Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Bioengineering

मस्तिष्क कैंसर और neurodegenerative रोगों का अध्ययन करने के लिए मानव तंत्रिका organoids

doi: 10.3791/59682 Published: June 28, 2019
* These authors contributed equally

Summary

इस अध्ययन का परिचय और वर्णन प्रोटोकॉल का अध्ययन करने के लिए एक प्रासंगिक और सटीक मॉडल के रूप में दो विशिष्ट मानव तंत्रिका organoids प्राप्त करने के लिए 1) मानव तंत्रिका organoids के भीतर मानव तंत्रिका organoids विशेष रूप से मनुष्यों में और 2) न्यूरॉन डोपामाइनर्जिक एक त्रि-आयामी अंगाभ उत्पन्न करने वाला विभेदन.

Abstract

इन विट्रो तंत्रिका मॉडल में प्रासंगिक की कमी neuropathologies के लिए चिकित्सा प्रगति पर एक महत्वपूर्ण बाधा है. प्रासंगिक सेलुलर मॉडल की स्थापना दोनों बेहतर इन रोगों के रोग तंत्र को समझने और नए चिकित्सीय लक्ष्यों और रणनीतियों की पहचान करने के लिए महत्वपूर्ण है. प्रासंगिक होना करने के लिए, एक इन विट्रो मॉडल एक मानव रोग के रोग सुविधाओं को पुन: पेश करना चाहिए. हालांकि, neurodegenerative रोग के संदर्भ में, एक प्रासंगिक इन विट्रो मॉडल एक मूल्यवान चिकित्सीय अवसर के रूप में तंत्रिका कोशिका प्रतिस्थापन प्रदान करना चाहिए.

इस तरह के एक मॉडल न केवल चिकित्सीय अणुओं की स्क्रीनिंग की अनुमति होगी, लेकिन यह भी तंत्रिका प्रोटोकॉल भेदभाव का अनुकूलन करने के लिए इस्तेमाल किया जा सकता है [उदाहरण के लिए, पार्किंसंस रोग में प्रत्यारोपण के संदर्भ में (पीडी)]. इस अध्ययन के विट्रो प्रोटोकॉल में दो का वर्णन करता है 1) मानव तंत्रिका organoids के भीतर मानव ग्लियोब्लास्टोमा विकास (नहीं) और 2) न्यूरॉन डोपामाइनर्जिक (डीए) एक तीन आयामी पैदा भेदभाव (3 डी) organoid. इस उद्देश्य के लिए, एक अच्छी तरह से मानकीकृत प्रोटोकॉल स्थापित किया गया था कि मानव भ्रूण स्टेम सेल (ESC) भेदभाव से व्युत्पन्न आकार कैलिब्रेटेड neurospheres के उत्पादन की अनुमति देता है. पहले मॉडल आणविक और सेलुलर तंत्रिका organoid के भीतर ग्लियोब्लास्टोमा विकास के दौरान होने वाली घटनाओं को प्रकट करने के लिए इस्तेमाल किया जा सकता है, जबकि दा organoid न केवल पार्किंसंस रोग में सेल थेरेपी के लिए डीए न्यूरॉन्स का एक उपयुक्त स्रोत का प्रतिनिधित्व करता है, लेकिन यह भी कर सकते हैं दवा परीक्षण के लिए इस्तेमाल किया जा.

Introduction

विश्व स्वास्थ्य संगठन (डब्ल्यूएचओ) कम ग्रेड (ग्रेड मैं द्वितीय से द्वितीय) या उच्च ग्रेड (ग्रेड III और चतुर्थ) के रूप में एस्ट्रोसाइटोमा वर्गीकृत करता है। ग्लियोब्लास्टोमा मल्टीफॉर्म (जीबीएम) एक एस्ट्रोसाइटोमा ग्रेड IV है, जो प्राथमिक मस्तिष्क ट्यूमर का सबसे घातक है, जो उपचारकेसभी वर्तमान रूपों 1 के लिए प्रतिरोधी है। न्यूरोसर्जरी, कीमोथेरेपी, और रेडियोथेरेपी सहित मानक देखभाल चिकित्सा के बावजूद, जीबीएम घातक रहता है और 15 महीने के समग्र जीवित रहने की दर नाटकीय रूप से पिछले 15 वर्षों में नहीं बदल ी2। जीबीएम रोगजनन को समझने में महत्वपूर्ण प्रगति करने के लिए, प्रासंगिक मॉडल का उपयोग महत्वपूर्ण है। अब तक, जीबीएम के अध्ययन सेल लाइनों पर भरोसा किया गया है, कृंतक organotypic स्लाइस, और चूहों या ट्रांसजेनिक चूहों में रोगी व्युत्पन्न कोशिकाओं के exotransplantation सहज ट्यूमर विकसित3,4. हालांकि इन मॉडलों मस्तिष्क मेटास्टेसिस और ट्यूमर आक्रामकता का अध्ययन करने के लिए उपयोगी किया गया है, वे प्रजातियों के बीच मतभेद ों द्वारा प्रतिबंधित कर रहे हैं, और जिसके परिणामस्वरूप निष्कर्ष गलत तरीके से मानव ऊतकों के लिए अनुवाद किया जा सकता है. इसके अलावा, मानव कोशिकाओं के साथ मौजूदा मॉडल भीमेजबान ऊतक की अनुपस्थिति से सीमित हैं / प्रायोगिक मॉडल बुनियादी विज्ञान से चिकित्सीय लक्ष्यों के लिए अनुवाद के लिए महत्वपूर्ण हैं. इसलिए, इन विट्रो मानव तंत्रिका organoids में उत्पादन करने के लिए एक प्रोटोकॉल का वर्णन सह जीबीएम शुरू कोशिकाओं (जीआईसी) के साथ खेती एक प्रासंगिक प्रणाली है कि जीबीएम विकास के रूपात्मक और कार्यात्मक सुविधाओं की नकल प्रदान कर सकते हैं. इस प्रणाली जीबीएम विकास के vivo सुविधाओं में कुछ पुन: पेश करता है जैसे कि हमलावर कोशिकाओं और नेक्रोसिस क्षेत्रों के फैलाना प्रवास, और यह ट्यूमर जीव विज्ञान के लिए प्रासंगिक जीन अभिव्यक्ति पर प्रकाश डाला गया. जैसा कि पहले से पता चला है, कुछ महत्वपूर्ण microRNAs 3 डी तंत्रिका ऊतक5,6के भीतर जीआईसी विकास के दौरान प्रेरित कर रहे हैं .

पीडी एक प्रमुख neurodegenerative विकार है और कई न्यूरॉन उपप्रकारों के अध: पतन के साथ जुड़ा हुआ7. यहां तक कि अगर लक्षणों की एक प्रगतिशील शुरुआत (जैसे, ब्रैडकिनेशिया, असममित बाकी कंपन, कठोरता और मुद्रा अस्थिरता) रोग की विशेषता है, इसकी सटीक एटियोलॉजी स्पष्ट रूप से स्थापित नहीं है। दरअसल, कई अध्ययनों सबूत है कि प्रमुख जोखिम कारकों आनुवंशिक और पर्यावरणीय कारकों का एक संयोजन से परिणाम कर सकते हैं पर प्रकाश डाला है. पार्किंसंस लक्षण substancia नाइग्रा (एसएन) में डोपामाइनर्जिक न्यूरॉन्स के द्विपक्षीय अध: पतन के साथ जुड़े रहे हैं, dopaminergic (डीए) axons के लापता होने के लिए अग्रणी 8,9. इसलिए, striatal डोपामाइन के स्तर की कमी पीडी रोगियों में मोटर रोग की प्रगति के साथ सहसंबद्ध है. डोपामाइनर्जिक न्यूरॉन्स में टायरोसिन हाइड्रॉक्सीलेस (थ्रथ), कैटेकोलेमिनर्जिक न्यूरोट्रांसमीटर के संश्लेषण में एक प्रमुख एंजाइम होता है जो एमिनो एसिड एल-टायरोसिन को एल-3,4-डाइहाइड्रॉक्सीफेनिलेलेनी (एल-डोपा, डोपामाइन अग्रदूत) को डोपामाइन10में परिवर्तित करता है। TH गतिविधि के प्रारंभिक नुकसान TH प्रोटीन अभिव्यक्ति में गिरावट के बाद पीडी की एक पहचान है.

यह अध्ययन मानव तंत्रिका organoids का उपयोग कर दो प्रोटोकॉल का वर्णन करता है, एक विशेष रूप से TH सकारात्मक कोशिकाओं के साथ समृद्ध एक midbrain की तरह phenotype की ओर उन्मुख के साथ.

Protocol

यह प्रोटोकॉल जिनेवा विश्वविद्यालय की मानव अनुसंधान नैतिकता समिति के दिशानिर्देशों का पालन करता है।

1. रखरखाव और अलग मानव भ्रूण स्टेम कोशिकाओं की संस्कृति (ESCs)

  1. एक विशिष्ट extracellular मैट्रिक्स के साथ पूर्व कोटिंग व्यंजन द्वारा फीडर मुक्त शर्तों पर एचएसईसी के रखरखाव और विस्तार प्रदर्शन करते हैं।
    1. 4 डिग्री सेल्सियस पर extracellular मैट्रिक्स के Thaw 300 डिग्री एल (सामान्य रेंज एकाग्रता 18-22 मिलीग्राम/एमएल, बर्फ पर रखने के लिए) और धीरे से ठंडा DMEM माध्यम के 15 एमएल के साथ मिश्रण करने के लिए extracellular मैट्रिक्स के एक समय से पहले जेलेशन से बचने के लिए. दोनों T150 फ्लास्क के लिए extracellular मैट्रिक के 7.5 एमएल जोड़ें.
    2. कम से कम 1 एच (अधिकतम रात भर) के लिए 37 डिग्री सेल्सियस पर extracellular मैट्रिक्स के साथ लेपित व्यंजन इनक्यूबेट करें।
    3. मध्यम और बीज hESCs 6.5 x 104 सेल/
  2. एचईएससी मध्यम और 1% पेनिसिलिन/स्ट्रेप्टोमाइसिन में एच 1 (ईएससी सेल लाइन) बनाए रखें।
  3. एंजाइमी प्रक्रिया के साथ कोशिकाओं को पास करें: 37 डिग्री सेल्सियस पर 1-2 मिनट की अवधि में एक T75 सेमी2 फ्लास्क के लिए एंजाइमी समाधान के 7.5 एमएल जोड़ें। एक बार कोशिकाओं को पूरी तरह से अलग कर रहे हैं, DMEM-F12 के 7.5 एमएल जोड़ें तो 300 x ग्रामपर 5 मिनट के लिए अपकेंद्रण . बेहतर अस्तित्व के लिए अनुमति देने के लिए, अतिरिक्त मैट्रिक्स लेपित व्यंजन पर वांछित घनत्व पर फिर से प्लेट कोशिकाओं, 24 ज के लिए रो-संबद्ध प्रोटीन kinase (रॉक) अवरोध करनेवाला (10 डिग्री सेल्सियस) युक्त एक ही माध्यम में।

2. जीबीएम अध्ययन के लिए हेसेक व्युत्पन्न तंत्रिका organoids

  1. 24 ज 3 डी संस्कृति शुरू करने से पहले, एक सीरम मुक्त मध्यम के साथ पूरक एक सीरम मुक्त मध्यम के साथ की जगह 10 $M रॉक अवरोध करनेवाला (दोनों घटकों एक microwell में एकत्रीकरण चरण के दौरान सेल अस्तित्व और सहज neurosphere गठन का समर्थन करने के लिए आवश्यक हैं प्लेट)। कोशिकाओं 60% संगम पर होना चाहिए. अगले दिन (दिन 0), एकल कोशिकाओं के रूप में ESC कालोनियों को अलग करें: माध्यम को हटा दें, फिर सीए2 +/Mg2 +के बिना पीबीएस से कुल्ला करें, एंजाइमी विघटन समाधान के 5 एमएल जोड़ें, और 1-2 मिनट के लिए 37 डिग्री सेल्सियस पर इनक्यूबेट करें।
  2. सीरम-मुक्त माध्यम में कोशिकाओं को 10 डिग्री सेल्सियस रॉक अवरोधक के साथ ले लीजिए और कोशिकाओं को 5 मिनट के लिए 300 x ग्राम पर अपकेंद्रण करें। सुपरनेंट निकालें और 10 एमएल में कोशिकाओं की गणना करें, जो कि रॉक अवरोधक के 10 डिग्री सेल्सियस के साथ पूरक हैं।
  3. समानांतर में, माइक्रोवेल प्लेट को 2 एमएल सीरम-मुक्त माध्यम के साथ अच्छी तरह से कुल्ला करें और प्लेट को 1200 x ग्राम पर 5 मिनट के लिए सभी बुलबुले को हटाने के लिए अपकेंद्रण करें, जो न्यूरोस्फीयर गठन को रोक सकता है।
  4. सीरम-मुक्त मध्यम के 12.5 एमएल में कोशिकाओं के 28.2 x 106 को 10 डिग्री सेल्सियस रॉक अवरोधक के साथ पूरक तैयार करें। 1000 कोशिकाओं/माइक्रोवेल का वितरण करें। 5 मिनट के लिए 300 x ग्राम पर कोशिकाओं को सेंट्रीफ्यूज करें और प्लेट को इनक्यूबेटर में 37 डिग्री सेल्सियस रात में रखें (अधिकतम 36 ज)। उदाहरण के लिए: 30 मानव तंत्रिका organoids प्राप्त करने के लिए, संगम के 70%-80% पर एक T150 फ्लास्क का उपयोग करें (लगभग 30 लाख कोशिकाओं).
  5. अगले दिन (दिन 1), क्षेत्रों (एक P1000 के साथ) इकट्ठा और उन्हें एक 6 अच्छी थाली में जगह है. प्रत्येक अच्छी तरह से, B27 मध्यम और DMEM-F12 GlutaMAX और Neurobasal मध्यम के 2 एमएल जोड़ें (1:1 पर मिश्रण), 1% B27 की खुराक और 1% गैर जरूरी एमिनो एसिड (NEAA) के साथ पूरक. तेजी से तंत्रिका प्रेरण को बढ़ावा देने के लिए, दोहरे-SMAD अवरोध कॉकटेल के साथ माध्यम के पूरक, 10 डिग्री एम TGF से बना /Activin/Nodal अवरोध करनेवाला और 0.5 $M हड्डी morphogenic प्रोटीन (BMP) अवरोध करनेवाला. इस कदम से आगे, क्षेत्रों रोटेशन (60 आरपीएम, कक्षीय शेकर) में सुसंस्कृत हैं। रोटेशन एक साथ या थाली के लिए चिपके से क्षेत्रों को रोकने के लिए महत्वपूर्ण है.
  6. हर 2-3 दिन में माध्यम बदलें: प्लेट को मोड़ें और गोले को 5 मिनट के लिए नीचे गिरने दें, आधे माध्यम (2 एमएल) को हटा दें, और विकास कारकों और अवरोधकों के साथ पूरक ताजा B27 मध्यम के 2 एमएल जोड़ें। गोलों को अपकेन्द्रित न करें।
  7. निम्नलिखित समय पाठ्यक्रम के अनुसार तंत्रिका प्रेरण प्रदर्शन:
    1. दिन 1-4 से, संस्कृति B27 मध्यम में क्षेत्रों दोहरी SMAD के साथ पूरक. दोहरी-एसएमएडी अवरोध कॉकटेल (10 डिग्री एम टीजीएफजेड/एक्सिन/नोडल अवरोधक और 0.5 डिग्री बीएमपी अवरोधक) तंत्रिका प्रेरण को बढ़ावा देता है।
    2. दिन से 4-11, HESC व्युत्पन्न तंत्रिका rosettes के प्रसार को बढ़ावा देने (क्षेत्रों में), जोड़ने के द्वारा 10 एनजी / एमएल epidermal विकास कारक (EGF) और 10 ng/mL बुनियादी फाइब्रोब्लास्ट कारक (bFGF) को B27 मध्यम दोहरी SMAD कॉकटेल के साथ पूरक.
      नोट: 11 दिन, अधिकांश कोशिकाएं नेस्टिन के लिए सकारात्मक होनी चाहिए।
    3. दिन 11-13 से, संस्कृति B27 मध्यम में क्षेत्रों 0.5 डिग्री बीएमपी अवरोधकरनेक के साथ पूरक.
    4. दिन 13-21 से, संस्कृति B27 मध्यम में क्षेत्रों 10 ng/mL glial व्युत्पन्न neurotrophic कारक (GDNF), 10 ng/mL मस्तिष्क व्युत्पन्न neurotrophic कारक (BDNF) और 1 $-secretase अवरोध करनेवाला के 1 डिग्री सेल्सियस के साथ पूरक. GDNF और बीडीएनएफ न्यूरोनल और ग्लिल विभेदकोश को बढ़ावा देते हैं। जेड-सेक्रेटस अवरोधक अधिक से अधिक तंत्रिका परिपक्वता के लिए अनुमति देता है।
    5. 21 दिन में, 6 अच्छी प्लेट के लिए डिज़ाइन की गई संस्कृति प्लेट डालने पर जमा एक हाइड्रोफिलिक पॉलीटेट्राफ्लोरोएथिलीन (PTFE) झिल्ली (6 मिमी व्यास, 0.4 मीटर) पर गोले (लगभग 1,000 गोले) को प्लेट करें। इस चरण से कोई भी घुमाव रोकें. रोज़ेट की उपस्थिति, एक उज्ज्वल क्षेत्र माइक्रोस्कोप के साथ मनाया, तंत्रिका भेदभाव की दीक्षा का संकेत मिलता है। तंत्रिका रोसेट PTFE झिल्ली पर क्षेत्रों चढ़ाना के बाद 2-3 दिन मनाया जा सकता है।
    6. जोड़ें 1 ML B27 मध्यम विकास कारकों और inhibitors के साथ पूरक (के रूप में पीछा किया) झिल्ली डालने के नीचे प्रत्येक अच्छी तरह से करने के लिए, हर 2-3 दिन (आमतौर पर सोमवार, बुधवार और शुक्रवार को), भेदभाव के बाद 3 सप्ताह के लिए.
    7. दिन 21-25 से, एक ही तंत्रिका परिपक्वता माध्यम में मानव तंत्रिका organoids खेती (Cf. कदम 2.7.4).
    8. दिन 25-28 से, केवल 1 $M $-secretase अवरोध करनेवाला के साथ B27 माध्यम पूरक.
    9. दिन 28-39 से, केवल बी 27 माध्यम में मानव तंत्रिका organoid संस्कृति को जोड़ने बंद करो.
      नोट: 3 सप्ताह के बाद, तंत्रिका organoids जीआईसी प्रत्यारोपण के लिए उपयोग करने के लिए तैयार हैं. तंत्रिका परिपक्वता के साथ, तंत्रिका अपरिपक्व मार्कर नेस्टिन की कमी और परिपक्व तंत्रिका मार्करों की वृद्धि - 3-tubulin और GFAP मनाया गया.

3. ग्लियोब्लास्टोमा शुरू करने वाली कोशिकाओं (जीआईसी) के अलगाव और खेती

  1. एक उच्च ग्रेड मानव जीबीएम बायोप्सी टुकड़े द्वारा जीआईसी अलग करें। 0.1 एमएम EDTA (4:1) में 0.25% trypsin युक्त एक बीकर में ट्यूमर का टुकड़ा स्थानांतरण और धीरे धीरे 30-60 मिनट के लिए 37 डिग्री सेल्सियस पर हलचल (ट्यूमर आकार पर निर्भर करता है).
  2. प्लेट में अलग कोशिकाओं 75 सेमी2 ऊतक संस्कृति flask पर चढ़ाया 2,500-5,000 कोशिकाओं प्रति सेमी2 जीआईसी माध्यम में: DMEM/F-12 मध्यम (1:1) युक्त 1% N2, 1% B27, और 1% G5 की खुराक (जीआईसी अस्तित्व के पक्ष में), BFGF और EGF के साथ पूरक (दोनों 10 पर ng/Ml, स्टेमनेस को बढ़ावा देने के लिए) और पेनिसिलिन का 1% /
  3. एक बार जीआईसी अच्छी तरह से स्थापित है और बढ़ रहा है, जीआईसी माध्यम से N2 और G5 की खुराक को हटा दें.
  4. organoid पर कोशिकाओं को जोड़ने से पहले एक दिन, जीआईसी अलग और उन्हें गिनती.
  5. जीआईसी मध्यम के 2 एमएल के साथ माइक्रोवेल प्लेट कुल्ला और बुलबुले को दूर करने के लिए अधिकतम गति से थाली centrifuge (1000 x ग्राम)। माइक्रोवेल प्रति एक ग्लिओमेस्फीयर प्राप्त करने के लिए 1,000 कोशिकाओं पर जीआईसी रखें। रात भर 37 डिग्री सेल्सियस (चित्र 1ब्) में इनक्यूबेट करें। यह चरण कुंजी है और अच्छी तरह से कैलिब्रेटेड जीआईसी के लिए अनुमति देता है (नेक्रोटिक और अधिक आकार के जीआईसी का एक उदाहरण चित्र 2A,C)में दिखाया गया है।
  6. जीबीएम आक्रमण आरंभ करने के लिए, एक बड़े बोर पाइप टिप के साथ तंत्रिका ऊतक के शीर्ष पर एक ग्लिओमेस्फीयर जोड़ें (चित्र 1F)। ध्यान से 6 अच्छी तरह से प्लेट वापस इनक्यूबेटर में जगह है.

4. पीडी अध्ययन के लिए हेसेक व्युत्पन्न डोपामाइनर्जिक ऑर्गनॉइड्स

  1. 0 दिन: 60% संगम (दिन 0) तक 2 डी संस्कृति में HESCs बढ़ाना, तो स्टेम सेल मीडिया की जगह एक सीरम मुक्त माध्यम के साथ HESCs की pluripotency सुविधाओं को बनाए रखने के लिए इस्तेमाल किया. 0.5 डिग्री सेल्सियस बीएमपी अवरोधक और 10 डिग्री एम टीजीएफ जेड/एक्टिविन/नोडल अवरोधक (दोहरी-एसएमएडी अवरोध कटोप कॉकटेल) के साथ संस्कृति माध्यम के पूरक द्वारा तंत्रिका प्रेरण शुरू करें, फिर पारित होने के दौरान कोशिकाओं की जीवित रहने की दर को बढ़ाने के लिए 24 घंटे के लिए 10 डिग्री सेल्सियस रॉक अवरोधक जोड़ें।
  2. दिन 1: सीरम मुक्त मध्यम के साथ अच्छी तरह से 2.5 एमएल के साथ microwell प्लेट तैयार 0.5 डिग्री एम बीएमपी अवरोध करनेवाला, 10 डिग्री सेल्सियस TGF$ / तंत्रिका ट्यूब के अधर पैटर्न की ओर कोशिकाओं को निर्दिष्ट करने के लिए, जोड़ें 100 ng/mL ध्वनि हाथी (SHH), 100 ng/mL फाइब्रोब्लास्ट वृद्धि कारक 8 (FGF8), और 2 $M smoothened agonist. माइक्रोवेल्स से हवा के बुलबुले को हटाने के लिए प्लेट को 5 मिनट के लिए 1200 x ग्राम पर (केवल मध्यम और बिना कोशिकाओं के) को सेंट्रीफ्यूज करें।
    1. 2 डी में तंत्रिका प्रेरण के 1 दिन के बाद, मध्यम निकालें और जल्दी से Ca2 +/ MgCl2 +बिना पीबीएस के साथ धो लें। एक T75 सेमी2 फ्लास्क में पुनः संयोजक एंजाइमी समाधान के 7.5 एमएल जोड़कर एकल कोशिकाओं के निलंबन में कालोनियों को अलग करें। 37 डिग्री सेल्सियस पर 2 मिनट के लिए इनक्यूबेट तो DMEM-F12 के 7.5 एमएल के साथ पूरा करें।
    2. सेल निलंबन और अपकेंद्रण को 300 x ग्राम पर 5 मिनट के लिए एकत्र करें। सुपरनेंट निकालें और माइक्रोवेल प्लेट तैयार करने के लिए उपयोग किए जाने वाले एक ही माध्यम में कोशिकाओं की गणना करें।
    3. एक सेल निलंबन प्राप्त करने के लिए मध्यम मात्रा समायोजित करें जिसमें माइक्रोवेल प्रति 1000 कोशिकाएं हैं (उदाहरण के लिए, यहां इस्तेमाल की जाने वाली माइक्रोवेल प्लेट में 4,700 माइक्रोवेल्स हैं जो प्रति अच्छी तरह से) हैं)। अतः 2.5 एमएल मध्यम में 4.7 मिलियन कोशिकाएं तैयार कीजिए और इसे प्लेट में पहले से रखे हुए मध्यम 2.5 एमएल में डालें।
    4. प्रत्येक माइक्रोवेल में कोशिकाओं को सही ढंग से वितरित करने के लिए, प्लेट को धीरे से हिलाएं, और माइक्रोवेल प्लेट को 5 मिनट के लिए 300 x ग्राम को अपकेंद्रण करें। गोले उत्पन्न करने के लिए प्लेट को 37 डिग्री सेल्सियस पर इनक्यूबेट करें।
  3. दिन 2: धीरे माध्यम के साथ microwells फ्लश और इकट्ठा तो ऊतक में गोल हस्तांतरण छह अच्छी तरह से थाली का इलाज किया. न्यूरोबेसल मध्यम के साथ मध्यम बदलें 1% B27, 1x NEA, 2 mM L-glutamine, और पेनिसिलिन का 1% / इसके अतिरिक्त, क्षेत्रीयता कारकों SHH जोड़ें, FGF8, sgonist smoothened, और दोहरी SMAD निषेध छोटे अणुओं.
    1. 37 डिग्री सेल्सियस (60 आरपीएम, कक्षीय शेकर) पर घूर्णन में गोले रखें और हर 2-3 दिनों में आधे-मध्यम को नए सिरे से बदल दें।
  4. 3 दिन: तंत्रिका प्रेरण को बढ़ाने और एक midbrain पहचान के साथ तंत्रिका संतति में परिवर्तित करने के लिए, 3 के साथ मध्यम पूरक 3 [M GSK-3] अवरोध करनेवाला, जो Wnt / दिन 13 तक के माध्यम में GSK-3] अवरोध करनेवाला बनाए रखें। दो नए ऊतक इलाज 6 अच्छी तरह से प्लेटों में विभाजित अच्छी तरह से प्रति दोनों क्षेत्र घनत्व को कम करने और क्षेत्र एकत्रीकरण से बचने के लिए.
    नोट: 8 दिन में, अधिकांश कोशिकाएं नेस्टिन के लिए सकारात्मक होनी चाहिए।
  5. 8 दिन: तंत्रिका परिपक्वता शुरू: क्षेत्रीयता कारकों SHH, FGF8, smoothened agonist की जगह, और दोहरी SMAD निषेध कॉकटेल के साथ 0.5 m dibutyryl cAMP (परिपक्वता के पक्ष में), 20 एनएम हिस्टोन deacetylase के अवरोधक (सेल चक्र से बाहर निकलने के लिए), 1 $M-secretase अवरोधक और विकास कारक, 10 एनजी/एमएल जीडीएनएफ, 10 एनजी/एमएल बीडीएनएफ, 1 एनजी/एमएल परिवर्तन विकास कारक $3 (टीजीएफजेड3), और 5 एनजी/एमएल एफजीएफ20 (दोनों पक्ष दा जनक जीवित रहने के पक्ष में)। माध्यम हर 2-3 दिन बदलें.
  6. दिन 21: तंत्रिका organoid उत्पन्न: PTFE झिल्ली (6 मिमी व्यास) पर हवा तरल इंटरफेस शर्तों के तहत 100 neurospheres के आसपास बीज. एक संस्कृति प्लेट डालने के लिए झिल्ली स्थानांतरण (0.4 मिमी) और तंत्रिका परिपक्वता माध्यम के 1.2 एमएल जोड़ने के रूप में पहले वर्णित neurosphere भेदभाव के लिए इस्तेमाल किया.
    1. इस चरण से कोई भी घुमाव रोकें. मध्यम हर 2-3 दिनों में बदलें जब तक आवश्यक भेदभाव समय बिंदु हासिल की है.
      नोट: तंत्रिका परिपक्वता के बारे में, तंत्रिका अपरिपक्व मार्कर Nestin की कमी और परिपक्व तंत्रिका मार्करों की वृद्धि - 3-tubulin और GFAP मनाया गया. उच्च TH और NURR1 अभिव्यक्ति मनाया गया (चित्र 3 C) और पुष्टि तंत्रिका organoid परिपक्वता11.

5. डोपामाइनर्जिक भेदभाव के सत्यापन के लिए TH और Nurr1 जीन अभिव्यक्ति की मात्रा

  1. आरएनए निष्कर्षण: भेदभाव के संकेत दिन पर, RLT बफर के 350 $L के साथ lyse 40 neurospheres (RNA निष्कर्षण किट में प्रदान की) 2-mercaptoethanol के 3.5 $L के साथ पूरक। निर्माता के निर्देशों का पालन एक आरएनए निष्कर्षण किट का उपयोग कर lysed neurospheres से आरएनए निकालें।
  2. कुल आरएनए सांद्रता की मात्रा निर्धारित करें।
  3. मात्रात्मक वास्तविक समय पॉलिमरेज श्रृंखला प्रतिक्रिया (QPCR) के लिए रिवर्स ट्रांसक्रिप्शन किट का उपयोग करकुल आरएनए निष्कर्षण के 300 एनजी के रिवर्स प्रतिलेखन प्रदर्शन और निर्माता के निर्देशों का पालन करें।
  4. असममित cyanine डाई का पता लगाने के आधार पर वास्तविक समय पीसीआर का पता लगाने प्रणाली पर QPCR विश्लेषण प्रदर्शन करते हैं। हाउसकीपिंग जीन के साथ डेटा को सामान्य करें: ग्लिसरऐल्डिहाइड-3-फॉस्फेट डिहाइड्रोजनेज (जीएपीडीएच) और दीर्घीकरण कारक 1-अल्फा (EF1)। प्राइमर के अनुक्रमों का वर्णन सारणी 1में किया गया है।

6. उच्च दबाव तरल क्रोमैटोग्राफी (HPLC) का पता लगाने

  1. डोपामाइन की उपस्थिति का पता लगाने के लिए इलेक्ट्रोकेमिकल डिटेक्शन के साथ उच्च दबाव तरल क्रोमैटोग्राफी (एचपीएलसी) का उपयोग करें। डोपामाइन एक जोरदार भंवर हर 5 मिनट के साथ 4 डिग्री सेल्सियस पर 15 मिनट के लिए 0.1 एन perchloric एसिड (HClO4) के 100 एमएल में तंत्रिका organoids lysing द्वारा निकाला गया था। सेंट्रीफ्यूगेशन के बाद, डोपामाइन खुराक के लिए -20 डिग्री सेल्सियस पर सुपरनेंट को इकट्ठा और स्टोर करें।
  2. 1 एमएल/मिनट की प्रवाह दर पर विपरित चरण HPLC द्वारा एनेलाइट्स को अलग करने के लिए सी-18 कॉलम (5 डिग्री मी, 4.6 मिमी x 150 मिमी) का उपयोग करें। डोपामाइन का पता लगाने के लिए एक coulometric डिटेक्टर कंडीशनिंग सेल की क्षमता पर सेट के साथ एक coulometric डिटेक्टर का उपयोग किया जाना चाहिए +200 एमवी.

7. microelectode सरणी (एमईए) मंच के साथ कच्चे डेटा रिकॉर्डिंग

  1. एक छिद्रयुक्त MEA डिवाइस के केंद्र में neurospheres हस्तांतरण करने के लिए एक विच्छेदन माइक्रोस्कोप का प्रयोग करें.
  2. इलेक्ट्रोफिजियोलॉजिकल रिकॉर्डिंग के लिए एम्पलीफायर और डेटा अधिग्रहण प्रणाली का उपयोग करें। एक ही 5 मिनट की अवधि में दर्ज spikes के औसत पीक-टू-पीक वोल्टेज के रूप में संकेत का उपयोग कर, एक 5 मिनट रिकॉर्डिंग के दौरान वोल्टेज के मानक विचलन के रूप में संकेत करने के लिए शोर अनुपात (SNR) को मापने।

Representative Results

इस प्रोटोकॉल के महत्वपूर्ण चरणों को अच्छी तरह से पहचाना और ठीक से हैंडल किया जाना चाहिए। इसलिए, प्रत्येक चरण के लिए समय चूक के साथ-साथ विभेदित प्रोटोकॉल के लिए प्रयुक्त यौगिकों को क्रमशः चित्र 1क में दर्शाया गया है तथा चित्र 3क के लिए सं योग एवं दा तंत्रिका organoids के लिए संस्कृति की स्थितियों का आरेख दर्शाया गया है। चित्र1ख,C,D,E,F कोशिकाओं, क्षेत्रों, और सं को दिखाता है और प्रत्येक चरण के लिए विशिष्ट आकृति विज्ञान दिखाता है। चित्रा 1 जी, एच, मैं कुछ तंत्रिका मार्करों के साथ इम्यूनोफ्लोरेसेंस धुंधला दिखाता है।

Figure 1
चित्र 1 : मानव तंत्रिका organoid (नहीं) विभेदन प्रोटोकॉल. (क) मानव भ्रूणीय स्टेम कोशिकाओं (एचईएससी) से व्युत्पन्न संकेल के उत्पादन के लिए मानकीकृत प्रोटोकॉल। (बी) हेसेक का रखरखाव एचईएससी माध्यम में बाह्य कोशिकीय मैट्रिक्स पर किया जाता है। (ग) माइक्रोवेल प्लेट्स का उपयोग अंशांकित न्यूरोस्फीयर उत्पन्न करने के लिए किया गया था। 2 सप्ताह में, neurospheres एक PTFE झिल्ली युक्त डालने पर चढ़ाया गया (स्केल बार $ 50 डिग्री मी). () 6 कूप प्लेट के एक कुएं में सं. पहले दिनों के दौरान, रोज़ेट (कालातीर) (ई ) मनाया गया। (च) शीर्ष पर कोई प्लस जीआईसी क्षेत्र का स्थूल दृश्य। (जी-मैं) कोई प्लस जीआईसी क्षेत्र के इम्यूनोफ्लोरेसेंस विश्लेषण (ईजीएफआर-पॉजिटिव; स्केल बार $ 50 डिग्री मी ) (जी) और अकेले नहीं, जिसने न्यूरोनल मार्कर के लिए प्रतिरक्षा प्रतिक्रिया को दिखाया - III-ट्यूबुलिन और नेस्टिंग के लिए थोड़ा सकारात्मक; तथापि, सिनैप्सिन 1 ने एक कमजोर संकेत दिखाया(ज,I) (स्केल बार ] 100 डिग्री ़ और 50 डिग्री उ क्रमशः)। कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें. 

Figure 2
चित्र 2 : नेक्रोटिक क्षेत्रों और अपरिपक्व सं की चित्रण. तंत्रिकामंडल (ए) और सं (बी) जब वे कुएं या बड़े आकार में बहुत अधिक होते हैं तो नेक्रोसिस से गुजरना पड़ सकता है (सी) (स्केल बार ] 10 डिग्री मी ) . () टमाटर के रिपोर्टर से संक्रमित एक जीआईसी ट्यूमर सेल आक्रमण को सं, स्केल बार, 10 डिग्री मी. तंत्रिका ट्यूबों () और कोई तंत्रिका ट्यूब ( एफ ) (स्केल बार ) (स्केल बार ] 50 डिग्री मी के साथ अपरिपक्व नहीं का उदाहरण देता है . कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 3
चित्र 3 : डीए तंत्रिका organoid की पीढ़ी के लिए मानकीकृत प्रोटोकॉल और इलेक्ट्रोफिजियोलॉजिकल और रूपात्मक विश्लेषण। (क) डीए न्यूरल ऑर्गनॉइड्स की पीढ़ी के लिए मानकीकृत प्रोटोकॉल। (बी) डीए तंत्रिका organoid के इम्यूनोफ्लोरेसेंस विश्लेषण; TH-immunoreactive कोशिकाओं सह-प्रतिव्यक्त Nurr1, एक midbrain विशिष्ट मार्कर (स्केल बार $ 50 डिग्री मी). Data माध्य के रूप में प्रस्तुत किए जाते हैं - SEM (द र् 3)। (ग) रेखांकन क्यूआरटी-पीसीआर द्वारा मूल्यांकन किए गए TH और Nurr1 जीन अभिव्यक्ति की गतिजता का प्रतिनिधित्व करते हैं। (डी) प्रतिनिधि HPLC: डोपामाइन चोटी (तीर) DA तंत्रिका organoid lysate से HPLC द्वारा पता लगाया गया था. (ई) एमईए प्लेटफॉर्म के साथ रिकॉर्ड किए गए कच्चे आंकड़ों का उदाहरण। प्रत्येक स्पाइक एक अनुलंब रेखा (समय टिकटों) द्वारा प्रदर्शित किया जाता है, जबकि शेष ट्रेस शोर है। (एफ) चित्र एक neurosphere का प्रतिनिधित्व करने के लिए मंत्रालय पर जमा. (छ) कच्चे डेटा से पता लगाए गए विशिष्ट स्पाइक्स (नीले और लाल वक्र) का अध्यारोपण। काला बोल्ड वक्र संगत लाल वक्रों के औसत को इंगित करता है। (एच) रैस्टर साजिश का पता लगाया प्रत्येक कील के साथ जुड़े समय टिकटों दिखा. अलग अलग रंग अलग इलेक्ट्रोड पर प्रकाश डाला. कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें. 

जीन फोवर्ड उल्टा
नूर1 GGCTGAAGCCATGCCTTGT जी.टी.जी.टी.जी.टी.सी.टी.टी.टी.टी.ए.टी.ए.टी.जी.ए.
Th जीसीसीसीटीसीजीसीजीसीटीटी CCCGAACTCCGTGAA
ईईएफ1 AGCAAAAAATGACCACAATG जीसीसीटीजीजीजीजीटीटीजीटा
जीएपीडीएच जीसीएकागागागागाडी AGGGGGATCAGTGTGGGT

तालिका 1: प्राइमर इस प्रोटोकॉल में इस्तेमाल किया।

Discussion

इस प्रोटोकॉल के सबसे महत्वपूर्ण पहलुओं में से एक सेल culturing और क्षेत्रों और तंत्रिका organoid आकारिकी के करीब निगरानी के दौरान HESC pluripotency के रखरखाव भी शामिल है. एचएसईएससी बहुत संवेदनशील होते हैं, और हर हेरफेर जल्दी अनियंत्रित भेदभाव के साथ-साथ सेल मौत का कारण बन सकता है। प्रयोगात्मक प्रजनन क्षमता बढ़ाने के लिए और असामान्य केरियोटाइप घटनाओं की घटना से बचने के लिए, उनके गुणसूत्र स्थिरता के सत्यापन के बाद सबसे कम मार्ग पर ईएससी के कई बैचों को क्रायोप्रोव करने की सलाह दी जाती है। इसके अलावा, यह प्रत्येक प्रयोग के लिए एक नई शीशी thaw और हर दिन कोशिकाओं के व्यवहार की जांच करने के लिए सिफारिश की है. यदि गोले असामान्य उच्च आकार के साथ कम अपवर्तक होते हैं, तो वे मिलने की संभावना को समेकित करना और मरना शुरू कर देंगे।

इस प्रणाली में एक सुधार या तो perfusion या एक संवहनी प्रणाली को लागू करने (endothelial कोशिकाओं को जोड़ने के द्वारा या एक 3 डी fluidic माइक्रोचिप के भीतर)12,13है . हालांकि, तंत्रिका organoid की मोटाई को नियंत्रित करने ($300 डिग्री मीटर) ऑक्सीजन और nutriments के कुशल निष्क्रिय भ्रम की अनुमति देता है और परिगलन से बचाता है. एक और सुधार प्रतिरक्षा कोशिकाओं (माइक्रोग्लिया) की शुरूआत है। मन में इन सीमाओं के साथ, तंत्रिका organoids प्लस एक जीआईसी प्रणाली कई कारणों के लिए एक प्रासंगिक उपकरण हो सकता है. सबसे पहले, इस प्रणाली दवा स्क्रीनिंग की निगरानी कैसे एक चिकित्सकीय यौगिक एक organoid या ट्यूमर सेल को प्रभावित कर सकता है की अनुमति देता है. दूसरा, सेल-टू-सेल बातचीत का अध्ययन किया जा सकता है, और व्यक्तिगत और सामूहिक हमलों के अंतर्निहित सूक्ष्म-पर्यावरणीय निर्धारकों की कल्पना की जा सकती है और 5,6,13का पता लगाया जा सकता है।

पार्किंसंस रोग के संदर्भ में, एक तंत्रिका organoid दा न्यूरॉन्स में समृद्ध रोग के विकास का अध्ययन करने के लिए एक प्रासंगिक और सटीक 3 डी मॉडल का प्रतिनिधित्व कर सकते हैं. पिछले अध्ययनों में, पार्किंसंस रोगी व्युत्पन्न प्रेरित pluripotent स्टेम कोशिकाओं दा न्यूरॉन्स की ओर विभेदित प्रभावित न्यूरॉन उपप्रकारों का अध्ययन करने के लिए इस्तेमाल किया गया है. ध्यान दें, कुछ रोग-संबंधी फीनोटाइप जैसे कि -साइनुक्लिइन का संचय तथा ऑक्सीडेटिव प्रतिबल के प्रति संवेदनशीलता14,15पाई गई है। इसके अलावा, तंत्रिका organoid चिकित्सकीय अणुओं स्क्रीन करने के लिए एक उपकरण के रूप में इस्तेमाल किया जा सकता है. हालांकि, विशिष्ट और प्रासंगिक readouts दा न्यूरॉन अस्तित्व और कार्यक्षमता का मूल्यांकन करने के लिए स्थापित किया जाना चाहिए, डोपामाइन उत्पादन और electrophysiological गतिविधि के रूप में. कुल मिलाकर, इस प्रोटोकॉल तंत्रिका organoids उत्पन्न करने के लिए दो मानकीकृत और सटीक स्टेम सेल आधारित दृष्टिकोण प्रदान करता है.

Disclosures

लेखक कोई प्रतिस्पर्धी वित्तीय हितों की घोषणा करते हैं.

Acknowledgments

लेखकों ला लीग Genevoise Contre ले कैंसर (Geneva, स्विट्जरलैंड), ISREC फाउंडेशन (लौसने, स्विट्जरलैंड), और अनुसंधान के लिए क्लेटन फाउंडेशन (Houston, TX, संयुक्त राज्य अमेरिका) वित्तीय सहायता के लिए धन्यवाद. इसके अलावा, लेखकों HES-HO और वित्तीय सहायता के लिए Wys केंद्र धन्यवाद. हम सहायक विचार विमर्श और समर्थन और सबूत पढ़ने के लिए डॉ Halah Kutaish के लिए Krause प्रयोगशाला धन्यवाद.

Materials

Name Company Catalog Number Comments
6-well plate (6-well plate) Falcon / Corning 07-201-588
ABI Prism 7900 HT detection system  (Real-Time PCR detection systems) Applied Biosystems Discontinued
Aggrewell 400 (Microwell culture plates ) StemCell Technologies 34421
Amplifier (W2100-HS32)  (Amplifier) Multi Channel Systems
Anti-EGFR (phospho Y1101) antibody Abcam ab76195 1/100 dilution
Anti-GFAP Antibody Dako  Z334  1/1000 dilution
Anti-Nestin, Human Antibody Millipore  ABD69  1/400 dilution
Anti-Synapsin I Antibody Chemicon  AB1543P  1/500 dilution
B27 supplements (B27) Life Technologies / Invitrogen 1238 For both protocol, stock solution 100x, final solution 1x
Brain-derived neurotrophic factor  (BDNF) Cell Guidance GFH1-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
CHIR-99021 (GSK-3β inhibitor ) Axon Medchem ct99021 For Dopaminergic protocol,  stock solution 7.5 mM in DMSO, final solution 3 µM
Compound E a γ–secretase inhibitor (γ–secretase inhibitor) Calbiochem CAS 209986-17-4 For both protocol (gamma-secretase inhibitor XXI),  stock solution 5 mM in DMSO, final solution 1 µM
Coulochem III  (Coulometric detector parameters) Thermo scientific
Dibutyryl cyclic-AMP (Dibutyryl cAMP) Sigma D0627 For Dopaminergic protocol,  stock solution 0.5 M in DMSO, final solution 0.5 mM
Dimethyl Sulfoxide Pure (DMSO) Sigma-Aldrich C6164 Compounds solvent, ready to use
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 12491-015 For cell culture, ready to use
Dulbecco's Modified Eagle Medium Mixture F-12 (DMEM-F12) Gibco 11320033 For cell culture, ready to use
EDTA 0.1 mM (EDTA) Life Technologies AM9912 For cell culture, ready to use
Epidermal Growth Factor (EGF) Gibco PHG0313 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
Fibroblast Growth Factor 20 (FGF20) Peprotech 100-41 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 5 ng/mL
fibroblast growth factor 8  (FGF8) Peprotech GFH176-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
Fibroblast growth factor-basic (bFGF) Gibco PHG0024 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
G5 supplements (G5) Invitrogen 17503012 For GIC culture, stock solution 100x, final solution 1x
Glial cell-derived neurotrophic factor (GDNF) Cell Guidance GFH2-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
Hydrophilic polytetrafluoroethylene  membrane (PTFE membrane) BioCell-Interface Discontinued
LDN-193189 (BMP inhibitor) Axon Medchem /Stemgen 04-0072-02 /1509 Dual/Smad,  stock solution 5 mM in DMSO, final solution 0.5 µM
L-glutamine (L-glutamine) Gibco 25030081 L-Glutamine (200 mM), stock solution 200 mM, final solution 2 mM
Matrigel (extracellular matrix) BD Biosciences 354277 hESC-qualified Matrix, stock solution 18-22 mg/mL, final solution 180-220 µg/mL
Millicell-CM Culture plate insert  (0.4 µm) (Culture plate insert) Millipore PICM03050
Monoclonal Anti-β-Tubulin III antibody Sigma  T8660  1/1000 dilution
MS Orbital Shaker, MS-NOR-30 (Orbital shaker) Major Science MS-NRC-30
N2 supplements (N2) Invitrogen 17502-048 For GIC culture, stock solution 100x, final solution 1x
Nanodrop (Nanodrop) Thermo Fisher Scientific Discontinued
Neurobasal (Neurobasal) Life Technologies / Gibco 21103049 Maintenance and maturation embryonic neuronal cell populations , ready to use
Non-Essential Amino Acids  (NEAA) Gibco 11140 Non-essential Amino Acids 100X, stock solution 100x, final solution 1x
Nurr1 Antibody (M-196) Santa Cruz Sc-5568 1/100 dilution
Nutristem  (hESC medium ) Biological Industries 05-100-1A Stem cell media, ready to use
Penicilin / Streptomycin  (Penicilin / Streptomycin ) Life Technologies / Gibco 15140122 For cell culture, stock solution 5 mg/mL, final solution 50 µg/mL 
Perchloric acid 0.1N (HCLO4) Merck 100519 For HPLC, ready to use
Phosphate Buffered Saline without Ca2+/Mg2+  (PBS without Ca2+/Mg2+ ) Life Technologies 14190250 For cell culture, ready to use
PrimeScript RT-PCR Kit (Reverse transcription kit) Takara RR014A
Purmorphamin (smoothened agonist) Calbiochem SML0868 For Dopaminergic protocol,  stock solution 10 mM in DMSO, final solution 2 µM
Rho-associated Kinase Y-27632 (ROCK) Abcam Biochemicals ab120129-1 Rock Inhibitor,  stock solution 50 mM in DMSO, final solution 10 µM
RNeasy mini kit (RNA extraction kit ) Qiagen 74104
SB-431542 (TGFβ/Activin/Nodal inhibitor ) Ascent Asc- 163 Dual-Smad,  stock solution 50 mM in DMSO, final solution 10 µM
Sonic Hedgehog (SHH) Cell Guidance GFH168-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
StemPro Accutase (hESC enzymatic solution) Gibco A11105-01 hESC enzymatic solution, ready to use
Symmetry C-18,5 mm (4.6 150mm2)  (Reversed-phase column) Waters Corporation
T150 flask (T150 flask) Falcon 08-772-1F
TH Antibody (F-11) Santa Cruz Sc-25269 1/200 dilution
Transforming Growth Factors beta 3 (TGFβ3) Cell Guidance GFH109-2 For Dopaminergic protocol,  stock solution 100 µg/mL in pure ethanol , final solution 1 ng/mL
Trichostatine A (inhibitor of histone deacetylase ) Sigma T8552 For Dopaminergic protocol,  stock solution 100 µM in DMSO, final solution 20 nM
TrypLE (recombinant enzymatic solution) Invitrogen 12604021 recombinant enzymatic solution, ready to use
Trypsin 0.25% (enzymatic solution) Life Technologies 15050065 enzymatic solution, ready to use
W2100, Multi Channel Systems (Data acquisition system ) WAT045905
X-vivo (serum free medium) Lonza BE04-743Q serum free medium, ready to use

DOWNLOAD MATERIALS LIST

References

  1. Louis, D. N., et al. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary. Acta Neuropathologica. 131, (6), 803-820 (2016).
  2. Stupp, R., et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. New England Journal of Medicine. 352, (10), 987-996 (2005).
  3. Daphu, I., et al. In vivo animal models for studying brain metastasis: value and limitations. Clinical and Experimental Metastasis. 30, (5), 695-710 (2013).
  4. Huszthy, P. C., et al. In vivo models of primary brain tumors: pitfalls and perspectives. Neuro Oncology. 14, (8), 979-993 (2012).
  5. Nayernia, Z., et al. The relationship between brain tumor cell invasion of engineered neural tissues and in vivo features of glioblastoma. Biomaterials. 34, (33), 8279-8290 (2013).
  6. Cosset, E., et al. Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials. 107, 74-87 (2016).
  7. Pringsheim, T., Jette, N., Frolkis, A., Steeves, T. D. The prevalence of Parkinson's's disease: a systematic review and meta-analysis. Movement Disorders. 29, (13), 1583-1590 (2014).
  8. Rajput, A. H., et al. Globus pallidus dopamine and Parkinson's motor subtypes: clinical and brain biochemical correlation. Neurology. 70, (16 Pt 2), 1403-1410 (2008).
  9. Jellinger, K. A. Pathology of Parkinson's's disease. Changes other than the nigrostriatal pathway. Molecular and Chemical Neuropathology. 14, (3), 153-197 (1991).
  10. Bernheimer, H., Birkmayer, W., Hornykiewicz, O., Jellinger, K., Seitelberger, F. Brain dopamine and the syndromes of Parkinson’s and Huntington. Clinical, morphological and neurochemical correlations. Journal of Neurological Science. 20, (4), 415-455 (1973).
  11. Tieng, V., et al. Engineering of midbrain organoids containing long-lived dopaminergic neurons. Stem Cells and Development. 23, (13), 1535-1547 (2014).
  12. Chen, C. S. 3D Biomimetic Cultures: The Next Platform for Cell Biology. Trends in Cell Biology. 26, (11), 798-800 (2016).
  13. Friedl, P., Sahai, E., Weiss, S., Yamada, K. M. New dimensions in cell migration. Nature Reviews Molecular Cell Biology. 13, (11), 743-747 (2012).
  14. Byers, B., et al. SNCA triplication Parkinson's's patient's iPSC-derived DA neurons accumulate alpha-synuclein and are susceptible to oxidative stress. PLoS ONE. 6, (11), e26159 (2011).
  15. Flierl, A., et al. Higher vulnerability and stress sensitivity of neuronal precursor cells carrying an alpha-synuclein gene triplication. PLoS ONE. 9, (11), e112413 (2014).
मस्तिष्क कैंसर और neurodegenerative रोगों का अध्ययन करने के लिए मानव तंत्रिका organoids
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).More

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter