Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Bioengineering

Organoides neuronales humanos para el estudio del cáncer cerebral y las enfermedades neurodegenerativas

doi: 10.3791/59682 Published: June 28, 2019
* These authors contributed equally

Summary

Este estudio introduce y describe protocolos para derivar dos organoides neuronales humanos específicos como un modelo relevante y preciso para el estudio de 1) desarrollo de glioblastoma humano dentro de organoides neuronales humanos exclusivamente en humanos y 2) neurona dopaminérgica diferenciación que genera un organoide tridimensional.

Abstract

La falta de modelos neuronales in vitro relevantes es un obstáculo importante en el progreso médico de las neuropatologías. El establecimiento de modelos celulares relevantes es crucial tanto para comprender mejor los mecanismos patológicos de estas enfermedades como para identificar nuevas dianas y estrategias terapéuticas. Para ser pertinente, un modelo in vitro debe reproducir las características patológicas de una enfermedad humana. Sin embargo, en el contexto de la enfermedad neurodegenerativa, un modelo in vitro relevante debe proporcionar el reemplazo de células neuronales como una valiosa oportunidad terapéutica.

Tal modelo no sólo permitiría el cribado de moléculas terapéuticas, sino que también se puede utilizar para optimizar la diferenciación del protocolo neural [por ejemplo, en el contexto del trasplante en la enfermedad de Parkinson (PD)]. Este estudio describe dos protocolos in vitro de 1) desarrollo de glioblastoma humano dentro de una diferenciación de organoides neuronales humanos (NO) y 2) neurondopamineérgica (DA) que genera un organoide tridimensional (3D). Para ello, se estableció un protocolo bien estandarizado que permite la producción de neuroesferas calibradas de tamaño derivadas de la diferenciación de células madre embrionarias humanas (hESC). El primer modelo se puede utilizar para revelar eventos moleculares y celulares que ocurren durante el desarrollo del glioblastoma dentro del organoide neural, mientras que el organoide DA no sólo representa una fuente adecuada de neuronas DA para la terapia celular en la enfermedad de Parkinson, sino que también puede ser utilizado para pruebas de drogas.

Introduction

La Organización Mundial de la Salud (OMS) clasifica los astrocitomas como de grado bajo (grado I a II) o de grado alto (grado III y IV). Glioblastoma multiforme (GBM) es un astrocitoma grado IV, el más letal de los tumores cerebrales primarios, que es resistente a todas las formas actuales de tratamientos1. A pesar de la terapia estándar de atención, incluida la neurocirugía, la quimioterapia y la radioterapia, GBM sigue siendomortal y la tasa de supervivencia global de 15 meses no ha cambiado drásticamente en los últimos 15 años 2. Para lograr progresos significativos en la comprensión de la patogénesis GBM, el uso de modelos relevantes es clave. Hasta ahora, el estudio de GBM se ha basado en líneas celulares, rodajas organotípicas de roedores y xenotrasplante de células derivadas del paciente en ratones o ratones transgénicos que desarrollan tumores espontáneos3,4. Aunque estos modelos han sido útiles para estudiar la metástasis cerebral y la agresividad tumoral, están restringidos por diferencias entre especies, y las conclusiones resultantes pueden traducirse incorrectamente a los tejidos humanos. Además, los modelos existentes con células humanas tambiénestán limitados por la ausencia de interacciones entre tejido huésped/tumor 3,4. Los modelos experimentales son fundamentales para la traducción de la ciencia básica a las dianas terapéuticas. Por lo tanto, describir un protocolo para producir organoides neuronales humanos in vitro co-cultivados con células que inician GBM (JCC) puede proporcionar un sistema relevante que imita las características morfológicas y funcionales del desarrollo de GBM. Este sistema reproduce algunas características in vivo del desarrollo de GBM, como la migración difusa de células invasoras y áreas de necrosis, y destaca la expresión génica relevante para la biología tumoral. Como se reveló anteriormente, algunos microARN críticos son inducidos durante el desarrollo de GIC dentro del tejido nervioso 3D5,6.

La DP es un trastorno neurodegenerativo importante y seasocia con la degeneración de múltiples subtipos neuronales 7. Incluso si una aparición progresiva de síntomas (por ejemplo, bradiquinesia, temblor de reposo asimétrico, rigidez e inestabilidad de la postura) caracteriza la enfermedad, su etiología exacta no está claramente establecida. De hecho, muchos estudios han puesto de relieve la evidencia de que los principales factores de riesgo pueden resultar de una combinación de factores genéticos y ambientales. Los síntomas de Parkinson se asocian con la degeneración bilateral de las neuronas dopaminérgicas en la substancia nigra (SN), lo que lleva a la desaparición de los axones dopaminérgicos (DA) que se proyectan al estriado8,9. Por lo tanto, la reducción de los niveles de dopamina estriacional se correlaciona con la progresión de la disfunción motora en pacientes con DP. Las neuronas dopaminérgicas contienen tirosina hidroxilasa (TH), una enzima clave en la síntesis de neurotransmisores catecolamángicos que convierte el aminoácido L-tirosina a L-3,4-dihidroxifenilalanina (L-DOPA, un precursor de la dopamina) a la dopamina10. La pérdida temprana de la actividad TH seguida de una disminución en la expresión de la proteína TH es un sello distintivo de la DP.

Este estudio describe dos protocolos que utilizan organoides neuronales humanos, con uno orientado específicamente hacia un fenotipo similar al cerebro medio enriquecido con células TH positivas.

Protocol

Este protocolo sigue las directrices del comité de ética de la investigación humana de la Universidad de Ginebra.

1. Mantenimiento y cultivo de células madre embrionarias humanas indiferenciadas (HESC)

  1. Realizar el mantenimiento y la expansión de los hSECs en condiciones libres de alimentación mediante el recubrimiento previo de platos con una matriz extracelular específica.
    1. Descongelar 300 ml de matriz extracelular a 4 oC (concentración de rango típico 18-22 mg/ml, mantener en hielo) y mezclar suavemente con 15 ml de medio DMEM frío para evitar una gelación prematura de la matriz extracelular. Añadir 7,5 ml del matric extracelular a ambos matraces T150.
    2. Incubar los platos recubiertos con matriz extracelular a 37oC durante al menos 1 h (máximo durante la noche).
    3. Retire los HESC medios y de semillas a una densidad de 6,5 x 104 celdas/cm2.
  2. Mantener H1 (línea celular de HESC) en el medio de hESC y 1% penicilina/estreptomicina.
  3. Pasar las células con procedimiento enzimático: añadir 7,5 ml de solución enzimática a un matraz T75 cm2 durante un período de 1-2 min a 37 oC. Una vez que las celdas estén completamente separadas, agregue 7,5 ml de DMEM-F12 y luego centrífuga durante 5 min a 300 x g. Para permitir una mejor supervivencia, vuelva a placar las células a la densidad deseada en platos recubiertos con matriz extracelular, en el mismo medio que contiene inhibidor de la proteína quinasa asociada a Rho (ROCK) (10 m) durante 24 horas.

2. organoides neuronales derivados del hESC para estudios de GBM

  1. 24 h antes de iniciar el cultivo 3D, sustituya el medio hESC por un medio libre de suero complementado con un inhibidor de LANCA de 10 m (ambos componentes son necesarios para apoyar la supervivencia celular y la formación espontánea de la neurosfera durante la fase de agregación en un micropozo placa). Las células deben estar al 60% de confluencia. Al día siguiente (día 0), separe las colonias de hESC como células individuales: retire el medio, luego enjuague con PBS sin Ca2+/ Mg2+,agregue 5 ml de solución de disolución enzimática e incubar a 37 oC durante 1-2 min.
  2. Recoger las células en medio libre de suero con 10 m de inhibidor de ROCK y centrifugar las células a 300 x g durante 5 min. Retire el sobrenadante y cuente las células en 10 ml de medio libre de suero complementado con 10 oM de inhibidor de ROCK.
  3. En paralelo, enjuague la placa de micropocillos con 2 ml de medio libre de suero por pozo y centrifugar la placa a 1200 x g durante 5 min para eliminar todas las burbujas, lo que puede prevenir la formación de la neuroesfera.
  4. Preparar 28,2 x 106 de células en 12,5 ml de medio libre de suero complementado con inhibidor de ROCK de 10 m. Dispensar 1000 células/micropozo. Centrifugar las células a 300 x g durante 5 min y colocar la placa en la incubadora a 37oC durante la noche (máximo 36 h). Por ejemplo: para obtener 30 organoides neuronales humanos, utilice un matraz T150 al 70%-80% de la confluencia (alrededor de 30 millones de células).
  5. Al día siguiente (día 1), recoger las esferas (con un P1000) y colocarlos en un plato de 6 pozos. En cada poca, añadir 2 mL de medio B27 y DMEM-F12 GlutaMAX y medio neurobasal (mezcla a 1:1), complementado con 1% de suplementos B27 y 1% de aminoácidos no esenciales (NEAA). Para promover la inducción neuronal rápida, complemente el medio con un cóctel de inhibición dual-SMAD, compuesto por 10 M de TGF/Activin/Inhibidor Nodal e inhibidor de la proteína morfogénica ósea (BMP) de 0,5 m. A partir de este paso adelante, las esferas se cultivan en rotación (60 rpm, agitador orbital). La rotación es crítica para evitar que las esferas se peguen juntas o a la placa.
  6. Cambiar el medio cada 2-3 días: doblar la placa y dejar que las esferas caigan durante 5 min, quitar la mitad del medio (2 ml), y añadir 2 ml de medio B27 fresco complementado con factores de crecimiento e inhibidores. No centrifugar las esferas.
  7. Realizar la inducción neuronal de acuerdo con el siguiente curso de tiempo:
    1. A partir de los días 1-4, cultivar las esferas en el medio B27 complementado con dual-SMAD. El cóctel de inhibición de doble SMAD (10 M TGF/Activin/Inhibidor Nodal y inhibidor de LA BMP de 0,5 m) promueve la inducción neuronal.
    2. A partir de los días 4-11, promover la proliferación de rosetas neurales derivadas de hESC (en las esferas), añadiendo 10 ng/ml de factor de crecimiento epidérmico (EGF) y factor fibroblasto básico de 10 ng/mL (bFGF) al medio B27 complementado con cóctel de doble SMAD.
      NOTA: El día 11, la mayoría de las células deben ser positivas para la anidación.
    3. A partir de los días 11-13, el cultivo de las esferas en medio B27 complementado con inhibidor de BMP de 0,5 M.
    4. A partir de los días 13-21, cultivo de las esferas en el medio B27 complementado con factor neurotrófico derivado del glial de 10 ng/ml (GDNF), factor neurotrófico derivado del cerebro de 10 ng/ml (BDNF) y 1 M de inhibidor de la secretasa. GDNF y BDNF promueven la diferenciación neuronal y glial. El inhibidor de la secretasa permite una mayor maduración neuronal.
    5. En el día 21, placa las esferas (alrededor de 1.000 esferas) en una membrana de politetrafluoroetileno hidrófilo (PTFE) (6 mm de diámetro, 0,4 m) depositadas en un inserto de placa de cultivo diseñado para 6 placas de pozo. Detenga cualquier rotación de este paso. La presencia de rosetas, observadas con un microscopio de campo brillante, indican el inicio de la diferenciación neuronal. Las rosetas neurales se pueden observar 2-3 días después de las esferas de chapado en la membrana de PTFE.
    6. Añadir 1 ml de medio B27 complementado con factores de crecimiento e inhibidores (según se indica) a cada pocal debajo del inserto de membrana, cada 2-3 días (generalmente los lunes, miércoles y viernes), para unas siguientes 3 semanas de diferenciación.
    7. A partir de los días 21-25, cultivar los organoides neuronales humanos en el mismo medio de maduración neural (cf. paso 2.7.4).
    8. A partir de los días 25-28, solo complemente el medio B27 con un inhibidor de 1 m de secretasa.
    9. A partir de los días 28-39, deje de agregar el inhibidor de la secretasa y continúe el cultivo organoide neural humano solo en el medio B27.
      NOTA: Después de 3 semanas, los organoides neurales están listos para su uso para la implantación de GIC. A lo largo de la maduración neuronal, se observó una disminución del marcador inmaduro neural Nestin y el aumento de los marcadores neuronales maduros 3-tubulina y GFAP.

3. Aislamiento y cultivo de células que inician el glioblastoma (CIG)

  1. Aísle los GIF fragmentando una biopsia de GBM humana de alto grado. Transfiera el pedazo de tumor en un vaso de precipitados que contenga 0,25% de trippsina en 0,1 mM de EDTA (4:1) y revuelva lentamente a 37 oC durante 30-60 min (dependiendo del tamaño del tumor).
  2. Placa de las células disociadas en matraces de cultivo tisular de 75 cm2 chapados en 2.500-5.000 células por cm2 en medio GIC: medio DMEM/F-12 (1:1) que contiene 1% N2, 1% B27 y 1% suplementos de G5 (para favorecer la supervivencia gic), complementados con bFGF y EGF (ambos a 10% N2, 1% B27 y 1% suplementos de G5 (para favorecer la supervivencia gico), complementados con bFGF y EGF (ambos a 10% N2, 1% B27 y 1% suplementos de G5 (para favorecer la supervivencia de GIC), complementados con bFGF y EGF (ambos a 10% N2, 1% B27 y 1% suplementos De G5 (para favorecer la supervivencia de GIC), complementados con bFGF y EGF (ambos a 10% N2, 1% B27 y 1% suplementos de G5 (para favorecer la supervivencia de GIC), complementados con bFGF y EGF (ambos a 10% N2, 1% B27 ng/Ml, para promover la tallo) y 1% de penicilina/estreptomicina.
  3. Una vez que el GIC esté bien establecido y creciendo, retire los suplementos N2 y G5 del medio GIC.
  4. Un día antes de añadir las células al organoide, disociar los GIC y contarlos.
  5. Enjuague la placa de micropocillos con 2 ml de medio GIC y centrifugar la placa a la velocidad máxima para eliminar burbujas (1000 x g). Coloque los CIC en 1.000 células para obtener una gliomasfera por micropozo. Incubar durante la noche a 37 oC (Figura1C). Este paso es clave y permite LOS GIF bien calibrados (un ejemplo de LOS GIS necróticos y de gran tamaño se muestra en la Figura 2A,C).
  6. Para iniciar la invasión GBM, agregue una gliomasfera encima del tejido neural con una punta de pipeta de gran diámetro (Figura1F). Coloque cuidadosamente la placa de 6 pozos de nuevo en la incubadora.

4. Organoides dopaminérgicos derivados del hESC para estudios de DP

  1. Día 0: Amplificar los hESC en el cultivo 2D hasta un 60% de confluencia (día 0), luego reemplace los medios de células madre utilizados para mantener las características de pluripotencia de los HEC con un medio libre de suero. Inicie la inducción neuronal complementando el medio de cultivo con un inhibidor de BMP de 0,5 m y un inhibidor de 10 M De TGF/Activin/Nodal (cóctel de inhibición dual-SMAD), luego agregue un inhibidor de ROCK de 10 m durante 24 horas para aumentar la tasa de supervivencia de las células durante el paso.
  2. Día 1: Preparar la placa de micropocillos con 2,5 ml por pozo de medio libre de suero complementado con inhibidor de BMP de 0,5 m, 10 M de TGF/Activin/Inhibidor nodal y 10 oM de inhibidor de ROCK. Para especificar las células hacia el patrón ventral del tubo neural, agregue 100 ng/ml de sonic erizo (SHH), 100 ng/ml de factor de crecimiento de fibroblastos 8 (FGF8) y agonista suavizado de 2 m. Centrifugar la placa (sólo con células medianas y sin células) a 1200 x g durante 5 min para eliminar las burbujas de aire de los micropocillos.
    1. Después de 1 día de inducción neuronal en 2D, retire el medio y lave rápidamente con PBS sin Ca2+/MgCl2+. Disociar las colonias en suspensión de células individuales añadiendo 7,5 ml de solución enzimática recombinante en un matraz T75 cm 2. Incubar durante 2 min a 37oC y luego completar con 7,5 mL de DMEM-F12.
    2. Recoger la suspensión celular y centrífuga a 300 x g durante 5 min. Retire el sobrenadante y cuente las células en el mismo medio utilizado para preparar la placa de micropocillos.
    3. Ajustar el volumen medio para obtener una suspensión celular que permite formar neuroesferas que contienen 1000 células por micropocillo (por ejemplo, la placa de micropocillos utilizada aquí contiene 4.700 micropocillos por pocillo). Por lo tanto, preparar 4,7 millones de células en 2,5 ml de medio y añadirlo a los 2,5 ml anteriores de medio ya colocados en la placa.
    4. Con el fin de distribuir correctamente las células en cada micropocillo, agitar suavemente la placa, y centrifugar la placa de micropocillos 300 x g durante 5 minutos. Incubar la placa a 37 oC durante 24 h para generar esferas.
  3. Día 2: Enjuague suavemente los micropocillos con el medio y recoja las esferas en una placa de seis pocillos tratada con tejido. Reemplace el medio por medio neurobasal complementado con 1% B27, 1x NEAA, 2 mM de L-glutamina y 1% de penicilina/estreptomicina. Además, agregue los factores de regionalización SHH, FGF8, agonista suavizado y moléculas pequeñas de inhibición dual-SMAD.
    1. Colocar las esferas en rotación a 37 oC (60 rpm, agitador orbital) y cambiar medio medio recién complementado cada 2-3 días.
  4. Día 3: Para mejorar la inducción neuronal y convertiren en progenitores neuronales con una identidad de cerebro medio, complemente el medio con el inhibidor GSK-3 de 3 m, que activa la vía Wnt/-catenina. Mantener el inhibidor gSK-3 en el medio hasta el día 13. Dividir en dos nuevas placas de 6 pozos tratadas con tejido para reducir la densidad de la esfera por pozo y evitar la agregación de esferas.
    NOTA: En el Día 8, la mayoría de las células deben ser positivas para la Nestin.
  5. Día 8: Iniciar la maduración neuronal: reemplazar los factores de regionalización SHH, FGF8, agonista suavizado y cóctel de inhibición dual-SMAD con 0,5 mM de campo de dibutilo (para favorecer la maduración), inhibidor de 20 nM de la histona deacetilasa (para la salida del ciclo celular), 1 m de secretasa inhibidores y factores de crecimiento, 10 ng/mL GDNF, 10 ng/mL BDNF, 1 ng/mL transformando el factor de crecimiento n.o 3 (TGF-3) y 5 ng/mL FGF20 (ambos favorecen la supervivencia del progenitor DA). Cambie el medio cada 2-3 días.
  6. Día 21: Generar el organoide neural: semilla alrededor de 100 neuroesferas bajo condiciones de interfaz aire-líquido en membrana de PTFE (6 mm de diámetro). Transfiera la membrana a un inserto de placa de cultivo (0,4 mm) y añada 1,2 ml de medio de maduración neuronal utilizado para la diferenciación de la neuroesfera como se describió anteriormente.
    1. Detenga cualquier rotación de este paso. Cambie el medio cada 2-3 días hasta que se alcance el punto de tiempo de diferenciación requerido.
      NOTA: En cuanto a la maduración neuronal, se observó una disminución del marcador inmaduro neural Nestin y el aumento de los marcadores neuronales maduros 3-tubulina y GFAP. Se observaron expresiones HIGH TH y NURR1 (Figura3C)y confirmaron la madurez organoide neural11.

5. Cuantificación de la expresión génica TH y Nurr1 para la validación de la diferenciación dopaminérgica

  1. Extracción de ARN: En el día indicado de diferenciación, leja 40 neurosferas con 350 l de tampón RLT (proporcionado en kit de extracción de ARN) complementado con 3,5 l de 2-mercaptoetanol. Extraiga el ARN de las neuroesferas lysed usando un kit de extracción de ARN siguiendo las instrucciones del fabricante.
  2. Cuantificar las concentraciones totales de ARN.
  3. Realice la transcripción inversa de 300 ng de la extracción total de ARN utilizando un kit de transcripción inversa para la reacción cuantitativa en cadena de la polimerasa en tiempo real (qPCR) y siga las instrucciones del fabricante.
  4. Realice análisis qPCR en sistemas de detección de PCR en tiempo real, basados en la detección asimétrica de tinte de cianina. Normalizar los datos con genes de limpieza: gliceraldehído-3-fosfato deshidrogenasa (GAPDH) y factor de alargamiento 1-alfa (EF1). Las secuencias de imprimaciones se describen en la Tabla 1.

6. Detección de cromatografía líquida de alta presión (HPLC)

  1. Utilice cromatografía líquida de alta presión (HPLC) con detección electroquímica para detectar la presencia de dopamina. La dopamina se extrajo al lisiar organoides neurales en 100 ml de 0.1 N ácido perclórico (HClO4) durante 15 minutos a 4 oC con un vórtice vigoroso cada 5 min. Después de la centrifugación, recoger y almacenar el sobrenadante a -20 oC para la dosis de dopamina.
  2. Utilice una columna C-18 (5 m, 4,6 mm x 150 mm) para separar los analitos por HPLC de fase invertida en modo isocrático a un caudal de 1 ml/minuto. La detección de dopamina debe llevarse a cabo utilizando un detector coulométrico con la célula acondicionador establecida en un potencial de +200 mV.

7. Grabación de datos sin procesar con plataforma de matriz microelectode (MEA)

  1. Utilice un microscopio de disección para transferir las neuroesferas al centro de un dispositivo MEA poroso.
  2. Utilice un amplificador y un sistema de adquisición de datos para grabaciones electrofisiológicas. Mida la relación señal-ruido (SNR) como la desviación estándar de la tensión durante una grabación de 5 minutos, utilizando la señal como la tensión promedio de pico a pico de los picos registrados en los mismos 5 períodos min.

Representative Results

Los pasos críticos de este protocolo deben estar bien identificados y manejados correctamente. Por lo tanto, un diagrama de condiciones de cultivo que indica el lapso de tiempo para cada paso, así como los compuestos utilizados para el protocolo de diferenciación se ilustran en la Figura 1A y la Figura 3A para NO más GBM y órganos neuronales DA, respectivamente. La Figura 1B,C,D,E,F ilustra las celdas, las esferas y el NO y muestra la morfología típica para cada paso. Figura 1G,H,I ilustra la tinción de inmunofluorescencia con algunos marcadores neuronales.

Figure 1
Figura 1 : Organoide neural humano (NO) protocolo de diferenciación. (A) Protocolo estandarizado para la generación de NO derivado de células madre embrionarias humanas (hESC). (B) los HECC se mantienen en matriz extracelular en medio hESC. (C) Se utilizaron placas de micropocillos para generar neuroesferas calibradas. A las 2 semanas, las neuroesferas se enchaparon en el inserto que contenía una membrana de PTFE (barra de escala de 50 m). (D) Vista macroscópica de NO en la plaquita en un pozo de una placa de 6 pocillos. Durante los primeros días, se observaron rosetas (flecha negra) (E). (F) Vista macroscópica de una esfera NO más GIC en la parte superior. (G-I) Análisis de inmunofluorescencia de NO más esfera GIC (EGFR-positivo; barra de escala a 50 m) (G) y NO solo, que mostró reactividad inmune para el marcador neuronal -III-tubulina y ligeramente positivo para la nestrina; sin embargo, la sinapsina 1 mostró una señal débil (H,I) (barras de escala de 100 m y 50 m, respectivamente). Haga clic aquí para ver una versión más grande de esta figura. 

Figure 2
Figura 2 : Ilustración de esferas necróticas y NO inmaduros. Las neuroesferas (A) y NO (B) pueden sufrir necrosis cuando son demasiado numerosas en el pozo o sobredimensionadas (C) (barra de escala de 10 m). (D) Un GIC infectado con un reportero de tomate ayuda a rastrear la invasión de células tumorales en NO, barra de escamas, 10 m. Ejemplo de NO inmaduro con tubos neurales (E) y sin tubos neurales (F) (barra de escala a 50 m). Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3 : Protocolo estandarizado para la generación de organoides neuronales DA y análisis electrofisiológico y morfológico. (A) Protocolo estandarizado para la generación de organoides neuronales DA. (B) Análisis de inmunofluorescencia del organoide neural DA; Células inmunorreactivas TH que co-expresan Nurr1, un marcador específico del cerebro medio (barra de escala de 50 m). Los datos se representan como medias - SEM (n.o 3). (C) Los gráficos representan la cinética de la expresión génica TH y Nurr1 evaluada por qRT-PCR. (D) HPLC representativo: pico de dopamina (flecha) fue detectado por HPLC de da lisato organoide neural. (E) Ejemplo de datos sin procesar registrados con la plataforma MEA. Cada pico se muestra mediante una línea vertical (marcas de tiempo), mientras que el seguimiento restante es el ruido. (F) Imagen que representa una neueuropafera depositada en el AME. (G) Superposición de picos típicos (curvas azules y rojas) detectados a partir de los datos sin procesar. La curva negrita negra indica el promedio de las curvas rojas correspondientes. (H) Trazado ráster que muestra las marcas de tiempo asociadas con cada pico detectado. Los diferentes colores resaltan los diferentes electrodos. Haga clic aquí para ver una versión más grande de esta figura. 

Gene Foward Marcha atrás
Nurr1 GGCTGAAGCCATCTCTTGT GTGAGGTCCATGCTAAACTTGACA
TH GCACCTTCGCGCAGTTCT CCCGAACTCCACCGTGAA
EEF1 AGCAAAAATGACCCACCAATG GCCTGGATGGTTCAGGATA
Gapdh GCACAAGAGGAAAGAGAGAGAGAGAACC AGGGGAGATTCAGTAGGTGT

Tabla 1: Primers utilizados en este protocolo.

Discussion

Uno de los aspectos más críticos de este protocolo incluye el mantenimiento de la pluripotencia hESC durante el cultivo celular y la estrecha monitorización de las esferas y la morfología organoide neural. los hESC son muy sensibles, y cada manipulación puede conducir a una diferenciación temprana e incontrolada, así como a la muerte celular. Con el fin de aumentar la reproducibilidad experimental y evitar la ocurrencia de eventos anormales de cariotipo, se aconseja criopreservar varios lotes de HESC en el paso más bajo después de la validación de su estabilidad cromosómica. Además, se recomienda descongelar un nuevo vial para cada experimento y comprobar el comportamiento de las células todos los días. Si las esferas son menos refractivas con un tamaño anormal mente mayor, es probable que comiencen a acumularse y morir.

Una mejora en este sistema es la perfusión o la implementación de un sistema vascularizado (mediante la adición de células endoteliales o dentro de un microchip fluido 3D)12,13. Sin embargo, el control del grosor del organoide neural (300 m) permite una perfusión pasiva eficiente de oxígeno y nutriciones y previene la necrosis. Otra mejora es la introducción de células inmunitarias (microglia). Teniendo en cuenta estas limitaciones, los organoides neuronales más un sistema GIC pueden ser una herramienta relevante por varias razones. En primer lugar, este sistema permite la detección de fármacos para monitorear cómo un compuesto terapéutico puede afectar a un organoide o célula tumoral. En segundo lugar, se pueden estudiar las interacciones de célula a célula, y los determinantes microambientales subyacentes a las invasiones individuales y colectivas se pueden visualizar y explorar5,6,13.

En el contexto de la enfermedad de Parkinson, un organoide neural enriquecido en las neuronas DA puede representar un modelo 3D relevante y preciso para estudiar el desarrollo de la enfermedad. En estudios anteriores, las células madre pluripotentes inducidas por el paciente de Parkinson diferenciadas hacia las neuronas DA se han utilizado para estudiar los subtipos neuronales afectados. Cabe destacar que se han observado algunos fenotipos relacionados con la enfermedad, como la acumulación de la sinucleina y la sensibilidad al estrés oxidativo14,15. Además, el organoide neural puede utilizarse como una herramienta para detectar moléculas terapéuticas. Sin embargo, lecturas específicas y relevantes deben configurarse para evaluar la supervivencia de la neurona DA y la funcionalidad, como la producción de dopamina y la actividad electrofisiológica. En conjunto, este protocolo proporciona dos enfoques estandarizados y precisos basados en células madre para generar organoides neuronales.

Disclosures

Los autores no declaran intereses financieros en competencia.

Acknowledgments

Los autores agradecen a la Ligue Genevoise Contre le Cancer (Ginebra, Suiza), a la IsREC Foundation (Lausana, Suiza) y a la Clayton Foundation for Research (Houston, TX, EE. UU.) por su apoyo financiero. Además, los autores agradecen a HES-HO y al Wyss Center por su apoyo financiero. Agradecemos al laboratorio de Krause por sus útiles discusiones y apoyo y al Dr. Halah Kutaish por su corrección.

Materials

Name Company Catalog Number Comments
6-well plate (6-well plate) Falcon / Corning 07-201-588
ABI Prism 7900 HT detection system  (Real-Time PCR detection systems) Applied Biosystems Discontinued
Aggrewell 400 (Microwell culture plates ) StemCell Technologies 34421
Amplifier (W2100-HS32)  (Amplifier) Multi Channel Systems
Anti-EGFR (phospho Y1101) antibody Abcam ab76195 1/100 dilution
Anti-GFAP Antibody Dako  Z334  1/1000 dilution
Anti-Nestin, Human Antibody Millipore  ABD69  1/400 dilution
Anti-Synapsin I Antibody Chemicon  AB1543P  1/500 dilution
B27 supplements (B27) Life Technologies / Invitrogen 1238 For both protocol, stock solution 100x, final solution 1x
Brain-derived neurotrophic factor  (BDNF) Cell Guidance GFH1-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
CHIR-99021 (GSK-3β inhibitor ) Axon Medchem ct99021 For Dopaminergic protocol,  stock solution 7.5 mM in DMSO, final solution 3 µM
Compound E a γ–secretase inhibitor (γ–secretase inhibitor) Calbiochem CAS 209986-17-4 For both protocol (gamma-secretase inhibitor XXI),  stock solution 5 mM in DMSO, final solution 1 µM
Coulochem III  (Coulometric detector parameters) Thermo scientific
Dibutyryl cyclic-AMP (Dibutyryl cAMP) Sigma D0627 For Dopaminergic protocol,  stock solution 0.5 M in DMSO, final solution 0.5 mM
Dimethyl Sulfoxide Pure (DMSO) Sigma-Aldrich C6164 Compounds solvent, ready to use
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 12491-015 For cell culture, ready to use
Dulbecco's Modified Eagle Medium Mixture F-12 (DMEM-F12) Gibco 11320033 For cell culture, ready to use
EDTA 0.1 mM (EDTA) Life Technologies AM9912 For cell culture, ready to use
Epidermal Growth Factor (EGF) Gibco PHG0313 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
Fibroblast Growth Factor 20 (FGF20) Peprotech 100-41 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 5 ng/mL
fibroblast growth factor 8  (FGF8) Peprotech GFH176-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
Fibroblast growth factor-basic (bFGF) Gibco PHG0024 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
G5 supplements (G5) Invitrogen 17503012 For GIC culture, stock solution 100x, final solution 1x
Glial cell-derived neurotrophic factor (GDNF) Cell Guidance GFH2-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
Hydrophilic polytetrafluoroethylene  membrane (PTFE membrane) BioCell-Interface Discontinued
LDN-193189 (BMP inhibitor) Axon Medchem /Stemgen 04-0072-02 /1509 Dual/Smad,  stock solution 5 mM in DMSO, final solution 0.5 µM
L-glutamine (L-glutamine) Gibco 25030081 L-Glutamine (200 mM), stock solution 200 mM, final solution 2 mM
Matrigel (extracellular matrix) BD Biosciences 354277 hESC-qualified Matrix, stock solution 18-22 mg/mL, final solution 180-220 µg/mL
Millicell-CM Culture plate insert  (0.4 µm) (Culture plate insert) Millipore PICM03050
Monoclonal Anti-β-Tubulin III antibody Sigma  T8660  1/1000 dilution
MS Orbital Shaker, MS-NOR-30 (Orbital shaker) Major Science MS-NRC-30
N2 supplements (N2) Invitrogen 17502-048 For GIC culture, stock solution 100x, final solution 1x
Nanodrop (Nanodrop) Thermo Fisher Scientific Discontinued
Neurobasal (Neurobasal) Life Technologies / Gibco 21103049 Maintenance and maturation embryonic neuronal cell populations , ready to use
Non-Essential Amino Acids  (NEAA) Gibco 11140 Non-essential Amino Acids 100X, stock solution 100x, final solution 1x
Nurr1 Antibody (M-196) Santa Cruz Sc-5568 1/100 dilution
Nutristem  (hESC medium ) Biological Industries 05-100-1A Stem cell media, ready to use
Penicilin / Streptomycin  (Penicilin / Streptomycin ) Life Technologies / Gibco 15140122 For cell culture, stock solution 5 mg/mL, final solution 50 µg/mL 
Perchloric acid 0.1N (HCLO4) Merck 100519 For HPLC, ready to use
Phosphate Buffered Saline without Ca2+/Mg2+  (PBS without Ca2+/Mg2+ ) Life Technologies 14190250 For cell culture, ready to use
PrimeScript RT-PCR Kit (Reverse transcription kit) Takara RR014A
Purmorphamin (smoothened agonist) Calbiochem SML0868 For Dopaminergic protocol,  stock solution 10 mM in DMSO, final solution 2 µM
Rho-associated Kinase Y-27632 (ROCK) Abcam Biochemicals ab120129-1 Rock Inhibitor,  stock solution 50 mM in DMSO, final solution 10 µM
RNeasy mini kit (RNA extraction kit ) Qiagen 74104
SB-431542 (TGFβ/Activin/Nodal inhibitor ) Ascent Asc- 163 Dual-Smad,  stock solution 50 mM in DMSO, final solution 10 µM
Sonic Hedgehog (SHH) Cell Guidance GFH168-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
StemPro Accutase (hESC enzymatic solution) Gibco A11105-01 hESC enzymatic solution, ready to use
Symmetry C-18,5 mm (4.6 150mm2)  (Reversed-phase column) Waters Corporation
T150 flask (T150 flask) Falcon 08-772-1F
TH Antibody (F-11) Santa Cruz Sc-25269 1/200 dilution
Transforming Growth Factors beta 3 (TGFβ3) Cell Guidance GFH109-2 For Dopaminergic protocol,  stock solution 100 µg/mL in pure ethanol , final solution 1 ng/mL
Trichostatine A (inhibitor of histone deacetylase ) Sigma T8552 For Dopaminergic protocol,  stock solution 100 µM in DMSO, final solution 20 nM
TrypLE (recombinant enzymatic solution) Invitrogen 12604021 recombinant enzymatic solution, ready to use
Trypsin 0.25% (enzymatic solution) Life Technologies 15050065 enzymatic solution, ready to use
W2100, Multi Channel Systems (Data acquisition system ) WAT045905
X-vivo (serum free medium) Lonza BE04-743Q serum free medium, ready to use

DOWNLOAD MATERIALS LIST

References

  1. Louis, D. N., et al. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary. Acta Neuropathologica. 131, (6), 803-820 (2016).
  2. Stupp, R., et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. New England Journal of Medicine. 352, (10), 987-996 (2005).
  3. Daphu, I., et al. In vivo animal models for studying brain metastasis: value and limitations. Clinical and Experimental Metastasis. 30, (5), 695-710 (2013).
  4. Huszthy, P. C., et al. In vivo models of primary brain tumors: pitfalls and perspectives. Neuro Oncology. 14, (8), 979-993 (2012).
  5. Nayernia, Z., et al. The relationship between brain tumor cell invasion of engineered neural tissues and in vivo features of glioblastoma. Biomaterials. 34, (33), 8279-8290 (2013).
  6. Cosset, E., et al. Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials. 107, 74-87 (2016).
  7. Pringsheim, T., Jette, N., Frolkis, A., Steeves, T. D. The prevalence of Parkinson's's disease: a systematic review and meta-analysis. Movement Disorders. 29, (13), 1583-1590 (2014).
  8. Rajput, A. H., et al. Globus pallidus dopamine and Parkinson's motor subtypes: clinical and brain biochemical correlation. Neurology. 70, (16 Pt 2), 1403-1410 (2008).
  9. Jellinger, K. A. Pathology of Parkinson's's disease. Changes other than the nigrostriatal pathway. Molecular and Chemical Neuropathology. 14, (3), 153-197 (1991).
  10. Bernheimer, H., Birkmayer, W., Hornykiewicz, O., Jellinger, K., Seitelberger, F. Brain dopamine and the syndromes of Parkinson’s and Huntington. Clinical, morphological and neurochemical correlations. Journal of Neurological Science. 20, (4), 415-455 (1973).
  11. Tieng, V., et al. Engineering of midbrain organoids containing long-lived dopaminergic neurons. Stem Cells and Development. 23, (13), 1535-1547 (2014).
  12. Chen, C. S. 3D Biomimetic Cultures: The Next Platform for Cell Biology. Trends in Cell Biology. 26, (11), 798-800 (2016).
  13. Friedl, P., Sahai, E., Weiss, S., Yamada, K. M. New dimensions in cell migration. Nature Reviews Molecular Cell Biology. 13, (11), 743-747 (2012).
  14. Byers, B., et al. SNCA triplication Parkinson's's patient's iPSC-derived DA neurons accumulate alpha-synuclein and are susceptible to oxidative stress. PLoS ONE. 6, (11), e26159 (2011).
  15. Flierl, A., et al. Higher vulnerability and stress sensitivity of neuronal precursor cells carrying an alpha-synuclein gene triplication. PLoS ONE. 9, (11), e112413 (2014).
Organoides neuronales humanos para el estudio del cáncer cerebral y las enfermedades neurodegenerativas
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).More

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter