Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Bioengineering

Organóides neurais humanos para estudar câncer cerebral e doenças neurodegenerativas

doi: 10.3791/59682 Published: June 28, 2019
* These authors contributed equally

Summary

Este estudo introduz e descreve protocolos para derivar dois organóides neurais humanos específicos como um modelo relevante e exato para estudar 1) desenvolvimento humano do glioblastoma dentro dos organóides neural humanos exclusivamente nos seres humanos e 2) neurônio dopaminérgicos diferenciação, gerando um organoide tridimensional.

Abstract

A falta de modelos neurais in vitro relevantes é um importante obstáculo ao progresso médico para as neuropatologias. O estabelecimento de modelos celulares relevantes é crucial para melhor compreender os mecanismos patológicos dessas doenças e identificar novos alvos e estratégias terapêuticas. Para ser pertinente, um modelo in vitro deve reproduzir as características patológicas de uma doença humana. Entretanto, no contexto da doença neurodegenerativas, um modelo in vitro relevante deve fornecer a recolocação da pilha neural como uma oportunidade terapêutica valiosa.

Tal modelo permitiria não somente a seleção de moléculas terapêuticas mas igualmente pode ser usado para aperfeiçoar a diferenciação neural do protocolo [por exemplo, no contexto da transplantação na doença de Parkinson (paládio)]. Este estudo descreve dois protocolos in vitro de 1) desenvolvimento humano do glioblastoma dentro de um organóides neural humano (no) e de 2) diferenciação dopaminérgicos (da) do neurônio que gera um organoid tridimensional (3D). Para tanto, estabeleceu-se um protocolo bem padronizado que permite a produção de neuroesferas calibradas por tamanho derivadas da diferenciação de células-tronco embrionárias humanas (hESC). O primeiro modelo pode ser usado para revelar os eventos moleculars e celulares que ocorrem durante no desenvolvimento do glioblastoma dentro do organoid neural, quando o organoid DA DA representar não somente uma fonte apropriada de neurônios DA DA para a terapia da pilha na doença de Parkinson mas igualmente pode ser usado para testes de drogas.

Introduction

A Organização Mundial da saúde (OMS) classifica os astrocitomas como grau baixo (grau I a II) ou alto grau (grau III e IV). Glioblastoma multiforme (GBM) é um astrocitoma grau IV, o mais letal dos tumores cerebrais primários, que é resistente a todas as formas atuais de tratamentos1. Apesar da terapia do padrão--cuidado que inclui a neurocirurgia, a quimioterapia, e a radioterapia, GBM permanece fatal e a taxa de sobrevivência total de 15 meses não mudou dramàtica sobre os 15 anos passados2. Para fazer progressos significativos na compreensão da patogênese da GBM, o uso de modelos relevantes é fundamental. Até o momento, o estudo da GBM baseou-se em linhagens celulares, fatias organootípicas de roedores e xenotransplante de células derivadas de pacientes em camundongos ou camundongos transgênicos desenvolvendo tumores espontâneos3,4. Embora esses modelos tenham sido úteis para estudar a metástase cerebral e a agressividade tumoral, eles são restritos por diferenças entre as espécies, e as conclusões resultantes podem ser traduzidas incorretamente para os tecidos humanos. Além disso, os modelos existentes com células humanas também são limitados pela ausência de interações tecido/tumor do hospedeiro3,4. Os modelos experimentais são críticos para a tradução da ciência básica para alvos terapêuticos. Portanto, descrever um protocolo para produzir organóides neurais humanos in vitro cocultivados com células iniciadores de GBM (GICs) pode fornecer um sistema relevante que imita características morfológicas e funcionais do desenvolvimento da GBM. Este sistema reproduz algumas características in vivo de desenvolvimentosgbm como migração difusa de células invasoras e áreas de necrose, e destaca a expressão gênica relevante para a biologia tumoral. Como revelado anteriormente, alguns microRNAs críticos são induzidos durante o desenvolvimento do GIC dentro do tecido nervoso 3D5,6.

O PD é uma desordem neurodegenerativas principal e associado com a degeneração de subtipos neuronal múltiplos7. Mesmo que um início progressivo dos sintomas (por exemplo, bradicinesia, tremor assimétrico do descanso, rigidez e instabilidade da postura) caracterize a doença, sua etiologia exata não é estabelecida claramente. Na verdade, muitos estudos têm destacado evidências de que os principais fatores de risco podem resultar de uma combinação de fatores genéticos e ambientais. Os sintomas de parkinsonianos estão associados à degeneração bilateral dos neurônios dopaminérgicos na substancia nigra (SN), levando ao desaparecimento de axônios dopaminérgicos (da) projetando-se para o estriado8,9. Portanto, a redução dos níveis de dopamina estriatal está correlacionada com a progressão da disfunção motora em pacientes com DP. Os neurônios dopaminérgicos contêm Tirosina Hidroxilase (TH), uma enzima chave na síntese de neurotransmissores catecolaminérgicos que converte o aminoácido L-tirosina para L-3,4-dihidroxifenilalanina (L-DOPA, um precursor de dopamina) para dopamina10. A perda adiantada da atividade do TH seguiu por um declínio na expressão da proteína do TH é uma indicação do paládio.

Este estudo descreve dois protocolos usando organoids neurais humanos, com um orientado especificamente para um midbrain-como o phenotype enriquecido com as pilhas do TH-positive.

Protocol

Este protocolo segue as diretrizes do Comitê de ética em pesquisa humana da Universidade de Genebra.

1. manutenção e cultura de células-tronco embrionárias humanas não diferenciadas (hESCs)

  1. Realize manutenção e expansão de hSECs em condições livres de alimentador por pré-revestimento de pratos com uma matriz extracelular específica.
    1. Descongelar 300 μL de matriz extracelular a 4 ° c (concentração típica de faixa 18-22 mg/mL, manter no gelo) e misturar suavemente com 15 mL de meio DMEM frio para evitar a geladura prematura da matriz extracelular. Adicione 7,5 ml do Matric extracelular a ambos os frascos T150.
    2. Incubar os pratos revestidos com matriz extracelular a 37 ° c durante pelo menos 1 h (máximo durante a noite).
    3. Remova o meio e as sementes de hESCs a uma densidade de 6,5 x 104 Cell/cm2.
  2. Manter H1 (linha celular hESC) em meio hESC e 1% de penicilina/estreptomicina.
  3. Passar as células com procedimento enzimático: Adicionar 7,5 mL de solução enzimática a um balão de T75 cm2 durante um período de 1-2 min a 37 ° c. Uma vez que as células estão completamente desanexadas, adicione 7,5 mL de DMEM-F12, em seguida, centrifugar por 5 min a 300 x g. Para permitir uma melhor sobrevida, re-placas de células na densidade desejada para os pratos de matriz extracelular-revestido, no mesmo meio contendo Rho-associado proteína quinase (ROCK) inibidor (10 μM) para 24 h.

2. organóides neurais derivados de hESC para estudos de GBM

  1. 24 h antes de iniciar a cultura 3D, substitua o meio hESC por um meio livre de soro suplementado com 10 μM de inibidor de rocha (ambos os componentes são necessários para apoiar a sobrevivência celular e formação de neurofera espontânea durante a fase de agregação em um micropoço da placa). As células devem estar em 60% de confluência. No dia seguinte (dia 0), separe as colônias de hESC como células únicas: Retire o meio, depois enxague com PBS sem CA2 +/mg2 +, acrescente 5 ml de solução de dissolução enzimática e incubar a 37 ° c por 1-2 min.
  2. Colete as células em meio livre de soro com 10 μM de inibidor de rocha e Centrifugue as células em 300 x g por 5 min. Retire o sobrenadante e conte as células em 10 ml de meio livre de soro suplementado com 10 μm de inibidor de rocha.
  3. Em paralelo, enxague a placa de micropoços com 2 mL de meio livre de soro por poço e centrifugue a placa em 1200 x g por 5 min para remover todas as bolhas, o que pode prevenir a formação da neurofera.
  4. Prepare 28,2 x 106 de células em 12,5 ml de meio livre de soro suplementado com 10 μm de inibidor de rocha. Dispensar 1000 células/micropoços. Centrifugue as pilhas em 300 x g por 5 minutos e coloc a placa na incubadora em 37 ° c durante a noite (máximo 36 h). Por exemplo: para obter 30 organóides neurais humanos, use um balão de T150 a 70%-80% da confluência (cerca de 30 milhões células).
  5. No dia seguinte (dia 1), recolher as esferas (com um P1000) e colocá-los em uma placa de 6 poços. Em cada poço, adicionar 2 mL de meio B27 e DMEM-F12 GlutaMAX e Neurobasal médio (Mix em 1:1), suplementado com 1% B27 suplementos e 1% não essenciais aminoácidos (NEAA). Para promover a indução neural rápida, complemente o meio com o coquetel de inibição Dual-SMAD, composto de 10 μM de inibidor TGFβ/activin/nodal e inibidor da proteína morfogênica óssea de 0,5 μM (BMP). A partir deste passo em frente, as esferas são cultivadas em rotação (60 RPM, agitador orbital). A rotação é fundamental para evitar que as esferas grudem juntas ou na chapa.
  6. Mude o meio cada 2-3 dias: dobre a placa e deixe as esferas cair para baixo por 5 minutos, remova a metade do meio (2 mL), e adicione 2 mL do meio B27 fresco suplementado com os fatores de crescimento e os nervos inibidores. Não Centrifugue as esferas.
  7. Realize a indução neural de acordo com o seguinte curso do tempo:
    1. A partir de dias 1-4, a cultura das esferas em B27 médio suplementado com Dual-SMAD. O coquetel de inibição Dual-SMAD (10 μM de inibidor TGFβ/activin/nodal e inibidor de 0,5 μM BMP) promove a indução neural.
    2. A partir dos dias 4-11, promover a proliferação de rosetas neurais derivadas de hESC (nas esferas), adicionando 10 ng/mL fator de crescimento epidérmico (EGF) e 10 ng/mL fator de fibroblastos básicos (bFGF) para o meio B27 suplementado com duplo-SMAD cocktail.
      Nota: no dia 11, a maioria das células deve ser positiva para Nestin.
    3. A partir dos dias 11-13, a cultura das esferas em meio B27 suplementado com 0,5 μM de inibidor BMP.
    4. A partir dos dias 13-21, a cultura das esferas em meio B27 suplementado com 10 ng/mL glial derivado fator neurotrófico (GDNF), 10 ng/mL cérebro derivado fator neurotrófico (BDNF) e 1 μM de γ-secretase inibidor. GDNF e BDNF promovem a diferenciação neuronal e glial. O inibidor da γ-secretase permite maior maturação neural.
    5. No dia 21, placa as esferas (aproximadamente 1.000 esferas) em uma membrana hidrofílico do politetrafluoretileno (PTFE) (diâmetro de 6 milímetros, 0,4 μm) depositada em uma inserção da placa da cultura projetada para a placa de 6 poços. Pare qualquer rotação desta etapa. A presença de rosettes, observada com um microscópio do brilhante-campo, indica o início da diferenciação neural. Os rosetas neural podem ser observados 2-3 dias após esferas do chapeamento na membrana de PTFE.
    6. Adicione 1 mL de meio B27 suplementado com fatores de crescimento e inibidores (como seguido) a cada poço embaixo da pastilha de membrana, a cada 2-3 dias (geralmente na segunda-feira, quarta e sexta-feira), para uma seguinte 3 semanas de diferenciação.
    7. A partir dos dias 21-25, cultivar organóides neurais humanos no mesmo meio de maturação neural (cf. Step 2.7.4).
    8. A partir dos dias 25-28, apenas complementam o meio B27 com 1 μM de inibidor de γ-secretase.
    9. Dos dias 28-39, pare de adicionar o inibidor de γ-secretase e continue a cultura organoid neural humana no meio B27 somente.
      Observação: após 3 semanas, os organóides neurais estão prontos para uso para implantação de GIC. Ao longo da maturação neural, observou-se diminuição do marcador neural imaturo Nestin e aumento dos marcadores neurais maduros β3-tubulin e GFAP.

3. isolamento e cultivo de glioblastoma-células iniciantes (GICs)

  1. Isole GICs fragmentando uma biópsia humana do GBM da classe elevada. Transfira o pedaço de tumor em uma taça contendo 0,25% de tripsina em 0,1 mM de EDTA (4:1) e mexa lentamente a 37 ° c por 30-60 min (dependendo do tamanho do tumor).
  2. Placa as células dissociadas em 75 cm2 frascos de cultura de tecidos revestidos a 2500-5000 células por cm2 em meio GIC: DMEM/F-12 médio (1:1) contendo 1% N2, 1% B27 e 1% G5 suplementos (para favorecer a sobrevivência do GIC), suplementados com bFGF e EGF (ambos em 10 ng/ml, para promover a stemness) e 1% de penicilina/estreptomicina.
  3. Uma vez que o GIC está bem estabelecido e crescendo, remova os suplementos de N2 e G5 do meio de GIC.
  4. Um dia antes de adicionar as células para o organóide, dissociar os GICs e contá-los.
  5. Enxague a placa de micropoços com 2 mL de meio GIC e centrifugue a placa na velocidade máxima para remover as bolhas (1000 x g). Coloque as GICs em 1.000 células para obter um gliomasphere por micropoços. Incubar durante a noite a 37 ° c (Figura 1C). Esta etapa é fundamental e permite que as GICs bem calibradas (um exemplo de GICs necrótico e de tamanho grande seja mostrada na Figura 2a,C).
  6. Para iniciar a invasão de GBM, adicione um gliomasphere em cima do tecido neural com uma ponta de Pipet grande furo (Figura 1F). Coloc com cuidado a placa de 6 poços para trás na incubadora.

4. organóides dopaminérgicos derivados de hESC para estudos de PD

  1. Dia 0: amplificar os hESCs na cultura 2D até 60% de confluência (dia 0), em seguida, substitua os meios de células-tronco usados para manter as características de pluripotência de hESCs com um meio livre de soro. Inicie a indução neural completando o meio de cultura com inibidor de 0,5 μM BMP e 10 μM TGFβ/activin/inibidor nodal (duplo-SMAD inibição cocktail), em seguida, adicione 10 μM de inibidor de rocha para 24 h para aumentar a taxa de sobrevivência das células durante a passagem.
  2. Dia 1: Prepare a placa de micropoços com 2,5 mL por poço de meio livre de soro suplementado com inibidor de 0,5 μM BMP, 10 μM de inibidor de TGFβ/activin/nodal e inibidor de rocha de 10 μM. Para especificar células para o padrão ventral do tubo neural, adicione 100 ng/mL Sonic Hedgehog (SHH), 100 ng/mL fator de crescimento de fibroblastos 8 (FGF8), e 2 μM de agonista suavizada. Centrifugue a placa (somente com meio e sem pilhas) em 1200 x g por 5 minutos para remover as bolhas de ar dos micropoços.
    1. Após 1 dia de indução neural em 2D, retire o meio e lave rapidamente com PBS sem CA2 +/MgCl2 +. Dissociar as colônias em suspensão de células simples adicionando 7,5 mL de solução enzimática recombinante em um balão de T75 cm2 . Incubar por 2 min a 37 ° c, em seguida, complete com 7,5 mL de DMEM-F12.
    2. Colete a suspensão celular e centrifugue a 300 x g por 5 min. Retire o sobrenadante e conte as células no mesmo meio usado para preparar a placa de micropoços.
    3. Ajuste o volume médio para obter uma suspensão celular que permita formar neuroesferas contendo 1000 células por micropoços (por exemplo, a placa de micropoços usada aqui contém 4.700 micropoços por poço). Assim, prepare 4,7 milhões células em 2,5 mL de meio e adicioná-lo ao anterior 2,5 mL de meio já colocado na placa.
    4. A fim de distribuir corretamente as células em cada micropoço, agitar suavemente a placa, e centrifugar a placa de micropoços 300 x g por 5 min. Incubar a placa em 37 ° c para 24 h para gerar esferas.
  3. Dia 2: lave suavemente os micropoços com o meio e colete, em seguida, transfira as esferas na placa de seis poços tratada com tecido. Substitua o meio pelo meio Neurobasal suplementado com 1% B27, 1x NEAA, 2 mM L-glutamina e 1% de penicilina/estreptomicina. Além disso, adicione fatores de regionalização SHH, FGF8, agonista suavizada e moléculas pequenas de inibição de SMAD dupla.
    1. Coloque as esferas em rotação a 37 ° c (60 RPM, agitador orbital) e mude meio-meio recém-suplementado a cada 2-3 dias.
  4. Dia 3: para melhorar a indução neural e converter para progenitores neurais com uma identidade do midbrain, suplementam o meio com o inibidor de 3 μM GSK-3β, que ativa o caminho de WNT/β-catenin. Manter o inibidor GSK-3β no meio até o dia 13. Dividido em duas novas placas de 6 poços tratadas com tecido para reduzir a densidade da esfera por poço e evitar a agregação da esfera.
    Nota: no dia 8, a maioria das células deve ser positiva para Nestin.
  5. Dia 8: iniciar a maturação neural: substitua os fatores de regionalização SHH, FGF8, agonista suavizada e coquetel de inibição Dual-SMAD com campo de dibutyryl de 0,5 mM (para favorecer a maturação), inibidor de 20 nM de histona deacetilase (para saída do ciclo celular), 1 μM γ-secretase inibidores e fatores de crescimento, 10 ng/mL GDNF, 10 ng/mL BDNF, 1 ng/mL fator de crescimento transformador β3 (TGFβ3), e 5 ng/mL FGF20 (ambos favorecem a sobrevivência do progenitor). Mude o meio a cada 2-3 dias.
  6. Dia 21: gerar o organóide neural: semente em torno de 100 neuroesferas condições de interface ar-líquido na membrana de PTFE (6 mm de diâmetro). Transfira a membrana para um inserto de placa de cultura (0,4 mm) e adicione 1,2 mL de meio de maturação neural usado para diferenciação da neurofera como descrito anteriormente.
    1. Pare qualquer rotação desta etapa. Altere o meio a cada 2-3 dias até que o ponto de tempo de diferenciação exigido seja atingido.
      Nota: em relação à maturação neural, observou-se diminuição do marcador neural imaturo Nestin e aumento dos marcadores neurais maduros β3-tubulin e GFAP. As altas expressões TH e NURR1 foram observadas (Figura 3C) e confirmam a maturidade organoide neural11.

5. quantificação da expressão gênica de TH e Nurr1 para validação da diferenciação dopaminérgica

  1. Extração do RNA: no dia indicado da diferenciação, os neurospheres de lyse 40 com 350 μL do amortecedor de RLT (fornecido no jogo da extração do RNA) suplementados com 3,5 μL do 2-mercaptoethanol. Extraia o RNA das neuroesferas lisadas usando um kit de extração de RNA seguindo as instruções do fabricante.
  2. Quantificar as concentrações totais de RNA.
  3. Realize a transcrição reversa de 300 ng da extração total do RNA usando o jogo reverso da transcrição para a reacção em cadeia quantitativa do polymerase do tempo real (qPCR) e siga as instruções do fabricante.
  4. Execute a análise de qPCR em sistemas de deteção do PCR do tempo real, baseados na deteção assimétrica da tintura do cianina. Normalizar os dados com os genes de limpeza: gliceraldeído-3-fosfato desidrogenase (GAPDH) e fator de alongamento 1-alfa (EF1). As sequências de primers estão descritas na tabela 1.

6. detecção de cromatografia líquida de alta pressão (HPLC)

  1. Use cromatografia líquida de alta pressão (HPLC) com detecção eletroquímica para detectar a presença de dopamina. A dopamina foi extraída por organóides neurais lisando em 100 mL de ácido perclórico de 0,1 N (HClO4) por 15 min a 4 ° c com um vortexing vigoroso a cada 5 min. Após a centrifugação, colete e armazene o sobrenadante a-20 ° c para dosagem de dopamina.
  2. Use uma coluna C-18 (5 μm, 4,6 mm x 150 mm) para separar os analitos por HPLC de fase invertida no modo Isocrático a uma vazão de 1 mL/minuto. A detecção de dopamina deve ser realizada usando um detector coulométrico com o conjunto de células condicionantes em um potencial de + 200 mV.

7. gravação de dados brutos com plataforma de matriz de microelectode (MEA)

  1. Use um microscópio de dissecção para transferir neuroesferas para o centro de um dispositivo MEA poroso.
  2. Use um amplificador e sistema de aquisição de dados para gravações eletrofisiológicas. Meça a relação sinal-ruído (SNR) como o desvio padrão da tensão durante uma gravação de 5 minutos, usando o sinal como a tensão Peak-to-Peak média dos picos gravados nos mesmos períodos de 5 minutos.

Representative Results

As etapas críticas deste protocolo devem ser bem identificadas e tratadas corretamente. Portanto, um diagrama de condições de cultura indicando o lapso de tempo para cada etapa, bem como os compostos utilizados para o protocolo de diferenciação, são ilustrados na Figura 1a e na Figura 3a para os organóides neurais no mais GBM e da da, respectivamente. A Figura 1b, C, D, e, F ilustra as células, esferas e no e mostram a morfologia típica para cada etapa. A Figura 1G, H, I ilustra a imunofluorescência que mancha com alguns marcadores neural.

Figure 1
Figura 1 : Organoide neural humano (no) protocolo de diferenciação. (A) protocolo padronizado para a geração de no derivado de células-tronco embrionárias humanas (hESC). (B) os hESCs são mantidos na matriz extracelular em meio hESC. (C) placas de micropoços foram utilizadas para gerar neuroesferas calibradas. Em 2 semanas, as neuroesferas foram chapeadas na pastilha contendo uma membrana de PTFE (barra de escala = 50 μm). (D) visão MACROSCÓPICA do não na pastilha em um poço de uma placa de 6 poços. Durante os primeiros dias, foram observadas rosetas (seta preta) (E). (F) visão macroscópica de uma esfera não mais GIC no topo. (G-I) Análise da imunofluorescência da esfera do NO mais GIC (EGFR-positivo; barra da escala = 50 μm) (G) e não sozinho, que mostrou a reactividade imune para o marcador neuronal βiii-tubulin e ligeiramente positivo para o Nestin; Entretanto, o sinapsina 1 mostrou um sinal fraco (H, I) (barras da escala = 100 μm e 50 μm, respectivamente). Por favor clique aqui para ver uma versão maior desta figura. 

Figure 2
Figura 2 : Ilustração de esferas Necrotic e imaturo no. As neuroesferas (a) e no (B) podem sofrer necrose quando são muito numerosas no poço ou oversized (C) (barra de escala = 10 μm). (D) um GIC infectado com um repórter de tomate ajuda a rastrear a invasão de células tumorais em não, barra de escala, 10 μm. exemplo de não imaturo com tubos neurais (e) e sem tubos neurais (F) (barra de escala = 50 μm). Por favor clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3 : Protocolo padronizado para geração de organoide neural da e análise eletrofisiológica e morfológica. (A) protocolo padronizado para a geração de organóides neurais da da. (B) análise de imunofluorescência do organóide neural da da; Células do TH-immunoreactive que coexpressam Nurr1, um marcador específico do midbrain (barra da escala = 50 μm). Os dados são representados como média ± SEM (n = 3). (C) os gráficos representam a cinética da expressão gênica de th e Nurr1 avaliada pela qRT-PCR. (D) HPLC representativa: pico de dopamina (seta) foi detectado por HPLC do lisado organóide neural da da. (E) exemplo de dados brutos gravados com a plataforma mea. Cada espiga é exibida por uma linha vertical (carimbos de hora), enquanto o traço restante é o ruído. (F) imagem representando uma neurofera DEPOSITADA no mea. (G) superposição de picos típicos (curvas azuis e vermelhas) detectadas a partir dos dados brutos. A curva em negrito preta indica a média das curvas vermelhas correspondentes. (H) plotagem raster mostrando os carimbos de hora associados a cada espiga detectado. As diferentes cores destacam os diferentes eletrodos. Por favor clique aqui para ver uma versão maior desta figura. 

Gene Foward Reverter
Nurr1 GGCTGAAGCCATGCCTTGT GTGAGGTCCATGCTAAACTTGACA
TH MÉTODO GCACCTTCGCGCAGTTCT CCCGAACTCCACCGTGAA
EEF1 AGCAAAAATGACCCACCAATG GCCTGGATGGTTCAGGATA
GAPDH GCACAAGGAAAGAGAGAACC AGGGGAGATTCAGTGTGGGT

Tabela 1: primers utilizados neste protocolo.

Discussion

Um dos aspectos mais críticos deste protocolo inclui a manutenção da pluripotência de hESC durante a cultura da célula e o monitoramento estreito das esferas e da morfologia organoide neural. os hESCs são muito sensíveis, e cada manipulação pode conduzir à diferenciação descontrolada adiantada assim como a morte da pilha. A fim aumentar a reprodutibilidade experimental e evitar a ocorrência de eventos anormais do karyotype, recomenda-se para criopreservar diversos lotes dos hESCs na passagem a mais baixa após a validação de sua estabilidade do cromossoma. Além disso, recomenda-se descongelar um novo frasco para cada experimento e verificar o comportamento das células todos os dias. Se as esferas são menos refração com tamanho mais alto anormal, eles provavelmente começará a agregar e morrer.

Uma melhoria em cima deste sistema é a perfusão ou a implementação de um sistema vascularized (adicionando pilhas endothelial ou dentro de um microchip fluídico 3D)12,13. Entretanto, controlar a espessura do organoid neural (≤ 300 μm) permite a perfusão passiva eficiente do oxigênio e dos nutrimentos e impede a necrose. Outra melhoria é a introdução de células imunes (microglia). Com estas limitações na mente, os organóides neural mais um sistema de GIC podem ser uma ferramenta relevante para diversas razões. Em primeiro lugar, este sistema permite a triagem de drogas para monitorar como um composto terapêutico pode afetar uma célula organoide ou tumor. Segundo, as interações célula a célula podem ser estudadas, e os determinantes microambientais subjacentes às invasões individuais e coletivas podem ser visualizados e explorados5,6,13.

No contexto da doença de Parkinson, um organóide neural enriquecido em neurônios DA DA pode representar um modelo 3D relevante e preciso para estudar o desenvolvimento DA doença. Em estudos prévios, as células-tronco pluripotentes induzidas pelo paciente de Parkinson diferenciadas para os neurônios DA DA foram usadas para estudar os subtipos neuronais afetados. De notar, alguns fenótipos relacionados à doença, como o acúmulo de α-sinucleina e sensibilidade ao estresse oxidativo,foram observados14,15. Além disso, o organóide neural pode ser usado como uma ferramenta para a tela de moléculas terapêuticas. No entanto, leituras específicos e relevantes devem ser configurados para avaliar a sobrevida e a funcionalidade do neurônio da da, como a produção de dopamina e a atividade eletrofisiológica. Ao todo, este protocolo fornece duas abordagens padronizadas e precisas baseadas em células-tronco para gerar organóides neurais.

Disclosures

Os autores não declaram interesses financeiros concorrentes.

Acknowledgments

Os autores agradecem à ligue Genevoise contre le Cancer (Genebra, Suíça), à Fundação ISREC (Lausanne, Suíça) e à Fundação Clayton de pesquisa (Houston, TX, EUA) pelo apoio financeiro. Além disso, os autores agradecem ao HES-HO e ao Wyss Center pelo apoio financeiro. Agradecemos ao laboratório de Krause por discussões e apoio úteis e Dr. Halah Kutaish para revisão.

Materials

Name Company Catalog Number Comments
6-well plate (6-well plate) Falcon / Corning 07-201-588
ABI Prism 7900 HT detection system  (Real-Time PCR detection systems) Applied Biosystems Discontinued
Aggrewell 400 (Microwell culture plates ) StemCell Technologies 34421
Amplifier (W2100-HS32)  (Amplifier) Multi Channel Systems
Anti-EGFR (phospho Y1101) antibody Abcam ab76195 1/100 dilution
Anti-GFAP Antibody Dako  Z334  1/1000 dilution
Anti-Nestin, Human Antibody Millipore  ABD69  1/400 dilution
Anti-Synapsin I Antibody Chemicon  AB1543P  1/500 dilution
B27 supplements (B27) Life Technologies / Invitrogen 1238 For both protocol, stock solution 100x, final solution 1x
Brain-derived neurotrophic factor  (BDNF) Cell Guidance GFH1-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
CHIR-99021 (GSK-3β inhibitor ) Axon Medchem ct99021 For Dopaminergic protocol,  stock solution 7.5 mM in DMSO, final solution 3 µM
Compound E a γ–secretase inhibitor (γ–secretase inhibitor) Calbiochem CAS 209986-17-4 For both protocol (gamma-secretase inhibitor XXI),  stock solution 5 mM in DMSO, final solution 1 µM
Coulochem III  (Coulometric detector parameters) Thermo scientific
Dibutyryl cyclic-AMP (Dibutyryl cAMP) Sigma D0627 For Dopaminergic protocol,  stock solution 0.5 M in DMSO, final solution 0.5 mM
Dimethyl Sulfoxide Pure (DMSO) Sigma-Aldrich C6164 Compounds solvent, ready to use
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 12491-015 For cell culture, ready to use
Dulbecco's Modified Eagle Medium Mixture F-12 (DMEM-F12) Gibco 11320033 For cell culture, ready to use
EDTA 0.1 mM (EDTA) Life Technologies AM9912 For cell culture, ready to use
Epidermal Growth Factor (EGF) Gibco PHG0313 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
Fibroblast Growth Factor 20 (FGF20) Peprotech 100-41 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 5 ng/mL
fibroblast growth factor 8  (FGF8) Peprotech GFH176-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
Fibroblast growth factor-basic (bFGF) Gibco PHG0024 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
G5 supplements (G5) Invitrogen 17503012 For GIC culture, stock solution 100x, final solution 1x
Glial cell-derived neurotrophic factor (GDNF) Cell Guidance GFH2-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
Hydrophilic polytetrafluoroethylene  membrane (PTFE membrane) BioCell-Interface Discontinued
LDN-193189 (BMP inhibitor) Axon Medchem /Stemgen 04-0072-02 /1509 Dual/Smad,  stock solution 5 mM in DMSO, final solution 0.5 µM
L-glutamine (L-glutamine) Gibco 25030081 L-Glutamine (200 mM), stock solution 200 mM, final solution 2 mM
Matrigel (extracellular matrix) BD Biosciences 354277 hESC-qualified Matrix, stock solution 18-22 mg/mL, final solution 180-220 µg/mL
Millicell-CM Culture plate insert  (0.4 µm) (Culture plate insert) Millipore PICM03050
Monoclonal Anti-β-Tubulin III antibody Sigma  T8660  1/1000 dilution
MS Orbital Shaker, MS-NOR-30 (Orbital shaker) Major Science MS-NRC-30
N2 supplements (N2) Invitrogen 17502-048 For GIC culture, stock solution 100x, final solution 1x
Nanodrop (Nanodrop) Thermo Fisher Scientific Discontinued
Neurobasal (Neurobasal) Life Technologies / Gibco 21103049 Maintenance and maturation embryonic neuronal cell populations , ready to use
Non-Essential Amino Acids  (NEAA) Gibco 11140 Non-essential Amino Acids 100X, stock solution 100x, final solution 1x
Nurr1 Antibody (M-196) Santa Cruz Sc-5568 1/100 dilution
Nutristem  (hESC medium ) Biological Industries 05-100-1A Stem cell media, ready to use
Penicilin / Streptomycin  (Penicilin / Streptomycin ) Life Technologies / Gibco 15140122 For cell culture, stock solution 5 mg/mL, final solution 50 µg/mL 
Perchloric acid 0.1N (HCLO4) Merck 100519 For HPLC, ready to use
Phosphate Buffered Saline without Ca2+/Mg2+  (PBS without Ca2+/Mg2+ ) Life Technologies 14190250 For cell culture, ready to use
PrimeScript RT-PCR Kit (Reverse transcription kit) Takara RR014A
Purmorphamin (smoothened agonist) Calbiochem SML0868 For Dopaminergic protocol,  stock solution 10 mM in DMSO, final solution 2 µM
Rho-associated Kinase Y-27632 (ROCK) Abcam Biochemicals ab120129-1 Rock Inhibitor,  stock solution 50 mM in DMSO, final solution 10 µM
RNeasy mini kit (RNA extraction kit ) Qiagen 74104
SB-431542 (TGFβ/Activin/Nodal inhibitor ) Ascent Asc- 163 Dual-Smad,  stock solution 50 mM in DMSO, final solution 10 µM
Sonic Hedgehog (SHH) Cell Guidance GFH168-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
StemPro Accutase (hESC enzymatic solution) Gibco A11105-01 hESC enzymatic solution, ready to use
Symmetry C-18,5 mm (4.6 150mm2)  (Reversed-phase column) Waters Corporation
T150 flask (T150 flask) Falcon 08-772-1F
TH Antibody (F-11) Santa Cruz Sc-25269 1/200 dilution
Transforming Growth Factors beta 3 (TGFβ3) Cell Guidance GFH109-2 For Dopaminergic protocol,  stock solution 100 µg/mL in pure ethanol , final solution 1 ng/mL
Trichostatine A (inhibitor of histone deacetylase ) Sigma T8552 For Dopaminergic protocol,  stock solution 100 µM in DMSO, final solution 20 nM
TrypLE (recombinant enzymatic solution) Invitrogen 12604021 recombinant enzymatic solution, ready to use
Trypsin 0.25% (enzymatic solution) Life Technologies 15050065 enzymatic solution, ready to use
W2100, Multi Channel Systems (Data acquisition system ) WAT045905
X-vivo (serum free medium) Lonza BE04-743Q serum free medium, ready to use

DOWNLOAD MATERIALS LIST

References

  1. Louis, D. N., et al. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary. Acta Neuropathologica. 131, (6), 803-820 (2016).
  2. Stupp, R., et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. New England Journal of Medicine. 352, (10), 987-996 (2005).
  3. Daphu, I., et al. In vivo animal models for studying brain metastasis: value and limitations. Clinical and Experimental Metastasis. 30, (5), 695-710 (2013).
  4. Huszthy, P. C., et al. In vivo models of primary brain tumors: pitfalls and perspectives. Neuro Oncology. 14, (8), 979-993 (2012).
  5. Nayernia, Z., et al. The relationship between brain tumor cell invasion of engineered neural tissues and in vivo features of glioblastoma. Biomaterials. 34, (33), 8279-8290 (2013).
  6. Cosset, E., et al. Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials. 107, 74-87 (2016).
  7. Pringsheim, T., Jette, N., Frolkis, A., Steeves, T. D. The prevalence of Parkinson's's disease: a systematic review and meta-analysis. Movement Disorders. 29, (13), 1583-1590 (2014).
  8. Rajput, A. H., et al. Globus pallidus dopamine and Parkinson's motor subtypes: clinical and brain biochemical correlation. Neurology. 70, (16 Pt 2), 1403-1410 (2008).
  9. Jellinger, K. A. Pathology of Parkinson's's disease. Changes other than the nigrostriatal pathway. Molecular and Chemical Neuropathology. 14, (3), 153-197 (1991).
  10. Bernheimer, H., Birkmayer, W., Hornykiewicz, O., Jellinger, K., Seitelberger, F. Brain dopamine and the syndromes of Parkinson’s and Huntington. Clinical, morphological and neurochemical correlations. Journal of Neurological Science. 20, (4), 415-455 (1973).
  11. Tieng, V., et al. Engineering of midbrain organoids containing long-lived dopaminergic neurons. Stem Cells and Development. 23, (13), 1535-1547 (2014).
  12. Chen, C. S. 3D Biomimetic Cultures: The Next Platform for Cell Biology. Trends in Cell Biology. 26, (11), 798-800 (2016).
  13. Friedl, P., Sahai, E., Weiss, S., Yamada, K. M. New dimensions in cell migration. Nature Reviews Molecular Cell Biology. 13, (11), 743-747 (2012).
  14. Byers, B., et al. SNCA triplication Parkinson's's patient's iPSC-derived DA neurons accumulate alpha-synuclein and are susceptible to oxidative stress. PLoS ONE. 6, (11), e26159 (2011).
  15. Flierl, A., et al. Higher vulnerability and stress sensitivity of neuronal precursor cells carrying an alpha-synuclein gene triplication. PLoS ONE. 9, (11), e112413 (2014).
Organóides neurais humanos para estudar câncer cerebral e doenças neurodegenerativas
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).More

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter