Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Bioengineering

Human neural Organoids for å studere Brain Cancer og nevrodegenerative sykdommer

doi: 10.3791/59682 Published: June 28, 2019
* These authors contributed equally

Summary

Denne studien introduserer og beskriver protokoller for å utlede to spesifikke menneskelige neural organoids som en relevant og nøyaktig modell for å studere 1) menneskelige glioblastom utvikling innen menneskelige nevrale organoids eksklusivt hos mennesker og 2) Nevron dopaminerg differensiering generere en tredimensjonal organoid.

Abstract

Mangelen på relevante in vitro nevrale modeller er en viktig hindring på medisinsk fremgang for neuropathologies. Etablering av relevante cellulære modeller er avgjørende både for å bedre forstå patologiske mekanismer av disse sykdommene og identifisere nye terapeutiske mål og strategier. For å være relevant, må en in vitro-modell reprodusere patologiske trekk ved en menneskelig sykdom. Men i sammenheng med nevrodegenerative sykdom, en relevant in vitro-modellen bør gi nevrale celle erstatning som en verdifull terapeutisk mulighet.

En slik modell ville ikke bare tillate screening av terapeutiske molekyler, men også kan brukes til å optimalisere nevrale protokollen differensiering [for eksempel i sammenheng med transplantasjon i Parkinsons sykdom (PD)]. Denne studien beskriver to in vitro protokoller av 1) menneskelige glioblastom utvikling innenfor en menneskelig neural organoids (NO) og 2) Nevron dopaminerg (DA) differensiering generere en tredimensjonal (3D) organoid. For dette formålet, en godt standardisert protokoll ble etablert som tillater produksjon av størrelse-kalibrert neurospheres avledet fra humant embryonale Stamcelle (hESC) differensiering. Den første modellen kan brukes til å avdekke molekylære og cellulære hendelser som forekommer under i glioblastom utvikling innenfor neural organoid, mens DA organoid ikke bare representerer en passende kilde til DA neurons for celle terapi i Parkinsons sykdom, men også kan brukes til narkotika testing.

Introduction

Verdenshelseorganisasjon (WHO) klassifiserer astrocytomas som lav grad (grad I til II) eller høy klasse (grad III og IV). Glioblastom multiforme (GBM) er en astrocytom grade IV, den mest dødelige av primære hjernesvulster, som er motstandsdyktig mot alle aktuelle former for behandlinger1. Til tross for standard-of-Care terapi inkludert nevrokirurgi, kjemoterapi, og strålebehandling, GBM fortsatt dødelig og 15-måneders total overlevelse har ikke dramatisk endret de siste 15 årene2. For å gjøre betydelige fremskritt i forståelsen GBM patogenesen, er bruken av relevante modeller nøkkelen. Så langt har studiet av GBM stolt på cellelinjer, gnagere organotypic skiver, og xenotransplantation av pasient-avledede celler til mus eller transgene mus utvikle spontane svulster3,4. Selv om disse modellene har vært nyttig å studere hjernen metastasering og tumor aggressivitet, de er begrenset av forskjeller mellom arter, og resulterende konklusjoner kan være feilaktig oversatt til menneskelig vev. Videre er eksisterende modeller med menneskelige celler også begrenset av fraværet av verten vev/tumor interaksjoner3,4. Eksperimentelle modeller er avgjørende for oversettelsen fra grunnleggende vitenskap til terapeutiske mål. Derfor beskriver en protokoll for å produsere in vitro menneskelige nevrale organoids co-kultivert med GBM-initiere celler (GICs) kan gi et relevant system som etterligner morfologiske og funksjonelle funksjoner i GBM utvikling. Dette systemet gjengir noen in vivo-funksjoner i GBM-developmentsuch som diffus migrering av invaderende celler og nekrose, og det fremhever genuttrykket som er relevant for tumor biologi. Som tidligere avslørt, er noen kritiske microRNAs indusert under GIC utvikling innen 3D nervøs vev5,6.

PD er en stor nevrodegenerative lidelse og forbundet med degenerasjon av flere neuronal under typer7. Selv om en progressiv utbruddet av symptomer (f. eks, rekkefølge, asymmetrisk hvile tremor, stivhet og holdning ustabilitet) karakteriserer sykdommen, dens eksakte etiologi er ikke klart etablert. Faktisk har mange studier fremhevet bevis for at store risikofaktorer kan skyldes en kombinasjon av genetiske og miljømessige faktorer. Parkinsonspasienter symptomer er forbundet med bilateral degenerasjon av dopaminerg neurons i substancia Nigra (SN), som fører til forsvinningen av dopaminerg (da) axons projisere til striatum8,9. Derfor, reduksjon av stria tale dopamin nivåer er korrelert med progresjon av motorisk dysfunksjon hos PD pasienter. Dopaminerg neurons inneholder tyrosin hydroksylase (TH), en nøkkel enzym i syntesen av catecholaminergic nevrotransmittere som konverterer aminosyren L-Tyrosin til L-3, 4-dihydroxyphenylalanine (L-DOPA, en dopamin forløper) til dopamin10. Tidlig tap av TH aktivitet etterfulgt av en nedgang i TH protein uttrykk er et kjennetegn på PD.

Denne studien beskriver to protokoller ved hjelp av menneskelige nevrale organoids, med en spesielt orientert mot en mellomhjernen-lignende fenotype beriket med TH-positive celler.

Protocol

Denne protokollen følger retningslinjene for universitetet i Genève menneskelige forskning etikk komiteen.

1. vedlikehold og kultur av udifferensierte menneskelige embryonale stamceller (hESCs)

  1. Utføre vedlikehold og utvidelse av hSECs på feeder-frie forhold ved pre-belegg retter med en bestemt ekstracellulære matrise.
    1. Tin 300 μL av ekstracellulære matrise ved 4 ° c (typisk rekkevidde konsentrasjon 18-22 mg/mL, holde på isen) og bland forsiktig med 15 mL kaldt DMEM medium for å unngå en prematur gelation av ekstracellulære matrise. Tilsett 7,5 mL av ekstracellulære matric til begge T150 flasker.
    2. Ruge rettene belagt med ekstracellulære matrise ved 37 ° c i minst 1 time (maks over natten).
    3. Fjern medium og frø hESCs til en tetthet på 6,5 x 104 celle/cm2.
  2. Oppretthold H1 (hESC cellelinje) i hESC medium og 1% penicillin/Streptomycin.
  3. Pass cellene med enzymatisk prosedyre: tilsett 7,5 mL enzymatisk løsning på en T75 cm2 kolbe over en periode på 1-2 min ved 37 ° c. Når cellene er helt løsrevet, tilsett 7,5 mL DMEM-F12 deretter sentrifuger i 5 min ved 300 x g. For å gi bedre overlevelse, re-plate celler ved ønsket tetthet på ekstracellulære matrise-belagte retter, i samme medium som inneholder Rho-assosiert protein kinase (ROCK) inhibitor (10 μM) for 24 h.

2. hESC-avledet neural organoids for GBM studier

  1. 24 timer før du starter 3D-kulturen, erstatter du hESC-mediet med et serum fritt medium supplert med 10 μM ROCK-hemmer (begge komponentene er nødvendige for å støtte celle overlevelse og spontan neurosphere dannelse under sammendrags fasen i en mikrotiterplateleser plate). Cellene bør være på 60% confluency. Neste dag (dag 0), løsne hESC kolonier som enkeltceller: fjerne mediet, og skyll med PBS uten ca2 +/mg2 +, tilsett 5 ml av enzymatisk oppløsning løsning, og ruge ved 37 ° c for 1-2 min.
  2. Samle cellene i serum fritt medium med 10 μM av ROCK-hemmer og sentrifuger cellene ved 300 x g i 5 min. Fjern supernatanten og Tell cellene i 10 ml serum fritt medium supplert med 10 ΜM av rock-hemmer.
  3. Parallelt, skyll mikrotiterplateleser plate med 2 mL serum fritt medium per brønn og sentrifuger platen ved 1200 x g i 5 min for å fjerne alle bobler, noe som kan hindre neurosphere dannelse.
  4. Forbered 28,2 x 106 av cellene i 12,5 ml serum fritt medium supplert med 10 μM rock inhibitor. Dispensere 1000 celler/mikrotiterplateleser. Sentrifuger cellene ved 300 x g i 5 min og Plasser platen i inkubator ved 37 ° c over natten (maks 36 h). For eksempel: for å få 30 menneskelige nevrale organoids, bruk en T150 kolbe på 70%-80% av samløpet (ca 30 000 000 celler).
  5. Neste dag (dag 1), samle kulene (med en P1000) og plassere dem i en 6 brønn plate. I hver brønn, tilsett 2 mL B27 medium og DMEM-F12 GlutaMAX og Neurobasal medium (bland på 1:1), supplert med 1% B27 kosttilskudd og 1% ikke-essensielle aminosyrer (NEAA). Å fremme rask neural induksjon, supplere mediet med dual-SMAD hemming cocktail, sammensatt av 10 μM TGFβ/Activin/Nodal inhibitor og 0,5 μM bein morphogenic protein (BMP) inhibitor. Fra dette skritt fremover, er kulene kultivert i rotasjon (60 RPM, orbital shaker). Rotasjonen er avgjørende for å hindre at kulene stikker sammen eller til platen.
  6. Endre mediet hver 2-3 dager: bøy platen og la kulene falle ned i 5 min, Fjern halvparten av mediet (2 mL), og tilsett 2 mL fersk B27 medium supplert med vekstfaktorer og hemmere. Ikke sentrifuger kulene.
  7. Utfør neural induksjon i henhold til følgende tid kurs:
    1. Fra dager 1-4, kultur kulene i B27 medium supplert med dual-SMAD. Den dual-SMAD hemming cocktail (10 μM TGFβ/Activin/Nodal inhibitor og 0,5 μM BMP inhibitor) fremme neural induksjon.
    2. Fra dager 4-11, fremme spredning av hESC-avledet nevrale rosetter (inn i kulene), ved å legge 10 ng/mL epidermal vekstfaktor (EGF) og 10 ng/mL grunnleggende Fibroblast faktor (bFGF) til B27 medium supplert med dual-SMAD cocktail.
      Merk: på dag 11, bør de fleste av cellene være positive for Nestin.
    3. Fra dager 11-13, kultur kulene i B27 medium supplert med 0,5 μM BMP inhibitor.
    4. Fra dager 13-21, kultur kulene i B27 medium supplert med 10 ng/mL gliacellene avledet nevrotropisk faktor (GDNF), 10 ng/mL hjernen avledet nevrotropisk faktor (BDNF) og 1 μM av γ-secretase inhibitor. GDNF og BDNF fremme neuronal og gliacellene differensiering. Den γ-secretase inhibitor gir større neural modning.
    5. På dag 21, plate kulene (ca 1 000 kuler) på en hydrofile polytetrafluoretylen (PTFE) membran (6 mm diameter, 0,4 μm) avsatt på en kultur plate sett designet for 6 brønn plate. Stopp enhver rotasjon fra dette trinnet. Tilstedeværelsen av rosetter, observert med en lys-feltet mikroskop, indikerer initiering av nevrale differensiering. De nevrale rosetter kan observeres 2-3 dager etter plating kuler på PTFE membranen.
    6. Tilsett 1 mL B27 medium supplert med vekstfaktorer og hemmere (som fulgte) til hver brønn under membranen setter inn, hver 2-3 dager (vanligvis på mandag, onsdag og fredag), for en følgende 3 uker med differensiering.
    7. Fra dager 21-25, dyrke menneskelige nevrale organoids i samme neural modning medium (CF. Step 2.7.4).
    8. Fra dager 25-28, bare utfylle B27 medium med 1 μM γ-secretase inhibitor.
    9. Fra dager 28-39, slutte å legge til γ-secretase inhibitor og fortsette menneskelige neural organoid kultur i B27 medium bare.
      Merk: etter 3 uker er neural organoids klar til bruk for GIC implantation. Langs neural modning, en reduksjon av nevrale umodne markør Nestin og økning av modne nevrale markører β3-tubulin og GFAP ble observert.

3. isolering og dyrking av glioblastom celler (GICs)

  1. Isolere GICs ved fragmentering en høy klasse menneskelige GBM biopsi. Overfør bit av tumor i et beger som inneholder 0,25% Trypsin i 0,1 mM EDTA (4:1) og rør langsomt ved 37 ° c for 30-60 min (avhengig av tumor størrelse).
  2. Plate de dissosiert cellene i 75 cm2 vev kultur flasker belagt ved 2500-5000 celler per cm2 i GIC medium: DMEM/F-12 medium (1:1) inneholder 1% N2, 1% B27, og 1% G5 kosttilskudd (for å favorisere GIC overlevelse), SUPPLERT med bFGF og EGF (begge ved 10 ng/ml, for å fremme stemness) og 1% av penicillin/Streptomycin.
  3. Når GIC er veletablert og voksende, fjerner du N2-og G5-tilleggene fra GIC-mediet.
  4. En dag før du legger cellene på organoid, distansere den GICs og telle dem.
  5. Skyll mikrotiterplateleser platen med 2 mL GIC medium og sentrifuger platen med maksimal hastighet for å fjerne bobler (1000 x g). Plasser GICs på 1 000 celler for å oppnå en gliomasphere per mikrotiterplateleser. Ruge over natten ved 37 ° c (figur 1C). Dette trinnet er nøkkelen og gir mulighet for godt kalibrert GICs (et eksempel på nekrotisk og overdimensjonerte GICs er vist i figur 2a,C).
  6. For å initiere GBM invasjon, tilsett en gliomasphere på toppen av nevrale vev med en stor bore Pipet spissen (figur 1F). Forsiktig plassere 6 brønn plate tilbake i inkubator.

4. hESC-avledet dopaminerg organoids for PD-studier

  1. Dag 0: Forsterk hESCs i 2D-kulturen opptil 60% confluency (dag 0), og erstatt deretter Stamcelle mediene som brukes til å opprettholde pluripotency funksjoner i hESCs med et serum fritt medium. Start neural induksjon ved å supplere kultur medium med 0,5 μM BMP inhibitor og 10 μM TGFβ/Activin/Nodal inhibitor (dual-SMAD hemming cocktail), legg deretter til 10 μM ROCK inhibitor for 24 h å øke overlevelse av celler under passering.
  2. Dag 1: klargjør mikrotiterplateleser platen med 2,5 mL per brønn av serum fritt medium supplert med 0,5 μM BMP-inhibitor, 10 μM TGFβ/Activin/Nodal-hemmer og 10 μM ROCK-hemmer. For å spesifisere celler mot ventrale mønster av Neural tube, tilsett 100 ng/mL Sonic Hedgehog (HYSJ), 100 ng/mL Fibroblast vekstfaktor 8 (FGF8), og 2 μM glattes Agonistiske. Sentrifuger platen (bare med middels og uten celler) ved 1200 x g i 5 min for å fjerne luftbobler fra microwells.
    1. Etter 1 dag av Neural induksjon i 2D, fjerne mediet og raskt vaske med PBS uten ca2 +/MgCl2 +. Distansere koloniene i enkeltceller suspensjon ved å legge 7,5 mL av rekombinant enzymatisk løsning i en T75 cm2 kolbe. Ruge i 2 minutter ved 37 ° c og deretter komplett med 7,5 mL DMEM-F12.
    2. Samle cellen suspensjon og sentrifuger på 300 x g i 5 min. fjerne supernatanten og telle cellene i samme medium som brukes til å forberede mikrotiterplateleser plate.
    3. Juster middels volum for å få en celle suspensjon slik at for å danne neurospheres som inneholder 1000 celler per mikrotiterplateleser (for eksempel mikrotiterplateleser platen som brukes her inneholder 4 700 microwells per brønn). Så, forberede 4 700 000 celler i 2,5 mL medium og legge det til forrige 2,5 mL medium allerede plassert i platen.
    4. For å kunne fordele cellene i hver mikrotiterplateleser på riktig måte, rist platen forsiktig og sentrifuger mikrotiterplateleser plate 300 x g i 5 min. ruge platen ved 37 ° c i 24 timer for å generere kuler.
  3. Dag 2: Skyll forsiktig microwells med mediet og samle deretter overføre kulene i vev-behandlet seks-brønn plate. Erstatt medium med Neurobasal medium supplert med 1% B27, 1x NEAA, 2 mM L-glutamin, og 1% av penicillin/Streptomycin. I tillegg legger regionalisering faktorer HYSJ, FGF8, glattes Agonistiske, og dual-SMAD hemming små molekyler.
    1. Plasser kuler i rotasjon ved 37 ° c (60 RPM, orbital shaker) og endre halv-medium fersk supplert hver 2-3 dager.
  4. Dag 3: for å forbedre neural induksjon og konvertere til nevrale forfedre med en mellomhjernen identitet, supplere mediet med 3 μM GSK-3β inhibitor, som aktiverer wnt/β-catenin veien. Oppretthold GSK-3β inhibitor i mediet opp til dag 13. Split i to nye vev-behandlet 6 brønn plater for å redusere både sfære tetthet per brønn og unngå sfære aggregering.
    Merk: på dag 8, bør de fleste av cellene være positive for Nestin.
  5. Dag 8: Start neural modning: erstatte regionalisering faktorer HYSJ, FGF8, glattes Agonistiske, og dual-SMAD hemming cocktail med 0,5 mM dibutyryl cAMP (for å favorisere modning), 20 nM hemmer av Histone deacetylase (for celle syklus exit), 1 μM γ-secretase hemmer og vekstfaktorer, 10 ng/mL GDNF, 10 ng/mL BDNF, 1 ng/mL transformere vekstfaktor β3 (TGFβ3), og 5 ng/mL FGF20 (begge favør DA stamfar overlevelse). Endre mediet hver 2-3 dager.
  6. Dag 21: Generer nevrale organoid: frø rundt 100 neurospheres under luft-væske-grensesnitt forhold på PTFE-membran (6 mm diameter). Overfør membranen til en kultur plate innsats (0,4 mm) og tilsett 1,2 mL av Neural modning medium som brukes for neurosphere differensiering som tidligere beskrevet.
    1. Stopp enhver rotasjon fra dette trinnet. Endre mediet hver 2-3 dager til den nødvendige differensiering tidpunktet er oppnådd.
      Merk: når det gjelder neural modning, en reduksjon av Neural umodne markør Nestin og økning av modne nevrale markører β3-tubulin og GFAP ble observert. Høy TH og NURR1 uttrykk ble observert (figur 3c) og bekrefte neural organoid modenhet11.

5. kvantifisering av TH og Nurr1 genuttrykk for validering av dopaminerg differensiering

  1. RNA-ekstraksjon: på den angitte dag av differensiering, lyse 40 neurospheres med 350 μL av RLT buffer (leveres i RNA Extraction Kit) supplert med 3,5 μL av 2-mercaptoethanol. Trekk ut RNA-en fra lysert-neurospheres ved hjelp av et RNA-avsugs sett etter produsentens anvisninger.
  2. Kvantifisere totalt RNA-konsentrasjoner.
  3. Utfør omvendt transkripsjon av 300 ng av den totale RNA-ekstraksjon ved hjelp av omvendt transkripsjon Kit for kvantitativ sanntids polymerase kjedere reaksjon (qPCR) og følg produsentens instruksjoner.
  4. Utfør qPCR-analyse i sanntid PCR deteksjon systemer, basert på asymmetrisk cyanine fargestoff deteksjon. Normalisere dataene med housekeeping gener: glyceraldehyde-3-fosfat dehydrogenase (GAPDH) og forlengelse faktor 1-Alpha (EF1). Sekvenser av primere er beskrevet i tabell 1.

6. høytrykks væske kromatografi (HPLC) deteksjon

  1. Bruk høytrykks væske kromatografi (HPLC) med elektrokjemiske deteksjon å oppdage tilstedeværelsen av dopamin. Dopamin ble ekstrahert ved lysering neural organoids i 100 mL 0,1 N perklorsyreblank syre (HClO4) i 15 min ved 4 ° c med en kraftig virvlingen hver 5 min. Etter sentrifugering, samle og lagre supernatanten ved-20 ° c for dopamin dosering.
  2. Bruk en C-18-kolonne (5 μm, 4,6 mm x 150 mm) for å skille analytter med reversert fase HPLC i isocratic modus med en strømningshastighet på 1 mL/minutt. Påvisning av dopamin bør utføres ved hjelp av en coulometriske detektor med condition celle satt på et potensial av + 200 mV.

7. rå data opptak med microelectode array (MEA) plattform

  1. Bruk et disseksjon mikroskop for å overføre neurospheres til midten av en porøs MEA-enhet.
  2. Bruk et forsterker-og datainnsamlingssystem for elektrofysiologisk innspillinger. Mål signal-til-støy-forhold (SNR) som standardavvik for spenningen under en 5 min innspilling, ved hjelp av signalet som gjennomsnittlig peak-to-peak spenning på toppene registrert i de samme 5 min perioder.

Representative Results

De kritiske trinnene i denne protokollen må være godt identifisert og håndtert på riktig måte. Derfor et diagram av kultur forhold som indikerer tidsforløp for hvert trinn, samt forbindelser som brukes for differensiering protokollen er illustrert i figur 1a og figur 3a for no pluss GBM og da neural organoids, henholdsvis. Figur 1B, C, D, E, F illustrerer cellene, KULENE og no og viser den typiske morfologi for hvert trinn. Figur 1g, H, illustrerer jeg immunofluorescence farging med noen nevrale markører.

Figure 1
Figur 1 : Human neural organoid (no) differensiering protokollen. (A) standardisert protokoll for GENERERING av no avledet fra humant embryonale stamceller (hESC). (B) hESCs vedlikeholdes på ekstracellulære matrise i hESC medium. (C) mikrotiterplateleser plater ble brukt til å generere kalibrert neurospheres. Ved 2 uker ble neurospheres belagt på innsatsen som inneholdt en PTFE-membran (skala bar = 50 μm). (D) makroskopisk syn på no inn i innsatsen i en brønn av en 6 brønn plate. I løpet av de første dagene, ble rosetter observert (svart pil) (E). (F) makroskopisk visning av et nei pluss GIC sfære på toppen. (G-I) Immunofluorescence analyse av NO pluss GIC sfære (EGFR-positive; skala bar = 50 μm) (G) og ingen alene, som viste immun reaktivitet for neuronal markør βIII-tubulin og litt positiv for nestin; synapsin 1 viste imidlertid et svakt signal (H, I) (skala bars = 100 μm og 50 μm, henholdsvis). Vennligst klikk her for å se en større versjon av dette tallet. 

Figure 2
Figur 2 : Illustrasjon av nekrotisk kuler og UMODNE no. Neurospheres (A) og no (B) kan gjennomgå nekrose når de er for mange i brønnen eller oversized (C) (Scale bar = 10 μm). (D) en GIC infisert med en tomat reporter bidra til å spore tumor celle INVASJON i ingen, skala bar, 10 μm. eksempel på umodne no med nevrale rør (E) og ingen nevrale rør (F) (Scale bar = 50 μm). Vennligst klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 : Standardisert protokoll for generering av da neural organoid og elektrofysiologisk og morfologiske analyse. (A) standardisert protokoll for GENERERING av da neural organoids. (B) Immunofluorescence analyse av da neural organoid; TH-immunoreactive celler co-uttrykker Nurr1, en mellomhjernen bestemt markør (skala bar = 50 μm). Data representeres som gjennomsnittet ± SEM (n = 3). (C) grafer representerer KINETICS av th og Nurr1 genuttrykk evaluert av QRT-PCR. (D) representative HPLC: dopamin Peak (arrow) ble oppdaget av HPLC fra da neural organoid lysat. (E) eksempel på rådata registrert med Mea plattform. Hver topp vises med en loddrett linje (tidsstempler), mens gjenværende spor er støy. (F) bilde representerer en neurosphere AVSATT på Mea. (G) superposisjon av vanlige pigger (blå og røde kurver) som oppdages fra rådata. Den svarte fet kurven indikerer gjennomsnittet av de tilsvarende røde kurvene. (H) raster plott viser tidsstemplene som er knyttet til hver topp oppdaget. De forskjellige fargene fremhever de forskjellige elektrodene. Vennligst klikk her for å se en større versjon av dette tallet. 

Genet Foward Omvendt
Nurr1 GGCTGAAGCCATGCCTTGT GTGAGGTCCATGCTAAACTTGACA
Th GCACCTTCGCGCAGTTCT CCCGAACTCCACCGTGAA
EEF1 AGCAAAAATGACCCACCAATG GCCTGGATGGTTCAGGATA
GAPDH GCACAAGAGGAAAGAGAGAGAACC AGGGGAGATTCAGTGTGGGT

Tabell 1: primere som brukes i denne protokollen.

Discussion

En av de mest kritiske aspektene ved denne protokollen inkluderer vedlikehold av hESC pluripotency under celle dyrking og tett oppfølging av kulene og neural organoid morfologi. hESCs er svært følsomme, og hver manipulasjon kan føre til tidlig ukontrollert differensiering samt celle død. For å øke eksperimentell reproduserbarhet og unngå forekomsten av unormale Karyotype hendelser, anbefales det å lagre nedfryste flere partier av hESCs på den laveste passasjen etter validering av deres kromosom stabilitet. Videre anbefales det å tine et nytt hetteglass for hvert eksperiment og kontrollere atferden til cellene hver dag. Hvis kulene er mindre brytnings med unormal høyere størrelse, vil de trolig begynne å samle og dø.

En forbedring på dette systemet er enten vascularized eller implementere en system (ved å legge endothelial celler eller i en 3D fluidic microchip)12,13. Men å kontrollere tykkelsen av nevrale organoid (≤ 300 μm) gir effektiv passiv tilførsel av oksygen og omdannelse og forhindrer nekrose. En annen forbedring er innføringen av immunceller (mikroglia). Med disse begrensningene i tankene, kan nevrale organoids pluss et GIC system være et relevant verktøy av flere grunner. Først, dette systemet gjør at stoffet screening for å overvåke hvordan en terapeutisk sammensatte kan påvirke en organoid eller tumor celle. For det andre kan celle-til-celle interaksjoner bli studert, og mikro-miljømessige faktorer underliggende individuelle og kollektive invasjoner kan bli visualisere og utforsket5,6,13.

I sammenheng med Parkinsons sykdom, en neural organoid beriket i DA neurons kan representere en relevant og nøyaktig 3D-modell for å studere sykdomsutvikling. I tidligere studier, Parkinsons pasient-avledet indusert Pluripotent stamceller differensiert mot DA neurons har blitt brukt til å studere de berørte neuronal under typer. Noen sykdoms relaterte fenotyper som Oppsamling av α-synuclein og følsomhet for oksidativt stress har blitt observert14,15. Videre kan neural organoid brukes som et verktøy for å skjermen terapeutiske molekyler. Men, spesifikke og relevante readouts bør settes opp for å evaluere DA Nevron overlevelse og funksjonalitet, for eksempel dopamin produksjon og elektrofysiologisk aktivitet. Alt i alt denne protokollen gir to standardiserte og nøyaktige stilk cellen-baserte tilnærminger til å generere nevrale organoids.

Disclosures

Forfatterne erklærer ingen konkurrerende finansielle interesser.

Acknowledgments

Forfatterne takker la Ligue Genevoise contre Le Cancer (Genève, Sveits), ISREC Foundation (Lausanne, Sveits), og Clayton Foundation for Research (Houston, TX, USA) for økonomisk støtte. Videre forfatterne takker HMS-HO og Wyss Center for økonomisk støtte. Vi takker Krause ' s Lab for nyttige diskusjoner og støtte og Dr. Halah Kutaish for korrekturlesing.

Materials

Name Company Catalog Number Comments
6-well plate (6-well plate) Falcon / Corning 07-201-588
ABI Prism 7900 HT detection system  (Real-Time PCR detection systems) Applied Biosystems Discontinued
Aggrewell 400 (Microwell culture plates ) StemCell Technologies 34421
Amplifier (W2100-HS32)  (Amplifier) Multi Channel Systems
Anti-EGFR (phospho Y1101) antibody Abcam ab76195 1/100 dilution
Anti-GFAP Antibody Dako  Z334  1/1000 dilution
Anti-Nestin, Human Antibody Millipore  ABD69  1/400 dilution
Anti-Synapsin I Antibody Chemicon  AB1543P  1/500 dilution
B27 supplements (B27) Life Technologies / Invitrogen 1238 For both protocol, stock solution 100x, final solution 1x
Brain-derived neurotrophic factor  (BDNF) Cell Guidance GFH1-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
CHIR-99021 (GSK-3β inhibitor ) Axon Medchem ct99021 For Dopaminergic protocol,  stock solution 7.5 mM in DMSO, final solution 3 µM
Compound E a γ–secretase inhibitor (γ–secretase inhibitor) Calbiochem CAS 209986-17-4 For both protocol (gamma-secretase inhibitor XXI),  stock solution 5 mM in DMSO, final solution 1 µM
Coulochem III  (Coulometric detector parameters) Thermo scientific
Dibutyryl cyclic-AMP (Dibutyryl cAMP) Sigma D0627 For Dopaminergic protocol,  stock solution 0.5 M in DMSO, final solution 0.5 mM
Dimethyl Sulfoxide Pure (DMSO) Sigma-Aldrich C6164 Compounds solvent, ready to use
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 12491-015 For cell culture, ready to use
Dulbecco's Modified Eagle Medium Mixture F-12 (DMEM-F12) Gibco 11320033 For cell culture, ready to use
EDTA 0.1 mM (EDTA) Life Technologies AM9912 For cell culture, ready to use
Epidermal Growth Factor (EGF) Gibco PHG0313 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
Fibroblast Growth Factor 20 (FGF20) Peprotech 100-41 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 5 ng/mL
fibroblast growth factor 8  (FGF8) Peprotech GFH176-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
Fibroblast growth factor-basic (bFGF) Gibco PHG0024 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
G5 supplements (G5) Invitrogen 17503012 For GIC culture, stock solution 100x, final solution 1x
Glial cell-derived neurotrophic factor (GDNF) Cell Guidance GFH2-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
Hydrophilic polytetrafluoroethylene  membrane (PTFE membrane) BioCell-Interface Discontinued
LDN-193189 (BMP inhibitor) Axon Medchem /Stemgen 04-0072-02 /1509 Dual/Smad,  stock solution 5 mM in DMSO, final solution 0.5 µM
L-glutamine (L-glutamine) Gibco 25030081 L-Glutamine (200 mM), stock solution 200 mM, final solution 2 mM
Matrigel (extracellular matrix) BD Biosciences 354277 hESC-qualified Matrix, stock solution 18-22 mg/mL, final solution 180-220 µg/mL
Millicell-CM Culture plate insert  (0.4 µm) (Culture plate insert) Millipore PICM03050
Monoclonal Anti-β-Tubulin III antibody Sigma  T8660  1/1000 dilution
MS Orbital Shaker, MS-NOR-30 (Orbital shaker) Major Science MS-NRC-30
N2 supplements (N2) Invitrogen 17502-048 For GIC culture, stock solution 100x, final solution 1x
Nanodrop (Nanodrop) Thermo Fisher Scientific Discontinued
Neurobasal (Neurobasal) Life Technologies / Gibco 21103049 Maintenance and maturation embryonic neuronal cell populations , ready to use
Non-Essential Amino Acids  (NEAA) Gibco 11140 Non-essential Amino Acids 100X, stock solution 100x, final solution 1x
Nurr1 Antibody (M-196) Santa Cruz Sc-5568 1/100 dilution
Nutristem  (hESC medium ) Biological Industries 05-100-1A Stem cell media, ready to use
Penicilin / Streptomycin  (Penicilin / Streptomycin ) Life Technologies / Gibco 15140122 For cell culture, stock solution 5 mg/mL, final solution 50 µg/mL 
Perchloric acid 0.1N (HCLO4) Merck 100519 For HPLC, ready to use
Phosphate Buffered Saline without Ca2+/Mg2+  (PBS without Ca2+/Mg2+ ) Life Technologies 14190250 For cell culture, ready to use
PrimeScript RT-PCR Kit (Reverse transcription kit) Takara RR014A
Purmorphamin (smoothened agonist) Calbiochem SML0868 For Dopaminergic protocol,  stock solution 10 mM in DMSO, final solution 2 µM
Rho-associated Kinase Y-27632 (ROCK) Abcam Biochemicals ab120129-1 Rock Inhibitor,  stock solution 50 mM in DMSO, final solution 10 µM
RNeasy mini kit (RNA extraction kit ) Qiagen 74104
SB-431542 (TGFβ/Activin/Nodal inhibitor ) Ascent Asc- 163 Dual-Smad,  stock solution 50 mM in DMSO, final solution 10 µM
Sonic Hedgehog (SHH) Cell Guidance GFH168-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
StemPro Accutase (hESC enzymatic solution) Gibco A11105-01 hESC enzymatic solution, ready to use
Symmetry C-18,5 mm (4.6 150mm2)  (Reversed-phase column) Waters Corporation
T150 flask (T150 flask) Falcon 08-772-1F
TH Antibody (F-11) Santa Cruz Sc-25269 1/200 dilution
Transforming Growth Factors beta 3 (TGFβ3) Cell Guidance GFH109-2 For Dopaminergic protocol,  stock solution 100 µg/mL in pure ethanol , final solution 1 ng/mL
Trichostatine A (inhibitor of histone deacetylase ) Sigma T8552 For Dopaminergic protocol,  stock solution 100 µM in DMSO, final solution 20 nM
TrypLE (recombinant enzymatic solution) Invitrogen 12604021 recombinant enzymatic solution, ready to use
Trypsin 0.25% (enzymatic solution) Life Technologies 15050065 enzymatic solution, ready to use
W2100, Multi Channel Systems (Data acquisition system ) WAT045905
X-vivo (serum free medium) Lonza BE04-743Q serum free medium, ready to use

DOWNLOAD MATERIALS LIST

References

  1. Louis, D. N., et al. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary. Acta Neuropathologica. 131, (6), 803-820 (2016).
  2. Stupp, R., et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. New England Journal of Medicine. 352, (10), 987-996 (2005).
  3. Daphu, I., et al. In vivo animal models for studying brain metastasis: value and limitations. Clinical and Experimental Metastasis. 30, (5), 695-710 (2013).
  4. Huszthy, P. C., et al. In vivo models of primary brain tumors: pitfalls and perspectives. Neuro Oncology. 14, (8), 979-993 (2012).
  5. Nayernia, Z., et al. The relationship between brain tumor cell invasion of engineered neural tissues and in vivo features of glioblastoma. Biomaterials. 34, (33), 8279-8290 (2013).
  6. Cosset, E., et al. Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials. 107, 74-87 (2016).
  7. Pringsheim, T., Jette, N., Frolkis, A., Steeves, T. D. The prevalence of Parkinson's's disease: a systematic review and meta-analysis. Movement Disorders. 29, (13), 1583-1590 (2014).
  8. Rajput, A. H., et al. Globus pallidus dopamine and Parkinson's motor subtypes: clinical and brain biochemical correlation. Neurology. 70, (16 Pt 2), 1403-1410 (2008).
  9. Jellinger, K. A. Pathology of Parkinson's's disease. Changes other than the nigrostriatal pathway. Molecular and Chemical Neuropathology. 14, (3), 153-197 (1991).
  10. Bernheimer, H., Birkmayer, W., Hornykiewicz, O., Jellinger, K., Seitelberger, F. Brain dopamine and the syndromes of Parkinson’s and Huntington. Clinical, morphological and neurochemical correlations. Journal of Neurological Science. 20, (4), 415-455 (1973).
  11. Tieng, V., et al. Engineering of midbrain organoids containing long-lived dopaminergic neurons. Stem Cells and Development. 23, (13), 1535-1547 (2014).
  12. Chen, C. S. 3D Biomimetic Cultures: The Next Platform for Cell Biology. Trends in Cell Biology. 26, (11), 798-800 (2016).
  13. Friedl, P., Sahai, E., Weiss, S., Yamada, K. M. New dimensions in cell migration. Nature Reviews Molecular Cell Biology. 13, (11), 743-747 (2012).
  14. Byers, B., et al. SNCA triplication Parkinson's's patient's iPSC-derived DA neurons accumulate alpha-synuclein and are susceptible to oxidative stress. PLoS ONE. 6, (11), e26159 (2011).
  15. Flierl, A., et al. Higher vulnerability and stress sensitivity of neuronal precursor cells carrying an alpha-synuclein gene triplication. PLoS ONE. 9, (11), e112413 (2014).
Human neural Organoids for å studere Brain Cancer og nevrodegenerative sykdommer
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).More

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter