Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Bioengineering

Человеческие нейронные органоиды для изучения рака мозга и нейродегенеративных заболеваний

doi: 10.3791/59682 Published: June 28, 2019
* These authors contributed equally

Summary

Это исследование вводит и описывает протоколы для получения двух конкретных человеческих нервных органоидов в качестве соответствующей и точной модели для изучения 1) развития глиобластомы человека в человеческих нервных органоидов исключительно у людей и 2) нейрон дофаминергических дифференциации, генерирующей трехмерный органоид.

Abstract

Отсутствие соответствующих нейронных моделей in vitro является важным препятствием на пути медицинского прогресса в области нейропатологии. Создание соответствующих клеточных моделей имеет решающее значение как для лучшего понимания патологических механизмов этих заболеваний, так и для выявления новых терапевтических целей и стратегий. Чтобы быть уместным, модель in vitro должна воспроизвести патологические особенности болезни человека. Однако, в контексте нейродегенеративных заболеваний, соответствующая модель in vitro должна обеспечить замену нервных клеток в качестве ценной терапевтической возможности.

Такая модель не только позволит скрининг терапевтических молекул, но и может быть использована для оптимизации дифференциации нейронных протоколов (например, в контексте трансплантации при болезни Паркинсона (PD)). Это исследование описывает два протокола in vitro 1) развития глиобластомы человека в рамках человеческих нервных органоидов (NO) и 2) нейрон дофаминергической (DA) дифференциации генерации трехмерной (3D) органоидов. Для этого был разработан хорошо стандартизированный протокол, позволяющий вырабатывать размеры нейросфер, полученных из гениальной стволовой клетки человека (HESC). Первая модель может быть использована для выявления молекулярных и клеточных событий, происходящих во время развития глиобластомы в нервной органоидов, в то время как органоид DA не только представляет собой подходящий источник нейронов DA для клеточной терапии при болезни Паркинсона, но также может использоваться для тестирования на наркотики.

Introduction

Всемирная организация здравоохранения (ВОЗ) классифицирует астроцитомы как низкоклассные (i класс i-II) или высокие (классы III и IV). Глиобластома мультиформ (GBM) является астроцитома класса IV, наиболее смертоносных первичных опухолей головного мозга, что является устойчивым ко всем текущим формам лечения1. Несмотря на стандартную терапию, включая нейрохирургию, химиотерапию и лучевую терапию, ГБМ остается смертельным, и 15-месячная общая выживаемость не сильно изменилась за последние 15 лет2. Для достижения значительного прогресса в понимании ПАтогенеза ГБМ, использование соответствующих моделей является ключевым фактором. До сих пор, изучение GBM полагалось на клеточные линии, грызунов органотипических ломтиков, и ксенотрансплантации пациентов полученных клеток в мышей или трансгенных мышей развивающихся спонтанных опухолей3,4. Хотя эти модели были полезны для изучения метастази мозга и агрессивности опухоли, они ограничены различиями между видами, и в результате выводы могут быть неправильно переведены на человеческие ткани. Кроме того, существующие модели с человеческими клетками такжеограничены отсутствием взаимодействия ткани хозяина/опухоли 3,4. Экспериментальные модели имеют решающее значение для перевода с фундаментальной науки на терапевтические цели. Таким образом, описывая протокол для производства в пробирке человеческих нервных органоидов совместно с GBM-инициирующих клеток (GICs) может обеспечить соответствующую систему, которая имитирует морфологические и функциональные особенности развития GBM. Эта система воспроизводит некоторые in vivo особенности развития GBM, такие как диффузная миграция вторгшихся клеток и областей некроза, и она подчеркивает экспрессию генов, имеющих отношение к биологии опухоли. Как было выявлено ранее, некоторые критические микроРНК индуцируются во время развития GIC в 3D нервной ткани5,6.

PD является одним из основных нейродегенеративных расстройств и связанных с дегенерацией нескольких нейрональных подтипов7. Даже если прогрессирующее начало симптомов (например, брадикинезия, асимметричный тремор отдыха, жесткость и нестабильность осанки) характеризуют болезнь, ее точная этиология четко не установлена. Действительно, многие исследования выявили доказательства того, что основные факторы риска могут быть результатом сочетания генетических и экологических факторов. Симптомы Паркинсона связаны с двусторонней дегенерацией дофаминергических нейронов в субстанции нигра (SN), что приводит к исчезновению дофаминергических (DA) аксонов, проецирующихся на стриатум8,9. Таким образом, снижение уровня стриатал допамина коррелирует с прогрессированием двигательной дисфункции у пациентов PD. Допамингические нейроны содержат гидроксилазу тирозина (TH), ключевой фермент в синтезе катехоламинергических нейротрансмиттеров, который преобразует аминокислоту L-тирозин в L-3,4-dihydroxyphenylalaninein (L-DOPA, прекурсор допамина) в допамин10. Ранняя потеря активности TH с последующим снижением экспрессии белка TH является отличительной чертой PD.

Это исследование описывает два протокола с использованием человеческих нервных органоидов, с одним специально ориентированных на средний мозг, как фенотип обогащенный TH-положительных клеток.

Protocol

Этот протокол соответствует руководящим принципам комитета по этике человеческих исследований Университета

1. Поддержание и культура недифференцированных эмбриональных стволовых клеток человека (HESC)

  1. Выполняйте техническое обслуживание и расширение HSECs на условиях без фидера, предварительно покрывая посуду с помощью специальной внеклеточной матрицы.
    1. Оттепель 300 кл внеклеточной матрицы при 4 градусах Цельсия (типичная концентрация диапазона 18-22 мг/мл, держитесь на льду) и аккуратно перемешайте с 15 мл холодной среды DMEM, чтобы избежать преждевременного гелирования внеклеточной матрицы. Добавьте 7,5 мл внеклеточного матрика к обеим колбам T150.
    2. Инкубировать блюда, покрытые внеклеточной матрицы на 37 градусов по Цельсию, по крайней мере 1 ч (максимум за одну ночь).
    3. Удалите средние и семенные hESCs с плотностью 6,5 х 104 ячейки /см2.
  2. Поддержание H1 (линия клеток hESC) в среде hESC и 1% пенициллина/стрептомицина.
  3. Передайте клетки с помощью ферментативной процедуры: добавьте 7,5 мл ферментативного раствора в колбу T75 см2 в течение 1-2 мин при 37 градусах По Цельсию. После того, как клетки полностью отделены, добавьте 7,5 мл DMEM-F12, затем центрифугу в течение 5 мин при 300 х г. Для обеспечения лучшего выживания, повторно пластины клеток при желаемой плотности на внеклеточной матричной посуды, в той же среде, содержащей Rho-связанных белка киназы (ROCK) ингибитор (10 мкм) для 24 ч.

2. hESC полученных нервных органоидов для исследований GBM

  1. 24 ч перед началом 3D-культуры замените среду hESC средой, свободной от сыворотки, дополненной ингибитором 10 км ROCK (оба компонента необходимы для поддержки выживания клеток и спонтанного формирования нейросферы во время фазы агрегации в микроколодце тарелка). Клетки должны быть на 60% внештатной. На следующий день (день 0), отсоединить колонии hESC в виде одиночных клеток: удалить среду, затем промыть PBS без Ca2'/Mg2", добавить 5 мл ферментативного раствора раствора раствора раствора раствора раствора раствора раствора, и инкубировать при 37 градусах по Цельсию в течение 1-2 мин.
  2. Соберите клетки в среде, свободной от сыворотки, с 10 мкм ингибитора ROCK и центрифуги клетки на 300 х г в течение 5 мин. Удалить супернатант и рассчитывать клетки в 10 мл сыворотки свободной среде дополняется 10 мкм ингибитора ROCK.
  3. Параллельно промыть микроскважину с 2 мл среды без сыворотки в скважину и центрифуги пластины на 1200 х г в течение 5 минут, чтобы удалить все пузырьки, которые могут предотвратить образование нейросферы.
  4. Приготовьте 28,2 x 106 клеток в 12,5 мл среды, свободной от сыворотки, дополненной 10 ингибитором rock. Распределить 1000 клеток/микровелл. Центрифуге клетки на 300 х г в течение 5 мин и поместите пластину в инкубатор на 37 градусов по Цельсию на ночь (максимум 36 ч). Например: чтобы получить 30 человеческих нервных органоидов, используйте одну колбу T150 при 70%-80% слияния (около 30 млн клеток).
  5. На следующий день (день 1), соберите сферы (с P1000) и поместите их в 6 хорошо пластины. В каждую скважину добавьте 2 мл средней и DMEM-F12 GlutaMAX и нейробазальной среды (смесь на 1:1), дополненной 1% добавками B27 и 1% несущественными аминокислотами (NEAA). Для содействия быстрой нервной индукции, дополнить среду с двойным-SMAD ингибирование коктейль, состоящий из 10 мКм TGF /Актив/Нодал ингибитор и 0,5 мкм костной морфогенный белок (BMP) ингибитор. С этого шага вперед сферы культивируются в вращении (60 об/мин, орбитальный шейкер). Вращение имеет решающее значение для предотвращения сферы от слипания или пластины.
  6. Изменение среды каждые 2-3 дня: согнуть пластину и пусть сферы падают на 5 мин, удалить половину среды (2 мл), и добавить 2 мл свежей среды B27 дополнены факторами роста и ингибиторами. Не центрифугис сферы.
  7. Выполните нейроиндукцию в соответствии со следующим курсом времени:
    1. С 1-4 дней культура сфер в среде B27 дополнена двойным SMAD. Коктейль-ингибирование двойного SMAD (10 мкм TGF/Актив/Ингибитор Nodal и ингибитор БМП 0,5 мкм) способствует индукции нейронов.
    2. С 4-11 дней, способствовать распространению hESC полученных нейронных розеток (в сферах), добавив 10 нг / мЛ эпидермального фактора роста (EGF) и 10 нг / мл основной фибробластный фактор (bFGF) в B27 среднего дополнены двойной SMAD коктейль.
      ПРИМЕЧАНИЕ: На 11-й день, большинство клеток должны быть положительными для Nestin.
    3. С 11-13 дней культура сфер в среде B27 дополнена ингибитором БМП 0,5 мкм.
    4. С 13-21 дней, культура сфер в B27 среде дополнены 10 нг /мл глиальных производных нейротрофический фактор (GDNF), 10 нг /мЛ мозга производных нейротрофический фактор (BDNF) и 1 Км ингибитора З-секретазы. GDNF и BDNF способствуют дифференциации нейронов и глиальных. Ингибитор кесекретари обеспечивает большее созревание нейронов.
    5. На 21 день наклеить сферы (около 1000 сфер) на гидрофильные политетрафториленовые (PTFE) мембраны (диаметр 6 мм, 0,4 мкм), отложенные на вставке пластины культуры, рассчитанной на 6 скважинную пластину. Остановите любое вращение с этого шага. Наличие розеток, наблюдаемых с помощью ярко-поляного микроскопа, указывает на начало нейронной дифференциации. Нейронные розетки можно наблюдать через 2-3 дня после покрытия сфер на мембране PTFE.
    6. Добавьте 1 мл средней b27, дополненной факторами роста и ингибиторами (как следует) к каждому колодцу под мембранной вставкой, каждые 2-3 дня (обычно в понедельник, среду и пятницу) в течение следующих 3 недель дифференциации.
    7. Начиная с 21-25 дней, культивировать человеческие нервные органоиды в той же среде созревания нейронов (Cf. шаг 2.7.4).
    8. С 25-28 дней, только дополнить B27 среды с 1 ММ-секретазы ингибитор.
    9. С 28-39 дней, прекратить добавление ингибитора к-секретазы и продолжить человека нервной органоидной культуры в B27 среде только.
      ПРИМЕЧАНИЕ: После 3 недель, нервные органоиды готовы к использованию для имплантации ГИК. Вдоль нейронного созревания наблюдалось уменьшение нервного незрелого маркера Nestin и увеличение зрелых нервных маркеров З3-тубулин и GFAP.

3. Изоляция и культивирование клеток, инициирующих глиобластому (ГИК)

  1. Изолировать ГИК путем фрагментации высококачественной биопсии ГБМ человека. Перенесите кусок опухоли в стакан, содержащий 0,25% трипсина в 0,1 мМ EDTA (4:1) и медленно перемешайте при 37 градусах По Цельсию в течение 30-60 мин (в зависимости от размера опухоли).
  2. Плита диссоциированных клеток в 75 см2 ткани культуры колбы покрытием на 2500-5000 клеток на см2 в среде GIC: DMEM / F-12 среды (1:1), содержащий 1% N2, 1% B27, и 1% G5 добавки (в пользу выживания GIC), дополнены bFGF и EGF (оба на 10 нг/Мл, для содействия стеблю) и 1% пенициллина/стрептомицина.
  3. После того, как GIC хорошо зарекомендовал себя и растет, удалить N2 и G5 добавки из среды GIC.
  4. За день до добавления клеток на органоид, разъединить ГИК и считать их.
  5. Промыть микроскважину с 2 мл Среднего ГИК и центрифуги пластины на максимальной скорости, чтобы удалить пузырьки (1000 х г). Поместите ГИК на 1000 клеток, чтобы получить одну глиомасферу на микроскважину. Инкубировать ночь при 37 градусов по Цельсию(рисунок 1C). Этот шаг является ключевым и позволяет хорошо откалиброванные ГИК (пример некротики и негабаритных ГИК показано на рисунке 2A,C).
  6. Чтобы инициировать вторжение GBM, добавьте одну глиомасферу поверх нервной ткани с большим наконечником пропорот(рисунок 1F). Аккуратно поместите 6 хорошо пластины обратно в инкубатор.

4. hESC полученных дофаминергических органоидов для исследований PD

  1. День 0: Усилите hESCs в 2D культуре до 60% confluency (день 0), после этого заменить средства стволовой клетки используемые для поддержания функций pluripotency hESCs с сывороточной свободной средой. Начните нейроиндукцию, дополняя среду культуры ингибитором 0,5 мкм БМП и 10 мкм TGF/Актив/Ингибитор для нодал (коктейль-ингибирование двойного SMAD), затем добавьте ингибитор 10 мКМ ROCK в течение 24 ч, чтобы увеличить выживаемость клеток во время прохождения.
  2. День 1: Подготовьте микроскважинную пластину с 2,5 мл на скважину среды, свободной от сыворотки, дополненной ингибитором БМП 0,5 мкм, 10 мкм ТГФ/Актививин/Нодальный ингибитор, и ингибитор омрок. Чтобы указать клетки к брюшной схеме нервной трубки, добавьте 100 нг/мл Соника Ежика (SHH), 100 нг/мл фибробластного фактора роста 8 (FGF8) и 2 мКм сглаженного агониста. Центрифуги пластины (только со средними и без клеток) на 1200 х г в течение 5 минут, чтобы удалить пузырьки воздуха из микровелл.
    1. После 1 дня нервной индукции в 2D, удалить среду и быстро мыть с PBS без Ca2"/MgCl2 ". Разъедините колонии в одноклеточных подвесках, добавив 7,5 мл рекомбинантного ферментативного раствора в колбу T75 см 2. Инкубировать в течение 2 мин при 37 градусах по Цельсию, затем в комплекте с 7,5 мл DMEM-F12.
    2. Соберите суспензию клетки и центрифугу при 300 х г в течение 5 мин. Удалите супернатант и посчитайте клетки в той же среде, используемой для подготовки микроколодца пластины.
    3. Отрегулируйте средний объем, чтобы получить клеточную суспензию, позволяющую образовывать нейросферы, содержащие 1000 клеток на микроскважину (например, микроскважинная пластина, используемая здесь, содержит 4700 микровелл на скважину). Так, приготовьте 4,7 млн ячеек в 2,5 мл средней и добавьте ее к прежним 2,5 мл среды, уже помещенной в пластину.
    4. Для того, чтобы правильно распределить клетки в каждом микроколодце, аккуратно встряхните пластину, и центрифуги микроуэлл аплиты 300 х г в течение 5 мин. Инкубировать пластину при 37 градусах Цельсия в течение 24 ч для генерации сфер.
  3. День 2: Аккуратно промыть микровеллы со средой и собирать затем передать сферы в ткани обработанных шестиколодцв пластины. Замените среду нейробазальной средой, дополненной 1% B27, 1x NEAA, 2 мМ L-глютамином и 1% пенициллина/стрептомицина. Кроме того, добавьте факторы регионализации SHH, FGF8, сглаженную агонист, и двойное sMAD ингибирование малых молекул.
    1. Поместите сферы в вращение при 37 градусах По Цельсию (60 об/мин, орбитальный шейкер) и меняйте полусредние свежедомесячные каждые 2-3 дня.
  4. День 3: Для повышения нервной индукции и преобразования в нейронных прародителей с среднего мозга идентичности, дополнить среду с 3 мкм ГСК-3 "ингибитор, который активирует Wnt / й-катенин пути. Поддерживайте ингибитор ГСК-3 в среде до 13-го дня. Разделите на две новые ткани обработанных 6 скважинных пластин, чтобы уменьшить плотность обеих сфер на скважину и избежать агрегации сферы.
    ПРИМЕЧАНИЕ: На 8-й день, большинство клеток должны быть положительными для Nestin.
  5. День 8: Начало нейронного созревания: заменить факторы регионализации SHH, FGF8, сглаженный агонист, и двойной SMAD ингибирование коктейль с 0,5 мМ дибутырила cAMP (в пользу созревания), 20 нМ ингибитор гистон деацетилазы (для выхода из клеточного цикла), 1 мкм факторы ингибитора и роста, 10 нг/мл GDNF, 10 нг/мл BDNF, 1 нг/мл, трансформирующий фактор роста No3 (TGF-3), и 5 нг/мл FGF20 (оба способствуют выживанию прародителей DA). Меняйте среду каждые 2-3 дня.
  6. День 21: Создание нервного органоида: семена около 100 нейросфер в условиях воздушно-жидкого интерфейса на мембране PTFE (диаметр 6 мм). Перенесите мембрану в вставку культурной пластины (0,4 мм) и добавьте 1,2 мл среды созревания нейронов, используемой для дифференциации нейросфер, как это было описано ранее.
    1. Остановите любое вращение с этого шага. Изменяйте среду каждые 2-3 дня до достижения требуемой временной точки дифференциации.
      ПРИМЕЧАНИЕ: Что касается нейронного созревания, то наблюдалось снижение нервно-паралитическим маркером Nestin и увеличение зрелых нервных маркеров No3-тубулин и GFAP. Высокие выражения TH и NURR1 наблюдались(Рисунок 3C)и подтверждают нервную органоидную зрелость11.

5. Количественная экспрессия генов TH и Nurr1 для проверки дофаминергической дифференциации

  1. Извлечение РНК: В указанный день дифференциации, лис40 нейросфер с 350 зл и буфером RLT (при условии в комплекте экстракции РНК) дополнены 3,5 л 2-меркаптоэтанатола. Извлеките РНК из лисированных нейросфер с помощью комплекта для экстракции РНК, следуя инструкциям производителя.
  2. Количественная оценка общей концентрации РНК.
  3. Выполните обратную транскрипцию 300 нг от общего объема добычи РНК с использованием обратного комплекта транскрипции для количественной реакции полимеразы в реальном времени (qPCR) и следуйте инструкциям производителя.
  4. Выполняйте анализ qPCR на системах обнаружения ПЦР в реальном времени на основе асимметричного обнаружения цианина. Нормализация данных с генами домашнего хозяйства: глицеральдегид-3-фосфат дегидрогеназы (GAPDH) и удлинение фактор 1-альфа (EF1). Последовательности грунтовок описаны в таблице 1.

6. Обнаружение жидкой хроматографии высокого давления (HPLC)

  1. Используйте жидкой хроматографии высокого давления (HPLC) с электрохимическим обнаружением для обнаружения присутствия дофамина. Допамин был извлечен путем лизании нервных органоидов в 100 мл 0,1 N перхлорной кислоты (HClO4) в течение 15 минут при 4 градусах Цельсия с энергичным вихрем каждые 5 минут. После центрифугации, собирать и хранить супернатант при -20 градусов по Цельсию для дозировки допамина.
  2. Используйте столбец C-18 (5 мкм, 4,6 мм х 150 мм), чтобы отделить аналиты по обратной фазе HPLC в изократическом режиме при скорости потока 1 мл/минута. Обнаружение допамина должно осуществляться с помощью кулометрического детектора с кондиционирующей ячейкой, установленной на потенциале в 200 мВ.

7. Необработанная запись данных с помощью платформы микровыборного массива (MEA)

  1. Используйте микроскоп для передачи нейросфер в центр пористого устройства MEA.
  2. Используйте усилитель и систему сбора данных для электрофизиологических записей. Измерьте соотношение сигнала к шуму (SNR) как стандартное отклонение напряжения во время записи 5 мин, используя сигнал в качестве среднего пикового к пиковому напряжения шипов, зарегистрированных в те же 5 мин.

Representative Results

Критические шаги этого протокола должны быть хорошо определены и обработаны должным образом. Таким образом, диаграмма культурных условий, указывающих на промежуток времени для каждого шага, а также соединения, используемые для протокола дифференциации, иллюстрируются на рисунке 1A и Рисунке 3A для NO плюс GBM и DA нейронных органоидов, соответственно. Рисунок1B,C,D,E,F иллюстрирует клетки, сферы и НЕТ и показывает типичную морфологию для каждого шага. Рисунок 1G,H, я иллюстрирую иммунофлуоресценции окрашивания с некоторыми нейронных маркеров.

Figure 1
Рисунок 1 : Человеческий нервный органоид (NO) протокол адифференциации. (A) Стандартизированный протокол для генерации NO, полученных из эмбриональных стволовых клеток человека (hESC). (B) hESCs поддерживаются на внеклеточной матрице в среде hESC. (C) Microwell пластины были использованы для создания откалиброванных нейросфер. В 2 недели, нейросферы были покрыты на вставку, содержащую мембрану PTFE (шкала бар 50 мкм). (D) Макроскопический вид НЕТ в вставку в один колодец из 6 хорошо пластины. В первые дни наблюдались розетки (черная стрелка) (Е). (F) Макроскопический вид NO плюс GIC сфере на вершине. (G-I) Иммунофлуоресценция анализ NO плюс GIC сферы (EGFR-положительный; шкала бар 50 мкм) (G) и НЕТ в одиночку, который показал иммунную реактивность для нейронального маркера ЗIII-тубулин и слегка положительным для nestin; однако, синапсин 1 показал слабый сигнал (H,I) (шкала баров - 100 мкм и 50 мкм соответственно). Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры. 

Figure 2
Рисунок 2 : Иллюстрация некротических сфер и незрелых НЕТ. Нейросферы (A) и NO (B) может пройти некроз, когда они слишком многочисленны в колодце или негабаритных (C) (шкала бар 10 мкм). (D) Один GIC инфицированных томатный репортер помочь отслеживать вторжение опухолевых клеток в НЕТ, шкала бар, 10 мкм. Пример незрелых НЕТ с нервными трубками (E) и не нервных труб (F) (шкала бар 50 мкм). Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 3
Рисунок 3 : Стандартизированный протокол для генерации нервного органоида DA и электрофизиологического и морфологического анализа. (A) Стандартизированный протокол для генерации нервных органоидов DA. (B) Иммунофлуоресценция анализ DA нервного органоида; TH-иммунореактивные клетки, совместно выражающие Nurr1, маркер среднего мозга (шкала бар 50 мкм). Данные представлены в виде средних SEM (n No 3). (C) Графики представляют кинетику ЭКСПРЕССии генов TH и Nurr1, оцениваемые qRT-PCR. (D) Представитель HPLC: пик допамина (стрелка) был обнаружен HPLC из DA нервного органоида лизата. (E) Пример необработанных данных, записанных с платформой MEA. Каждый шип отображается вертикальной линией (штампами времени), в то время как оставшийся след — это шум. (F) Изображение представляющих нейросферы на хранение на MEA. (G) Суперпозиция типичных шипов (синих и красных кривых), обнаруженных на необработанных данных. Черная смелая кривая указывает среднее значение соответствующих красных кривых. (H) Raster участок с указанием времени марки, связанные с каждым всплеском обнаружены. Различные цвета подчеркивают различные электроды. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры. 

Ген Фоуард Обратный
Nurr1 GGCTGAAGCCATCTTGTGTGT GTGAGGTCCATGCTAACTGACA
Й GCACCTTCGCGCAGTTCTCT CCCGAACTCCGTGAA
EEF1 АГКААААААТКАКАККАААТГ GCCTGGATGGTCAGGATA
GAPDH ГКАКАААГАГААААГАГАГАГАГАГАЗАк AGGGGAGATCAGTGTGTGTGTGTGTGTGTGTGTGT

Таблица 1: Праймеры, используемые в этом протоколе.

Discussion

Одним из наиболее важных аспектов этого протокола является поддержание плюрипотентности hESC во время культивирования клеток и тщательный мониторинг сфер и нейроорганоидной морфологии. hESCs очень чувствительны, и каждая манипуляция может привести к ранней неконтролируемой дифференциации, а также смерти клеток. Для повышения экспериментальной воспроизводимости и избежания возникновения аномальных кариотипных явлений рекомендуется криоконсервировать несколько партий гЭСК при самом низком проходе после проверки их хромосомного устойчивости. Кроме того, рекомендуется разморозить новый флакон для каждого эксперимента и проверять поведение клеток каждый день. Если сферы менее рефракционные с аномальным более высоким размером, они, скорее всего, начнут агрегировать и умирать.

Одним из улучшений в этой системе является либо перфузии или реализации васкуляризированной системы (путем добавления эндотелиальных клеток или в 3D жидкости микрочип)12,13. Однако контроль толщины нервного органоида (300 мкм) позволяет эффективно перетусывать кислород и питательные раны и предотвращает некроз. Другим усовершенствованием является введение иммунных клеток (микроглии). С учетом этих ограничений, нервные органоиды плюс система GIC может быть соответствующим инструментом по нескольким причинам. Во-первых, эта система позволяет скрининг наркотиков для мониторинга того, как терапевтическое соединение может повлиять на органоид или опухолевые клетки. Во-вторых, можно изучить взаимодействие между клетками и клетками, а микроэкологические детерминанты, лежащие в основе индивидуальных и коллективных вторжений, можно визуализировать и изучить5,6,13.

В контексте болезни Паркинсона, нервный органоид, обогащенный нейронами DA, может представлять собой соответствующую и точную 3D-модель для изучения развития болезни. В предыдущих исследованиях, Паркинсона пациента полученных индуцированных плюрипотентных стволовых клеток, дифференцированных по отношению к DA нейронов были использованы для изучения пострадавших нейронных подтипов. Следует отметить, что некоторые связанные с болезнями фенотипы, такие как накопление синуклеина и чувствительность к окислительному стрессу, наблюдались14,15. Кроме того, нервный органоид может быть использован в качестве инструмента для проверки терапевтических молекул. Тем не менее, конкретные и соответствующие считывании должны быть созданы для оценки dA нейронов выживания и функциональности, такие как производство допамина и электрофизиологической активности. В целом, этот протокол обеспечивает два стандартизированных и точных подходов на основе стволовых клеток для генерации нервных органоидов.

Disclosures

Авторы не заявляют о каких-либо конкурирующих финансовых интересах.

Acknowledgments

Авторы благодарят La Ligue Genevoise Contre le Cancer (Генева, Швейцария), ISREC Foundation (Лозанна, Швейцария) и Фонд Клейтона по исследованиям (Хьюстон, Техас, США) за финансовую поддержку. Кроме того, авторы благодарят HES-HO и Центр Висса за финансовую поддержку. Мы благодарим лабораторию Краузе за полезные обсуждения и поддержку, а д-ра Халаха Кутаиша за корректуры.

Materials

Name Company Catalog Number Comments
6-well plate (6-well plate) Falcon / Corning 07-201-588
ABI Prism 7900 HT detection system  (Real-Time PCR detection systems) Applied Biosystems Discontinued
Aggrewell 400 (Microwell culture plates ) StemCell Technologies 34421
Amplifier (W2100-HS32)  (Amplifier) Multi Channel Systems
Anti-EGFR (phospho Y1101) antibody Abcam ab76195 1/100 dilution
Anti-GFAP Antibody Dako  Z334  1/1000 dilution
Anti-Nestin, Human Antibody Millipore  ABD69  1/400 dilution
Anti-Synapsin I Antibody Chemicon  AB1543P  1/500 dilution
B27 supplements (B27) Life Technologies / Invitrogen 1238 For both protocol, stock solution 100x, final solution 1x
Brain-derived neurotrophic factor  (BDNF) Cell Guidance GFH1-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
CHIR-99021 (GSK-3β inhibitor ) Axon Medchem ct99021 For Dopaminergic protocol,  stock solution 7.5 mM in DMSO, final solution 3 µM
Compound E a γ–secretase inhibitor (γ–secretase inhibitor) Calbiochem CAS 209986-17-4 For both protocol (gamma-secretase inhibitor XXI),  stock solution 5 mM in DMSO, final solution 1 µM
Coulochem III  (Coulometric detector parameters) Thermo scientific
Dibutyryl cyclic-AMP (Dibutyryl cAMP) Sigma D0627 For Dopaminergic protocol,  stock solution 0.5 M in DMSO, final solution 0.5 mM
Dimethyl Sulfoxide Pure (DMSO) Sigma-Aldrich C6164 Compounds solvent, ready to use
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 12491-015 For cell culture, ready to use
Dulbecco's Modified Eagle Medium Mixture F-12 (DMEM-F12) Gibco 11320033 For cell culture, ready to use
EDTA 0.1 mM (EDTA) Life Technologies AM9912 For cell culture, ready to use
Epidermal Growth Factor (EGF) Gibco PHG0313 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
Fibroblast Growth Factor 20 (FGF20) Peprotech 100-41 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 5 ng/mL
fibroblast growth factor 8  (FGF8) Peprotech GFH176-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
Fibroblast growth factor-basic (bFGF) Gibco PHG0024 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
G5 supplements (G5) Invitrogen 17503012 For GIC culture, stock solution 100x, final solution 1x
Glial cell-derived neurotrophic factor (GDNF) Cell Guidance GFH2-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
Hydrophilic polytetrafluoroethylene  membrane (PTFE membrane) BioCell-Interface Discontinued
LDN-193189 (BMP inhibitor) Axon Medchem /Stemgen 04-0072-02 /1509 Dual/Smad,  stock solution 5 mM in DMSO, final solution 0.5 µM
L-glutamine (L-glutamine) Gibco 25030081 L-Glutamine (200 mM), stock solution 200 mM, final solution 2 mM
Matrigel (extracellular matrix) BD Biosciences 354277 hESC-qualified Matrix, stock solution 18-22 mg/mL, final solution 180-220 µg/mL
Millicell-CM Culture plate insert  (0.4 µm) (Culture plate insert) Millipore PICM03050
Monoclonal Anti-β-Tubulin III antibody Sigma  T8660  1/1000 dilution
MS Orbital Shaker, MS-NOR-30 (Orbital shaker) Major Science MS-NRC-30
N2 supplements (N2) Invitrogen 17502-048 For GIC culture, stock solution 100x, final solution 1x
Nanodrop (Nanodrop) Thermo Fisher Scientific Discontinued
Neurobasal (Neurobasal) Life Technologies / Gibco 21103049 Maintenance and maturation embryonic neuronal cell populations , ready to use
Non-Essential Amino Acids  (NEAA) Gibco 11140 Non-essential Amino Acids 100X, stock solution 100x, final solution 1x
Nurr1 Antibody (M-196) Santa Cruz Sc-5568 1/100 dilution
Nutristem  (hESC medium ) Biological Industries 05-100-1A Stem cell media, ready to use
Penicilin / Streptomycin  (Penicilin / Streptomycin ) Life Technologies / Gibco 15140122 For cell culture, stock solution 5 mg/mL, final solution 50 µg/mL 
Perchloric acid 0.1N (HCLO4) Merck 100519 For HPLC, ready to use
Phosphate Buffered Saline without Ca2+/Mg2+  (PBS without Ca2+/Mg2+ ) Life Technologies 14190250 For cell culture, ready to use
PrimeScript RT-PCR Kit (Reverse transcription kit) Takara RR014A
Purmorphamin (smoothened agonist) Calbiochem SML0868 For Dopaminergic protocol,  stock solution 10 mM in DMSO, final solution 2 µM
Rho-associated Kinase Y-27632 (ROCK) Abcam Biochemicals ab120129-1 Rock Inhibitor,  stock solution 50 mM in DMSO, final solution 10 µM
RNeasy mini kit (RNA extraction kit ) Qiagen 74104
SB-431542 (TGFβ/Activin/Nodal inhibitor ) Ascent Asc- 163 Dual-Smad,  stock solution 50 mM in DMSO, final solution 10 µM
Sonic Hedgehog (SHH) Cell Guidance GFH168-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
StemPro Accutase (hESC enzymatic solution) Gibco A11105-01 hESC enzymatic solution, ready to use
Symmetry C-18,5 mm (4.6 150mm2)  (Reversed-phase column) Waters Corporation
T150 flask (T150 flask) Falcon 08-772-1F
TH Antibody (F-11) Santa Cruz Sc-25269 1/200 dilution
Transforming Growth Factors beta 3 (TGFβ3) Cell Guidance GFH109-2 For Dopaminergic protocol,  stock solution 100 µg/mL in pure ethanol , final solution 1 ng/mL
Trichostatine A (inhibitor of histone deacetylase ) Sigma T8552 For Dopaminergic protocol,  stock solution 100 µM in DMSO, final solution 20 nM
TrypLE (recombinant enzymatic solution) Invitrogen 12604021 recombinant enzymatic solution, ready to use
Trypsin 0.25% (enzymatic solution) Life Technologies 15050065 enzymatic solution, ready to use
W2100, Multi Channel Systems (Data acquisition system ) WAT045905
X-vivo (serum free medium) Lonza BE04-743Q serum free medium, ready to use

DOWNLOAD MATERIALS LIST

References

  1. Louis, D. N., et al. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary. Acta Neuropathologica. 131, (6), 803-820 (2016).
  2. Stupp, R., et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. New England Journal of Medicine. 352, (10), 987-996 (2005).
  3. Daphu, I., et al. In vivo animal models for studying brain metastasis: value and limitations. Clinical and Experimental Metastasis. 30, (5), 695-710 (2013).
  4. Huszthy, P. C., et al. In vivo models of primary brain tumors: pitfalls and perspectives. Neuro Oncology. 14, (8), 979-993 (2012).
  5. Nayernia, Z., et al. The relationship between brain tumor cell invasion of engineered neural tissues and in vivo features of glioblastoma. Biomaterials. 34, (33), 8279-8290 (2013).
  6. Cosset, E., et al. Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials. 107, 74-87 (2016).
  7. Pringsheim, T., Jette, N., Frolkis, A., Steeves, T. D. The prevalence of Parkinson's's disease: a systematic review and meta-analysis. Movement Disorders. 29, (13), 1583-1590 (2014).
  8. Rajput, A. H., et al. Globus pallidus dopamine and Parkinson's motor subtypes: clinical and brain biochemical correlation. Neurology. 70, (16 Pt 2), 1403-1410 (2008).
  9. Jellinger, K. A. Pathology of Parkinson's's disease. Changes other than the nigrostriatal pathway. Molecular and Chemical Neuropathology. 14, (3), 153-197 (1991).
  10. Bernheimer, H., Birkmayer, W., Hornykiewicz, O., Jellinger, K., Seitelberger, F. Brain dopamine and the syndromes of Parkinson’s and Huntington. Clinical, morphological and neurochemical correlations. Journal of Neurological Science. 20, (4), 415-455 (1973).
  11. Tieng, V., et al. Engineering of midbrain organoids containing long-lived dopaminergic neurons. Stem Cells and Development. 23, (13), 1535-1547 (2014).
  12. Chen, C. S. 3D Biomimetic Cultures: The Next Platform for Cell Biology. Trends in Cell Biology. 26, (11), 798-800 (2016).
  13. Friedl, P., Sahai, E., Weiss, S., Yamada, K. M. New dimensions in cell migration. Nature Reviews Molecular Cell Biology. 13, (11), 743-747 (2012).
  14. Byers, B., et al. SNCA triplication Parkinson's's patient's iPSC-derived DA neurons accumulate alpha-synuclein and are susceptible to oxidative stress. PLoS ONE. 6, (11), e26159 (2011).
  15. Flierl, A., et al. Higher vulnerability and stress sensitivity of neuronal precursor cells carrying an alpha-synuclein gene triplication. PLoS ONE. 9, (11), e112413 (2014).
Человеческие нейронные органоиды для изучения рака мозга и нейродегенеративных заболеваний
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).More

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter