Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Bioengineering

뇌암과 신경 퇴행성 질환을 연구하기위한 인간의 신경 오르가노이드

doi: 10.3791/59682 Published: June 28, 2019
* These authors contributed equally

Summary

이 연구는 1) 인간 에서독점적으로 인간 신경 유기 체 내 인간 교모세포종 개발 및 2) 뉴런 도파민성 연구를 위한 관련 및 정확한 모델로 두 개의 특정 인간 신경 오르가노이드를 도출하는 프로토콜을 소개하고 기술합니다. 3차원 오르가노이드를 생성하는 분화.

Abstract

관련 생체 외 신경 모델의 부족은 신경 병 증에 대 한 의료 진행에 중요 한 장애물. 관련 세포 모형의 설치는 이 질병의 병리학 적인 기계장치를 더 잘 이해하고 새로운 치료 표적 및 전략을 확인하기 위하여 둘 다 중요합니다. 관련이 있기 위해서는 시험관 내 모델이 인간 질병의 병리학 적 특징을 재현해야합니다. 그러나, 신경 퇴행성 질환의 맥락에서, 관련 시험관 내 모델은 귀중한 치료 기회로 신경 세포 교체를 제공해야합니다.

이러한 모델은 치료 분자의 스크리닝을 허용할 뿐만 아니라 신경 프로토콜 분화를 최적화하는 데에도 사용될 수 있다[예를 들어, 파킨슨병(PD)]에서 이식의 맥락에서]. 본 연구는 1) 인간 신경 오르가노이드 내 인간 교모세포종 발달(NO) 및 2) 3차원(3D) 오르가노이드를 생성하는 신경 도파민성(DA) 분화의 2개의 시험관내 프로토콜을 기술한다. 이를 위해, 인간 배아 줄기 세포(hESC) 분화로부터 유래된 크기 보정된 신경구의 생산을 허용하는 잘 표준화된 프로토콜이 확립되었다. 첫 번째 모델은 신경 오르가노이드 내의 교모세포종 발달 중에 발생하는 분자 및 세포 이벤트를 밝히는 데 사용될 수 있으며, DA 오르가노이드는 파킨슨 병의 세포 치료를위한 DA 뉴런의 적절한 공급원을 나타낼뿐만 아니라 약물 검사에 사용할 수 있습니다.

Introduction

세계 보건 기구 (WHO)는 낮은 학년 (II 등급) 또는 높은 등급 (학년 III 및 IV)로 성상 세포종을 분류합니다. 교모세포종 다형성 (GBM)은 성상 세포종 등급 IV, 1 차적인 뇌종양의 가장 치명적인,즉 치료의 모든 현재 형태에 저항1. 신경 외과, 화학 요법 및 방사선 요법을 포함한 표준 치료 치료에도 불구하고 GBM은 여전히 치명적이며 15 개월 전체생존율은 지난 15 년 동안 극적으로 변하지 않았습니다 2. GBM 병인을 이해하는 데 상당한 진전을 이루기 위해 관련 모델의 사용이 중요합니다. 지금까지 GBM의 연구는 자발적종양을 개발하는 쥐 또는 형질전환 마우스로 세포주, 설치류 organotypic 슬라이스, 및 환자 유래세포의 이종이식에 의존해 왔다 3,4. 이 모형은 두뇌 전이 및 종양 공격성을 공부하는 것이 유용했더라도, 그(것)들은 종 사이 다름에 의해 제한되고, 그 결과로 결론은 인간 조직으로 잘못 번역될 수 있습니다. 더욱이, 인간 세포를 가진 기존 모형은 또한 호스트조직/종양 상호 작용의 부재에 의해 제한됩니다 3,4. 실험 모델은 기초 과학에서 치료 대상으로의 번역에 매우 중요합니다. 따라서 GBM-발병 세포(GIC)와 함께 배양된 시험관 내 인간 신경 오르가노이드를 생산하는 프로토콜을 기술하는 것은 GBM 개발의 형태학적 및 기능적 특징을 모방하는 관련 시스템을 제공할 수 있다. 이 시스템은 침입 세포 및 괴사 영역의 확산 이동과 같은 GBM 발달의 생체 내 기능을 재현하고 종양 생물학과 관련된 유전자 발현을 강조합니다. 이전에 밝혀진 바와 같이, 몇몇 중요한 microRNAs는 3D신경 조직 내의 GIC 발달 도중 유도됩니다 5,6.

PD는 주요 신경 퇴행성 질환이며 다중 신경 아류형의 변성과 관련된7. 증상의 점진적 발병 (예를 들어, 운동 상실, 비대칭 휴식 떨림, 강성 및 자세 불안정성)이 질병을 특징짓는 경우에도 정확한 병인은 명확하게 확립되지 않습니다. 실제로, 많은 연구 결과는 중요한 위험 요소가 유전과 환경 요인의 조합에서 유래할 수 있다는 증거를 강조했습니다. 파킨슨병 증상은 서브스타민니아니그라(SN)에서 도파민성 뉴런의 양측 변성과 연관되며, 줄무늬8,9에돌출되는 도파민성(DA) 축종의 실종으로 이어진다. 따라서, striatal 도파민 수준의 감소는 PD 환자에서 모터 기능 장애의 진행과 상관 관계가 있다. 도파민성 뉴런은 아미노산 L-티로신을 L-3,4-디하이드록시페닐라닌(L-DOPA, 도파민 전구체)으로 변환하는 카테콜라미네르성 신경전달물질의 합성에 핵심적인 효소인 티로신 하이드록실라제(TH)를 함유하고 있다. TH 단백질 발현의 감소에 이어 TH 활성의 조기 손실은 PD의 특징이다.

이 연구는 TH 양성 세포로 농축 된 중뇌 와 같은 표현형을 지향한 인간 신경 오르가노이드를 사용하는 두 가지 프로토콜을 설명합니다.

Protocol

이 프로토콜은 제네바 대학의 인간 연구 윤리위원회의 지침을 따릅니다.

1. 미분화 인간 배아 줄기 세포 (hESCs)의 유지 보수 및 배양

  1. 특정 세포외 매트릭스로 접시를 사전 코팅하여 피더가 없는 조건에서 hSE의 유지 보수 및 확장을 수행합니다.
    1. 4 °C에서 세포 외 매트릭스의 300 μL을 해동 (전형적인 범위 농도 18-22 mg / mL, 얼음에 유지) 및 부드럽게 차가운 DMEM 매체의 15 mL와 혼합하여 세포 외 매트릭스의 조기 겔화를 방지할 수 있습니다. T150 플라스크에 세포외 산부인과 7.5mL를 추가합니다.
    2. 세포외 매트릭스로 코팅된 접시를 37°C에서 적어도 1시간(최대 하룻밤)에 배양합니다.
    3. 6.5 x 104 셀 /cm2의 밀도로 배지및 종자 hESCs를 제거합니다.
  2. HESC 배지와 1% 페니실린/스트렙토마이신에서 H1(hESC 세포주)을 유지합니다.
  3. 효소 절차로 세포를 통과하십시오 : 37 °C에서 1-2 분 동안 T75 cm2 플라스크에 7.5 mL의 효소 용액을 추가하십시오. 세포가 완전히 분리되면 7.5 mL의 DMEM-F12를 추가한 다음 300 x g에서 5 분 동안 원심 분리기를 추가하십시오. 더 나은 생존을 허용하기 위해, 세포외 매트릭스 코팅 접시상에 원하는 밀도로 세포를 재플레이트하고, 24시간 동안 Rho-관련 단백질 키나아제(ROCK) 억제제(10 μM)를 함유하는 동일한 배지에서.

2. GBM 연구를 위한 hESC 유래 신경 오르가노이드

  1. 3D 배양을 시작하기 전에 24 시간, 10 μM ROCK 억제제로 보충 된 혈청이없는 배지로 hESC 배지를 대체하십시오 (두 성분 모두 마이크로웰에서 응집 단계 동안 세포 생존 및 자발적 신경 구형 형성을 지원하는 데 필요합니다. 플레이트)를 참조하십시오. 세포는 60 % 합류에 있어야합니다. 다음날 (0일) hESC 콜로니를 단일 세포로 분리한 다음, 배지를 제거한 다음 Ca2+/Mg2+없이PBS로 헹구고 효소 용액 5 mL을 추가하고 37 °C에서 1-2 분 동안 배양하십시오.
  2. 10 μM의 ROCK 억제제로 세포를 수집하고 5 분 동안 300 x g의 세포를 원심 분리합니다. 상구체를 제거하고 10 μM의 ROCK 억제제로 보충된 무혈청 배지의 10 mL에서 세포를 계산합니다.
  3. 병렬로, 잘 당 혈청없는 매체의 2 mL로 마이크로 웰 플레이트를 헹구고 신경 구 형성을 방지 할 수있는 모든 기포를 제거하기 위해 5 분 동안 1200 x g의 플레이트를 원심 분리합니다.
  4. 10 μM ROCK 억제제로 보충된 무혈청 배지 12.5 mL에 28.2 x 10 6의 세포를 준비합니다. 1000 개의 세포 / 마이크로 웰을 분배하십시오. 세포를 300 x g에서 5분 동안 원심분리하고 밤새 37°C(최대 36시간)에서 인큐베이터에 플레이트를 놓습니다. 예를 들면: 30개의 인간 신경 오르가노이드를 얻으려면, 합류의 70%-80%에서 1개의 T150 플라스크를 사용하십시오 (대략 3천만 개의 세포).
  5. 다음날(1일차)에는 구(P1000)를 수집하고 6개의 웰 플레이트에 넣습니다. 각 우물에 B27 배지와 DMEM-F12 글루타맥스 및 신경기저 배지(1:1에서 혼합)를 2 mL 추가하고 1% B27 보충제와 1% 비필수 아미노산(NEAA)으로 보충합니다. 빠른 신경 유도를 촉진하기 위해, 10 μM TGFβ/액티빈/노달 억제제와 0.5 μM 골 모포제닉 단백질(BMP) 억제제로 구성된 이중 SMAD 억제 칵테일로 배지를 보충하십시오. 이 단계 앞으로, 구체는 회전 (60 rpm, 궤도 셰이커)에서 배양된다. 회전은 구가 서로 달라붙거나 플레이트에 달라붙지 않도록 하는 데 중요합니다.
  6. 매 2-3 일마다 매체를 변경하십시오 : 접시를 구부리고 구체가 5 분 동안 떨어지게하고, 배지 (2 mL)의 절반을 제거하고, 성장 인자와 억제물로 보충 된 신선한 B27 배지 2 mL를 추가하십시오. 구를 원심분리하지 마십시오.
  7. 다음 시간 과정에 따라 신경 유도를 수행합니다.
    1. 1-4일부터, 이중 SMAD로 보충된 B27 배지의 구체를 배양한다. 이중 SMAD 억제 칵테일 (10 μM TGFβ/액티빈/노달 억제제 및 0.5 μM BMP 억제제)는 신경 유도를 촉진합니다.
    2. 4-11일부터, 이중 SMAD 칵테일을 보충한 B27 배지에 10 ng/mL 표피 성장 인자(EGF) 및 10 ng/mL 기본 섬유아세포 인자(bFGF)를 추가하여 hESC 유래 신경 로제트(구체내)의 증식을 촉진합니다.
      참고: 11일째에는 대부분의 세포가 네스티안에 긍정적이어야 합니다.
    3. 11-13일부터, 0.5 μM BMP 억제제를 보충한 B27 배지에서 구체를 배양하였다.
    4. 13-21일부터, B27 배지에서 구체를 10 ng/mL 유래 신경영양 인자(GDNF), 10 ng/mL 뇌 유래 신경영양 인자(BDNF) 및 1 μM의 γ-분비효소 억제제로 보충하였다. GDNF및 BDNF는 신경및 신경교 분화를 촉진한다. γ-분비 효소 억제제는 더 큰 신경 성숙을 허용한다.
    5. 21일째에, 6개의 웰 플레이트용으로 설계된 배양 플레이트 인서트에 증착된 친수성 폴리테트라플루오로에틸렌(PTFE) 멤브레인(6 mm 직경, 0.4 μm)에 구체(약 1,000구)를 플레이트한다. 이 단계에서 회전을 중지합니다. 밝은 필드 현미경으로 관찰 된 장미의 존재는 신경 분화의 개시를 나타냅니다. 신경 로제트는 PTFE 막상의 구체를 도금한 후 2-3일 후에 관찰될 수 있다.
    6. B27 배지 의 1 mL을 성장 인자와 억제제 (따라) 멤브레인 삽입 아래 각 우물에 추가, 매 2-3 일 (일반적으로 월요일, 수요일 및 금요일), 다음 3 분화의 주.
    7. 21-25일부터, 동일한 신경 성숙 배지에서 인간 신경 오르가노이드를 육성한다(Cf. Step 2.7.4).
    8. 25-28일부터, B27 배지에 1 μM γ-분비효소 억제제만 을 보완한다.
    9. 28-39일부터, γ-분비효소 억제제 첨가를 중단하고 B27 배지에서만 인간 신경 오르가노이드 배양을 계속한다.
      참고: 3주 후, 신경 오르가노이드는 GIC 이식에 사용할 준비가 되었습니다. 신경 성숙을 따라, 신경 미성숙 마커 네스테틴의 감소 및 성숙한 신경 마커 β3-tubulin 및 GFAP의 증가가 관찰되었다.

3. 교모세포종 개시 세포(GIC)의 분리 및 재배

  1. 고급 인간 GBM 생검을 조각화하여 GIC를 분리합니다. 0.1 mM EDTA (4:1)에서 0.25 % 트립신을 함유한 비커에서 종양 조각을 옮기고 30-60 분 동안 37 °C에서 천천히 저어줍니다 (종양 크기에 따라 다름).
  2. 75 cm2 조직 배양 플라스크에서 해리 된 세포를 GIC 배지에서 cm2 당 2,500-5,000 세포로 도금: DMEM/F-12 배지 (1:1) 포함 1% N2, 1% B27, 그리고 1% G5 보충제 (GIC 생존을 선호 하기 위해), bFGF와 EGF (둘 다10에서) 보충 ng/Ml, 줄기를 촉진 하기 위해) 그리고 1% 페니실린/연쇄상 구균의.
  3. 일단 GIC는 잘 설립 하 고 성장, GIC 매체에서 N2와 G5 보충제를 제거.
  4. 하루 전에 세포를 오르가노이드에 추가하기 전에 GIC를 해리하고 계산하십시오.
  5. GIC 배지 2 mL로 마이크로웰 플레이트를 헹구고 최대 속도로 플레이트를 원심 분리하여 기포를 제거합니다(1000 x g). GIC를 1,000개의 세포에 배치하여 마이크로웰당 하나의 신경교종을 얻습니다. 37°C에서 하룻밤 동안배양한다(도 1C). 이 단계는 핵심이며 잘 보정된 GIC를 허용합니다(괴사 및 대형 GIC의 예는그림 2A,C에 나와 있음).
  6. GBM 침공을 시작하려면 큰 보어 파이펫 팁 (그림 1F)으로신경 조직 위에 하나의 신경교종 구를 추가하십시오. 조심스럽게 인큐베이터에 다시 6 웰 플레이트를 배치합니다.

4. PD 연구를 위한 hESC 유래 도파민성 오르가노이드

  1. 일 0: 최대 60% confluency (일 0)에서 2D 배양에서 hESCs를 증폭한 다음 혈청이없는 배지로 hESCs의 다능성 기능을 유지하는 데 사용되는 줄기 세포 매체를 대체하십시오. 0.5 μM BMP 억제제와 10 μM TGFβ/액티빈/노달 억제제(듀얼-SMAD 억제 칵테일)로 배양 배지를 보충하여 신경 유도를 시작한 다음, 24시간 동안 10 μM ROCK 억제제를 추가하여 통과 시 세포의 생존율을 높입니다.
  2. 1일차: 0.5 μM BMP 억제제, 10 μM TGFβ/액티빈/노달 억제제, 10 μM ROCK 억제제가 보충된 무혈청 배지 당 2.5 mL로 마이크로웰 플레이트를 준비합니다. 신경관의 복부 패턴을 향해 세포를 지정하려면 100 ng/mL 소닉 고슴도치(SHH), 100 ng/mL 섬유아세포 성장 인자 8(FGF8) 및 2 μM 스무드 작용제를 추가합니다. 1200 x g에서 5 분 동안 플레이트 (중간 및 세포가없는 경우)를 원심 분리하여 마이크로 웰에서 기포를 제거합니다.
    1. 2D에서 신경 유도의 1 일 후, 매체를 제거하고 신속하게 Ca2 + /MgCl 2+없이PBS로 씻어 . T75 cm2 플라스크에 재조합 효소 용액 7.5 mL을 추가하여 단일 세포 현탁액에서 콜로니를 해리합니다. 37 °C에서 2 분 동안 인큐베이션 한 다음 7.5 mL의 DMEM-F12로 완성합니다.
    2. 세포 현탁액과 원심분리기를 300 x g에서 5분 동안 수집한다.
    3. 중간 부피를 조정하여 마이크로웰당 1000개의 세포를 포함하는 신경구를 형성할 수 있도록 세포 현탁액을 구한다(예를 들어, 여기에 사용된 마이크로웰 플레이트는 웰당 4,700 마이크로웰을 함유한다). 따라서 배지의 2.5 mL에 470만 개의 세포를 준비하고 이미 플레이트에 배치된 배지의 이전 2.5 mL에 첨가합니다.
    4. 각 마이크로웰에 세포를 올바르게 분배하기 위해, 플레이트를 부드럽게 흔들고, 마이크로웰 플레이트를 5분 동안 300 x g으로 원심분리하고, 37°C에서 24시간 동안 플레이트를 인큐베이션하여 구체를 생성한다.
  3. 2일차: 매질로 마이크로웰을 부드럽게 세척한 다음, 조직 처리된 6웰 플레이트에 구체를 옮김을 채취합니다. 1% B27, 1x NEAA, 2 mML-글루타민, 1%의 페니실린/스트렙토마이신으로 보충된 신경기근 배지로 배지를 대체하십시오. 또한, 국소화 인자 SHH, FGF8, 스무디한 작용제 및 이중 SMAD 억제 소분자를 추가합니다.
    1. 구체를 37°C(60rpm, 궤도 셰이커)에서 회전시키고 2-3일마다 새로 보충된 반중간을 변경합니다.
  4. 3일차: 신경 유도를 강화하고 중뇌 정체성으로 신경 전구체로 전환하려면 Wnt/β-카테닌 경로를 활성화하는 3 μM GSK-3β 억제제로 배지를 보충하십시오. GSK-3β 억제제는 13일째까지 배지에서 유지한다. 두 개의 새로운 조직 처리 6 웰 플레이트로 분할하여 웰 당 두 구 밀도를 줄이고 구 응집을 방지합니다.
    참고: 8일째에는 대부분의 세포가 네스티안에 긍정적이어야 합니다.
  5. 일 8: 신경 성숙을 시작: 지역화 요인 SHH를 대체, FGF8, 부드러운 아고니스트, 및 듀얼 SMAD 억제 칵테일 0.5 mM 디부티릴 cAMP (성숙을 선호), 히스톤 deacetylase의 20 nM 억제제 (세포 주기 출구), 1 μM γ-secretase 억제제 및 성장 인자, 10 ng/mL GDNF, 10 ng/mL BDNF, 1 ng/mL 변혁 성장 인자 β3 (TGFβ3), 및 5 ng/mL FGF20 (둘 다 DA 조상 생존을 선호함). 2-3일마다 매체를 변경합니다.
  6. 일 21: 신경 오르가노이드를 생성: PTFE 멤브레인 (6 mm 직경)에 공기 액체 인터페이스 조건하에서 약 100 신경 구를 씨앗. 상기와 같이 배양 플레이트 삽입체(0.4 mm)로 멤브레인을 전달하고 신경구 분화에 사용되는 1.2 mL의 신경 성숙 배지를 추가한다.
    1. 이 단계에서 회전을 중지합니다. 필요한 분화 시점이 달성될 때까지 2-3일마다 배지를 변경합니다.
      참고: 신경 성숙에 관해서는, 신경 미성숙 마커 네스테틴의 감소 및 성숙한 신경 마커 β3-tubulin 및 GFAP의 증가가 관찰되었다. 높은 TH 및 NURR1 발현을 관찰하였다(도3C)신경오르가노이드 성숙도를확인11.

5. 도파민성 분화 검증을 위한 TH 및 Nurr1 유전자 발현정

  1. RNA 추출: 분화의 표시된 날에, 350 μL의 RLT 완충액 (RNA 추출 키트에서 제공)으로 40 신경 구를 2-메르카포에탄올3.5 μL로 보충하였다. 제조업체의 지시에 따라 RNA 추출 키트를 사용하여 용해된 신경구에서 RNA를 추출합니다.
  2. 총 RNA 농도를 정량화합니다.
  3. 정량적 실시간 폴리머라제 연쇄 반응(qPCR)을 위한 역전사 키트를 사용하여 총 RNA 추출의 300 ng의 역전사를 수행하고 제조사의 지시를 따른다.
  4. 비대칭 사이아닌 염료 검출을 기반으로 실시간 PCR 검출 시스템에서 qPCR 분석을 수행합니다. 하우스키핑 유전자: 글리세랄데히드-3-인산탈수소효소(GAPDH) 및 신장 계수인 1-알파(EF1)로 데이터를 정상화합니다. 프라이머의 서열은 1에 기재되어 있다.

6. 고압 액체 크로마토그래피 (HPLC) 검출

  1. 전기 화학 적 검출과 고압 액체 크로마토그래피 (HPLC)를 사용하여 도파민의 존재를 감지합니다. 도파민은 신경 오르가노이드를 100 mL의 0.1 N 과염소산(HClO4)에서 4°C에서 15분 동안 격렬한 소용돌이로 5분마다 추출하여 추출하였다. 원심분리 후, 도파민 투여량에 대해 상급체를 -20°C에서 수집하고 저장한다.
  2. C-18 컬럼(5μm, 4.6mm x 150mm)을 사용하여 1mL/분의 유량으로 등용 모드에서 역상 HPLC로 분석기를 분리합니다. 도파민의 검출은 +200 mV의 잠재력에 설정된 컨디셔닝 셀을 가진 coulometric 검출기를 사용하여 수행되어야 합니다.

7. 마이크로일렉트로노드 어레이(MEA) 플랫폼을 사용하여 원시 데이터 기록

  1. 해부 현미경을 사용하여 신경구를 다공성 MEA 장치의 중심으로 옮김을 전달합니다.
  2. 전기 생리학적 기록을 위해 증폭기 및 데이터 수집 시스템을 사용합니다. 신호 대 잡음 비(SNR)를 5분 기록 동안 전압의 표준 편차로 측정하고, 신호를 동일한 5분 동안 기록된 스파이크의 평균 피크 대 피크 전압으로 사용합니다.

Representative Results

이 프로토콜의 중요한 단계는 잘 식별되고 올바르게 처리되어야 합니다. 따라서, 분화 프로토콜에 사용되는 화합물뿐만 아니라 각 단계에 대한 시간 경과를 나타내는 배양 조건의 도면은 각각 NO 플러스 GBM 및 DA 신경 오르가노이드에 대한 도 1A도 3A에 예시된다. 도 1B,C, D, E, F는 세포, 구, 및 NO를 도시하고 각 단계에 대한 전형적인 형태를 보여준다. 도 1G,H,일부 신경 마커로 면역 형광 염색을 예시한다.

Figure 1
그림 1 : 인간 신경 오르가노이드 (NO) 차별화 프로토콜. (a) 인간 배아 줄기 세포(hESC)로부터 유래된 NO의 생성을 위한 표준화된 프로토콜. (B) hESCs는 hESC 배지에서 세포외 기매트릭스에서 유지된다. (C) 마이크로웰 플레이트를 사용하여 보정된 신경구를 생성하였다. 2주에서, 신경구는 PTFE 멤브레인을 함유하는 삽입물 위에 도금되었다(스케일 바 = 50 μm). (D) 6 웰 플레이트의 한 웰에 삽입에 NO의 매크로 뷰. 첫 날 동안, 장미 (검은 화살표)(E)를 관찰하였다. (F) 상단에 NO 플러스 GIC 구의 매크로 스코픽보기. (G-I) NO 플러스 GIC 구체의 면역형광 분석(EGFR-positive; scale bar =50 μm) (G) 및 NO 단독으로, 이는 뉴런 마커 βIII-tubulin에 대한 면역 반응성을 나타내고 중스테인에 대해 약간 양성; 그러나, 시냅신 1은 약한신호(H,I)를 나타내었다(스케일 바 = 100 μm 및 50 μm 각각). 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오. 

Figure 2
그림 2 : 괴사구와 미성숙한 NO의 일러스트레이션. 신경구(A) 및 NO(B)는 웰 또는 대형(C)에서 너무 많을 때괴사를 겪을 수 있다(스케일 바 = 10 μm). (D) 토마토 리포터에 감염된 1개의 GIC는 NO, 스케일 바, 10 μm에서 종양 세포 침각을 추적하는 데 도움을 주며, 신경관(E)과 신경관 없음(F)(스케일 바 = 50 μm)을 가진 미성숙 NO의 예이다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 3
그림 3 : DA신경오르가노이드 생성을 위한 표준화된 프로토콜 및 전기 생리학 및 형태 학적 분석. (A) DA 신경 오르가노이드의 생성을 위한 표준화된 프로토콜. (B) DA 신경 오르가노이드의 면역형광 분석; TH-면역 반응성 세포는 Nurr1을 공동 발현하고, 중뇌 특이적 마커(스케일 바 = 50 μm)를 발현한다. 데이터는 평균 ± SEM(n= 3)으로 표현된다. (C) 그래프는 qRT-PCR에 의해 평가된 TH 및 Nurr1 유전자 발현의 역학을 나타낸다. (D) 대표적인 HPLC: 도파민 피크(arrow)는 DA 신경 오르가노이드 에서 HPLC에 의해 검출되었다. (E) MEA 플랫폼으로 기록된 원시 데이터의 예. 각 스파이크는 수직 선(타임스탬프)으로 표시되는 반면 나머지 추적은 노이즈입니다. (F) MEA에 증착된 신경구를 나타내는 사진. (G) 원시 데이터에서 감지된 일반적인 스파이크(파란색 및 빨간색 곡선)의 중첩입니다. 검은색 굵은 곡선은 해당 빨간색 곡선의 평균을 나타냅니다. (H) 각 스파이크와 관련된 타임스탬프를 보여주는 래스터 플롯이 감지되었습니다. 서로 다른 색상은 서로 다른 전극을 강조 표시합니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오. 

유전자 포워드 (동) 역방향
누르 1 GGCTGAAGCCATCTTGT GTGAGCCATGCTAACTTGACA
GCACCTTCGCTCT CCCGAACTCCACCGTGAA
EEF1 아카아아아아아카카카카카카트 GCCTGGTTTTCAGGATA
갭DH GCACAAGAGGAA가가가가가가가아크 아게가가트카그그그그그그그그그

표 1: 이 프로토콜에 사용되는 프라이머.

Discussion

이 프로토콜의 가장 중요한 측면 중 하나는 세포 배양 및 구체 및 신경 조직 형태학의 면밀한 모니터링 동안 hESC 다능성의 유지를 포함한다. hESCs는 매우 민감하며 모든 조작은 세포 사멸뿐만 아니라 조기 통제되지 않은 분화로 이어질 수 있습니다. 실험 적 재현성을 높이고 비정상적인 karyotype 이벤트의 발생을 피하기 위해 염색체 안정성의 검증 후 가장 낮은 통로에서 여러 배치의 hESCs를 냉동 보존하는 것이 좋습니다. 또한, 각 실험에 대한 새로운 바이알을 해동하고 매일 세포의 행동을 확인하는 것이 좋습니다. 구체가 비정상적으로 높은 크기로 굴절이 적으면 집계되어 죽기 시작할 수 있습니다.

이 시스템에 대한 하나의 개선은 관류 또는 혈관화 시스템(내피 세포를 추가하거나 3D 유체 마이크로칩내)을 구현하는 것이다 12,13. 그러나 신경 오르가노이드(≤300 μm)의 두께를 제어하면 산소와 영양의 효율적인 수동 관류가 가능하고 괴사를 방지할 수 있습니다. 또 다른 개선은 면역 세포 (microglia)의 도입이다. 마음에 이러한 제한, 신경 오르가노이드 플러스 GIC 시스템은 여러 가지 이유로 관련 도구가 될 수 있습니다. 첫째, 이 시스템은 약물 스크리닝을 통해 치료 화합물이 오르가노이드 또는 종양 세포에 어떤 영향을 미칠 수 있는지 모니터링할 수 있습니다. 둘째, 세포 간 상호 작용을 연구할 수 있으며, 개인 및 집단 침략의 근간이 되는 미세 환경 결정요인을 5,6,13을시각화하고 탐구할 수 있다.

파킨슨 병의 맥락에서, DA 뉴런이 풍부한 신경 오르가노이드는 질병 발달을 연구하기 위해 관련성 있고 정확한 3D 모델을 나타낼 수 있습니다. 이전 연구에서, DA 뉴런으로 분화 된 파킨슨 병 환자 유래 유도 만능 줄기 세포는 영향을받는 신경 아류형을 연구하는 데 사용되었습니다. 참고로, α-synuclein의 축적과 같은 일부 질병 관련 표현형및 산화 스트레스에 대한 민감성은14,15로관찰되었다. 더욱이, 신경 오르가노이드는 치료 분자를 스크리미는 도구로 사용될 수 있다. 그러나, 특정 하 고 관련 된 판독 DA 신경 생존 및 기능을 평가 하도록 설정 해야 합니다., 도파민 생산 및 전기 생리 활성 등. 전부, 이 프로토콜은 신경 오르가노이드를 생성하는 2개의 표준화되고 정확한 줄기 세포 기지를 둔 접근을 제공합니다.

Disclosures

저자는 경쟁적인 재정적 이익을 선언하지 않습니다.

Acknowledgments

저자는 라 리그 제네보이스 콘트레 르 암 (제네바, 스위스), ISREC 재단 (로잔, 스위스), 그리고 연구를위한 클레이튼 재단 (휴스턴, 텍사스, 미국) 재정 지원을 감사드립니다. 또한, 저자는 HES-HO와 와이스 센터에 재정 지원을 감사드립니다. 우리는 도움이 토론과 지원에 대한 크라우스의 실험실과 교정에 대한 박사 할라 쿠태쉬에 감사드립니다.

Materials

Name Company Catalog Number Comments
6-well plate (6-well plate) Falcon / Corning 07-201-588
ABI Prism 7900 HT detection system  (Real-Time PCR detection systems) Applied Biosystems Discontinued
Aggrewell 400 (Microwell culture plates ) StemCell Technologies 34421
Amplifier (W2100-HS32)  (Amplifier) Multi Channel Systems
Anti-EGFR (phospho Y1101) antibody Abcam ab76195 1/100 dilution
Anti-GFAP Antibody Dako  Z334  1/1000 dilution
Anti-Nestin, Human Antibody Millipore  ABD69  1/400 dilution
Anti-Synapsin I Antibody Chemicon  AB1543P  1/500 dilution
B27 supplements (B27) Life Technologies / Invitrogen 1238 For both protocol, stock solution 100x, final solution 1x
Brain-derived neurotrophic factor  (BDNF) Cell Guidance GFH1-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
CHIR-99021 (GSK-3β inhibitor ) Axon Medchem ct99021 For Dopaminergic protocol,  stock solution 7.5 mM in DMSO, final solution 3 µM
Compound E a γ–secretase inhibitor (γ–secretase inhibitor) Calbiochem CAS 209986-17-4 For both protocol (gamma-secretase inhibitor XXI),  stock solution 5 mM in DMSO, final solution 1 µM
Coulochem III  (Coulometric detector parameters) Thermo scientific
Dibutyryl cyclic-AMP (Dibutyryl cAMP) Sigma D0627 For Dopaminergic protocol,  stock solution 0.5 M in DMSO, final solution 0.5 mM
Dimethyl Sulfoxide Pure (DMSO) Sigma-Aldrich C6164 Compounds solvent, ready to use
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 12491-015 For cell culture, ready to use
Dulbecco's Modified Eagle Medium Mixture F-12 (DMEM-F12) Gibco 11320033 For cell culture, ready to use
EDTA 0.1 mM (EDTA) Life Technologies AM9912 For cell culture, ready to use
Epidermal Growth Factor (EGF) Gibco PHG0313 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
Fibroblast Growth Factor 20 (FGF20) Peprotech 100-41 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 5 ng/mL
fibroblast growth factor 8  (FGF8) Peprotech GFH176-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
Fibroblast growth factor-basic (bFGF) Gibco PHG0024 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
G5 supplements (G5) Invitrogen 17503012 For GIC culture, stock solution 100x, final solution 1x
Glial cell-derived neurotrophic factor (GDNF) Cell Guidance GFH2-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
Hydrophilic polytetrafluoroethylene  membrane (PTFE membrane) BioCell-Interface Discontinued
LDN-193189 (BMP inhibitor) Axon Medchem /Stemgen 04-0072-02 /1509 Dual/Smad,  stock solution 5 mM in DMSO, final solution 0.5 µM
L-glutamine (L-glutamine) Gibco 25030081 L-Glutamine (200 mM), stock solution 200 mM, final solution 2 mM
Matrigel (extracellular matrix) BD Biosciences 354277 hESC-qualified Matrix, stock solution 18-22 mg/mL, final solution 180-220 µg/mL
Millicell-CM Culture plate insert  (0.4 µm) (Culture plate insert) Millipore PICM03050
Monoclonal Anti-β-Tubulin III antibody Sigma  T8660  1/1000 dilution
MS Orbital Shaker, MS-NOR-30 (Orbital shaker) Major Science MS-NRC-30
N2 supplements (N2) Invitrogen 17502-048 For GIC culture, stock solution 100x, final solution 1x
Nanodrop (Nanodrop) Thermo Fisher Scientific Discontinued
Neurobasal (Neurobasal) Life Technologies / Gibco 21103049 Maintenance and maturation embryonic neuronal cell populations , ready to use
Non-Essential Amino Acids  (NEAA) Gibco 11140 Non-essential Amino Acids 100X, stock solution 100x, final solution 1x
Nurr1 Antibody (M-196) Santa Cruz Sc-5568 1/100 dilution
Nutristem  (hESC medium ) Biological Industries 05-100-1A Stem cell media, ready to use
Penicilin / Streptomycin  (Penicilin / Streptomycin ) Life Technologies / Gibco 15140122 For cell culture, stock solution 5 mg/mL, final solution 50 µg/mL 
Perchloric acid 0.1N (HCLO4) Merck 100519 For HPLC, ready to use
Phosphate Buffered Saline without Ca2+/Mg2+  (PBS without Ca2+/Mg2+ ) Life Technologies 14190250 For cell culture, ready to use
PrimeScript RT-PCR Kit (Reverse transcription kit) Takara RR014A
Purmorphamin (smoothened agonist) Calbiochem SML0868 For Dopaminergic protocol,  stock solution 10 mM in DMSO, final solution 2 µM
Rho-associated Kinase Y-27632 (ROCK) Abcam Biochemicals ab120129-1 Rock Inhibitor,  stock solution 50 mM in DMSO, final solution 10 µM
RNeasy mini kit (RNA extraction kit ) Qiagen 74104
SB-431542 (TGFβ/Activin/Nodal inhibitor ) Ascent Asc- 163 Dual-Smad,  stock solution 50 mM in DMSO, final solution 10 µM
Sonic Hedgehog (SHH) Cell Guidance GFH168-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
StemPro Accutase (hESC enzymatic solution) Gibco A11105-01 hESC enzymatic solution, ready to use
Symmetry C-18,5 mm (4.6 150mm2)  (Reversed-phase column) Waters Corporation
T150 flask (T150 flask) Falcon 08-772-1F
TH Antibody (F-11) Santa Cruz Sc-25269 1/200 dilution
Transforming Growth Factors beta 3 (TGFβ3) Cell Guidance GFH109-2 For Dopaminergic protocol,  stock solution 100 µg/mL in pure ethanol , final solution 1 ng/mL
Trichostatine A (inhibitor of histone deacetylase ) Sigma T8552 For Dopaminergic protocol,  stock solution 100 µM in DMSO, final solution 20 nM
TrypLE (recombinant enzymatic solution) Invitrogen 12604021 recombinant enzymatic solution, ready to use
Trypsin 0.25% (enzymatic solution) Life Technologies 15050065 enzymatic solution, ready to use
W2100, Multi Channel Systems (Data acquisition system ) WAT045905
X-vivo (serum free medium) Lonza BE04-743Q serum free medium, ready to use

DOWNLOAD MATERIALS LIST

References

  1. Louis, D. N., et al. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary. Acta Neuropathologica. 131, (6), 803-820 (2016).
  2. Stupp, R., et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. New England Journal of Medicine. 352, (10), 987-996 (2005).
  3. Daphu, I., et al. In vivo animal models for studying brain metastasis: value and limitations. Clinical and Experimental Metastasis. 30, (5), 695-710 (2013).
  4. Huszthy, P. C., et al. In vivo models of primary brain tumors: pitfalls and perspectives. Neuro Oncology. 14, (8), 979-993 (2012).
  5. Nayernia, Z., et al. The relationship between brain tumor cell invasion of engineered neural tissues and in vivo features of glioblastoma. Biomaterials. 34, (33), 8279-8290 (2013).
  6. Cosset, E., et al. Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials. 107, 74-87 (2016).
  7. Pringsheim, T., Jette, N., Frolkis, A., Steeves, T. D. The prevalence of Parkinson's's disease: a systematic review and meta-analysis. Movement Disorders. 29, (13), 1583-1590 (2014).
  8. Rajput, A. H., et al. Globus pallidus dopamine and Parkinson's motor subtypes: clinical and brain biochemical correlation. Neurology. 70, (16 Pt 2), 1403-1410 (2008).
  9. Jellinger, K. A. Pathology of Parkinson's's disease. Changes other than the nigrostriatal pathway. Molecular and Chemical Neuropathology. 14, (3), 153-197 (1991).
  10. Bernheimer, H., Birkmayer, W., Hornykiewicz, O., Jellinger, K., Seitelberger, F. Brain dopamine and the syndromes of Parkinson’s and Huntington. Clinical, morphological and neurochemical correlations. Journal of Neurological Science. 20, (4), 415-455 (1973).
  11. Tieng, V., et al. Engineering of midbrain organoids containing long-lived dopaminergic neurons. Stem Cells and Development. 23, (13), 1535-1547 (2014).
  12. Chen, C. S. 3D Biomimetic Cultures: The Next Platform for Cell Biology. Trends in Cell Biology. 26, (11), 798-800 (2016).
  13. Friedl, P., Sahai, E., Weiss, S., Yamada, K. M. New dimensions in cell migration. Nature Reviews Molecular Cell Biology. 13, (11), 743-747 (2012).
  14. Byers, B., et al. SNCA triplication Parkinson's's patient's iPSC-derived DA neurons accumulate alpha-synuclein and are susceptible to oxidative stress. PLoS ONE. 6, (11), e26159 (2011).
  15. Flierl, A., et al. Higher vulnerability and stress sensitivity of neuronal precursor cells carrying an alpha-synuclein gene triplication. PLoS ONE. 9, (11), e112413 (2014).
뇌암과 신경 퇴행성 질환을 연구하기위한 인간의 신경 오르가노이드
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).More

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter