltung der hESC-Pluripotenz während der Zellkultivierung und die genaue Überwachung der Sphären und der neuronalen organoiden Morphologie. hESCs sind sehr empfindlich, und jede Manipulation kann zu einer frühen unkontrollierten Differenzierung sowie zu Zelltod führen. Um die experimentelle Reproduzierbarkeit zu erhöhen und das Auftreten abnormaler Karyotyp-Ereignisse zu vermeiden, wird empfohlen, mehrere Chargen von hESCs an der niedrigsten Passage nach Dervalidierung ihrer Chromosomenstabilität zu kryokonservieren. Darüber hinaus wird empfohlen, für jedes Experiment eine neue Durchstechflasche aufzutauen und das Verhalten der Zellen jeden Tag zu überprüfen. Wenn die Kugeln weniger brefraktiv mit ungewöhnlich höherer Größe sind, werden sie wahrscheinlich beginnen zu aggregieren und zu sterben.

Eine Verbesserung dieses Systems ist entweder perfusion oder die Implementierung eines vaskularisierten Systems (durch Zugabe von Endothelzellen oder innerhalb eines 3D-Fluid-Mikrochips)12,13. Die Kontrolle der Dicke des neuronalen Organoids (300 m) ermöglicht jedoch eine effiziente passive Perfusion von Sauerstoff und Nährstoffen und verhindert Nekrose. Eine weitere Verbesserung ist die Einführung von Immunzellen (Mikroglia). Mit diesen Einschränkungen im Hinterkopf, neuronale Organoide plus ein GIC-System kann ein relevantes Werkzeug aus mehreren Gründen sein. Erstens ermöglicht dieses System das Screening von Arzneimitteln, um zu überwachen, wie eine therapeutische Verbindung ein Organoid oder eine Tumorzelle beeinflussen kann. Zweitens können Zell-zu-Zell-Wechselwirkungen untersucht und Mikro-Umweltdeterminanten, die individuellen und kollektiven Invasionen zugrunde liegen, visualisiert und untersucht werden5,6,13.

Im Kontext der Parkinson-Krankheit kann ein in DA-Neuronen angereichertes neuronales Organoid ein relevantes und genaues 3D-Modell darstellen, um die Krankheitsentwicklung zu untersuchen. In früheren Studien wurden Parkinsons von Patienten abgeleitete induzierte pluripotente Stammzellen, die zu DA-Neuronen differenziert wurden, verwendet, um die betroffenen neuronalen Subtypen zu untersuchen. Bemerkenswert ist, dass einige krankheitsbedingte Phänotypen, wie z.B. die Anhäufung von '-Synuclein und die Empfindlichkeit gegenüber oxidativem Stress,14,15beobachtet wurden. Darüber hinaus kann das neuronale Organoid als Werkzeug verwendet werden, um therapeutische Moleküle zu überprüfen. Es sollten jedoch spezifische und relevante Auslesungen eingerichtet werden, um das Überleben und die Funktionalität von DA-Neuronen zu bewerten, wie z. B. Dopaminproduktion und elektrophysiologische Aktivität. Insgesamt bietet dieses Protokoll zwei standardisierte und genaue Stammzell-basierte Ansätze zur Erzeugung neuronaler Organoide.

Disclosures

Die Autoren erklären keine konkurrierenden finanziellen Interessen.

Acknowledgments

Die Autoren danken la Ligue Genevoise Contre le Cancer (Genf, Schweiz), der ISREC Foundation (Lausanne, Schweiz) und der Clayton Foundation for Research (Houston, TX, USA) für die finanzielle Unterstützung. Darüber hinaus danken die Autoren HES-HO und dem Wyss Center für die finanzielle Unterstützung. Wir danken dem Krause-Labor für die hilfreichen Diskussionen und Unterstützung und Dr. Halah Kutaish für das Korrekturlesen.

Materials

Name Company Catalog Number Comments
6-well plate (6-well plate) Falcon / Corning 07-201-588
ABI Prism 7900 HT detection system  (Real-Time PCR detection systems) Applied Biosystems Discontinued
Aggrewell 400 (Microwell culture plates ) StemCell Technologies 34421
Amplifier (W2100-HS32)  (Amplifier) Multi Channel Systems
Anti-EGFR (phospho Y1101) antibody Abcam ab76195 1/100 dilution
Anti-GFAP Antibody Dako  Z334  1/1000 dilution
Anti-Nestin, Human Antibody Millipore  ABD69  1/400 dilution
Anti-Synapsin I Antibody Chemicon  AB1543P  1/500 dilution
B27 supplements (B27) Life Technologies / Invitrogen 1238 For both protocol, stock solution 100x, final solution 1x
Brain-derived neurotrophic factor  (BDNF) Cell Guidance GFH1-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
CHIR-99021 (GSK-3β inhibitor ) Axon Medchem ct99021 For Dopaminergic protocol,  stock solution 7.5 mM in DMSO, final solution 3 µM
Compound E a γ–secretase inhibitor (γ–secretase inhibitor) Calbiochem CAS 209986-17-4 For both protocol (gamma-secretase inhibitor XXI),  stock solution 5 mM in DMSO, final solution 1 µM
Coulochem III  (Coulometric detector parameters) Thermo scientific
Dibutyryl cyclic-AMP (Dibutyryl cAMP) Sigma D0627 For Dopaminergic protocol,  stock solution 0.5 M in DMSO, final solution 0.5 mM
Dimethyl Sulfoxide Pure (DMSO) Sigma-Aldrich C6164 Compounds solvent, ready to use
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 12491-015 For cell culture, ready to use
Dulbecco's Modified Eagle Medium Mixture F-12 (DMEM-F12) Gibco 11320033 For cell culture, ready to use
EDTA 0.1 mM (EDTA) Life Technologies AM9912 For cell culture, ready to use
Epidermal Growth Factor (EGF) Gibco PHG0313 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
Fibroblast Growth Factor 20 (FGF20) Peprotech 100-41 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 5 ng/mL
fibroblast growth factor 8  (FGF8) Peprotech GFH176-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
Fibroblast growth factor-basic (bFGF) Gibco PHG0024 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
G5 supplements (G5) Invitrogen 17503012 For GIC culture, stock solution 100x, final solution 1x
Glial cell-derived neurotrophic factor (GDNF) Cell Guidance GFH2-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
Hydrophilic polytetrafluoroethylene  membrane (PTFE membrane) BioCell-Interface Discontinued
LDN-193189 (BMP inhibitor) Axon Medchem /Stemgen 04-0072-02 /1509 Dual/Smad,  stock solution 5 mM in DMSO, final solution 0.5 µM
L-glutamine (L-glutamine) Gibco 25030081 L-Glutamine (200 mM), stock solution 200 mM, final solution 2 mM
Matrigel (extracellular matrix) BD Biosciences 354277 hESC-qualified Matrix, stock solution 18-22 mg/mL, final solution 180-220 µg/mL
Millicell-CM Culture plate insert  (0.4 µm) (Culture plate insert) Millipore PICM03050
Monoclonal Anti-β-Tubulin III antibody Sigma  T8660  1/1000 dilution
MS Orbital Shaker, MS-NOR-30 (Orbital shaker) Major Science MS-NRC-30
N2 supplements (N2) Invitrogen 17502-048 For GIC culture, stock solution 100x, final solution 1x
Nanodrop (Nanodrop) Thermo Fisher Scientific Discontinued
Neurobasal (Neurobasal) Life Technologies / Gibco 21103049 Maintenance and maturation embryonic neuronal cell populations , ready to use
Non-Essential Amino Acids  (NEAA) Gibco 11140 Non-essential Amino Acids 100X, stock solution 100x, final solution 1x
Nurr1 Antibody (M-196) Santa Cruz Sc-5568 1/100 dilution
Nutristem  (hESC medium ) Biological Industries 05-100-1A Stem cell media, ready to use
Penicilin / Streptomycin  (Penicilin / Streptomycin ) Life Technologies / Gibco 15140122 For cell culture, stock solution 5 mg/mL, final solution 50 µg/mL 
Perchloric acid 0.1N (HCLO4) Merck 100519 For HPLC, ready to use
Phosphate Buffered Saline without Ca2+/Mg2+  (PBS without Ca2+/Mg2+ ) Life Technologies 14190250 For cell culture, ready to use
PrimeScript RT-PCR Kit (Reverse transcription kit) Takara RR014A
Purmorphamin (smoothened agonist) Calbiochem SML0868 For Dopaminergic protocol,  stock solution 10 mM in DMSO, final solution 2 µM
Rho-associated Kinase Y-27632 (ROCK) Abcam Biochemicals ab120129-1 Rock Inhibitor,  stock solution 50 mM in DMSO, final solution 10 µM
RNeasy mini kit (RNA extraction kit ) Qiagen 74104
SB-431542 (TGFβ/Activin/Nodal inhibitor ) Ascent Asc- 163 Dual-Smad,  stock solution 50 mM in DMSO, final solution 10 µM
Sonic Hedgehog (SHH) Cell Guidance GFH168-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
StemPro Accutase (hESC enzymatic solution) Gibco A11105-01 hESC enzymatic solution, ready to use
Symmetry C-18,5 mm (4.6 150mm2)  (Reversed-phase column) Waters Corporation
T150 flask (T150 flask) Falcon 08-772-1F
TH Antibody (F-11) Santa Cruz Sc-25269 1/200 dilution
Transforming Growth Factors beta 3 (TGFβ3) Cell Guidance GFH109-2 For Dopaminergic protocol,  stock solution 100 µg/mL in pure ethanol , final solution 1 ng/mL
Trichostatine A (inhibitor of histone deacetylase ) Sigma T8552 For Dopaminergic protocol,  stock solution 100 µM in DMSO, final solution 20 nM
TrypLE (recombinant enzymatic solution) Invitrogen 12604021 recombinant enzymatic solution, ready to use
Trypsin 0.25% (enzymatic solution) Life Technologies 15050065 enzymatic solution, ready to use
W2100, Multi Channel Systems (Data acquisition system ) WAT045905
X-vivo (serum free medium) Lonza BE04-743Q serum free medium, ready to use

DOWNLOAD MATERIALS LIST

References

  1. Louis, D. N., et al. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary. Acta Neuropathologica. 131, (6), 803-820 (2016).
  2. Stupp, R., et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. New England Journal of Medicine. 352, (10), 987-996 (2005).
  3. Daphu, I., et al. In vivo animal models for studying brain metastasis: value and limitations. Clinical and Experimental Metastasis. 30, (5), 695-710 (2013).
  4. Huszthy, P. C., et al. In vivo models of primary brain tumors: pitfalls and perspectives. Neuro Oncology. 14, (8), 979-993 (2012).
  5. Nayernia, Z., et al. The relationship between brain tumor cell invasion of engineered neural tissues and in vivo features of glioblastoma. Biomaterials. 34, (33), 8279-8290 (2013).
  6. Cosset, E., et al. Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials. 107, 74-87 (2016).
  7. Pringsheim, T., Jette, N., Frolkis, A., Steeves, T. D. The prevalence of Parkinson's's disease: a systematic review and meta-analysis. Movement Disorders. 29, (13), 1583-1590 (2014).
  8. Rajput, A. H., et al. Globus pallidus dopamine and Parkinson's motor subtypes: clinical and brain biochemical correlation. Neurology. 70, (16 Pt 2), 1403-1410 (2008).
  9. Jellinger, K. A. Pathology of Parkinson's's disease. Changes other than the nigrostriatal pathway. Molecular and Chemical Neuropathology. 14, (3), 153-197 (1991).
  10. Bernheimer, H., Birkmayer, W., Hornykiewicz, O., Jellinger, K., Seitelberger, F. Brain dopamine and the syndromes of Parkinson’s and Huntington. Clinical, morphological and neurochemical correlations. Journal of Neurological Science. 20, (4), 415-455 (1973).
  11. Tieng, V., et al. Engineering of midbrain organoids containing long-lived dopaminergic neurons. Stem Cells and Development. 23, (13), 1535-1547 (2014).
  12. Chen, C. S. 3D Biomimetic Cultures: The Next Platform for Cell Biology. Trends in Cell Biology. 26, (11), 798-800 (2016).
  13. Friedl, P., Sahai, E., Weiss, S., Yamada, K. M. New dimensions in cell migration. Nature Reviews Molecular Cell Biology. 13, (11), 743-747 (2012).
  14. Byers, B., et al. SNCA triplication Parkinson's's patient's iPSC-derived DA neurons accumulate alpha-synuclein and are susceptible to oxidative stress. PLoS ONE. 6, (11), e26159 (2011).
  15. Flierl, A., et al. Higher vulnerability and stress sensitivity of neuronal precursor cells carrying an alpha-synuclein gene triplication. PLoS ONE. 9, (11), e112413 (2014).
Human neurale Organoide zur Untersuchung von Hirntumor und neurodegenerativen Erkrankungen
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).More

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter