Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Bioengineering

Beyin kanseri ve nörodejeneratif hastalıkların Incelenmesi için insan nöral Organoidler

doi: 10.3791/59682 Published: June 28, 2019
* These authors contributed equally

Summary

Bu çalışmada, iki spesifik insan nöral organoidleri, insan sinirsel organoidlerin içinde sadece insanlarda ve 2) nöron dopaminerjik olarak eğitim için ilgili ve doğru bir model olarak 1) insan glioblastoma gelişimi türetmek için protokoller tanıtır ve açıklanmaktadır üç boyutlu bir organoid üreten farklılaşma.

Abstract

İlgili in vitro nöral modellerin eksikliği nöropatoloji için tıbbi ilerlemede önemli bir engeldir. İlgili hücresel modellerin kurulması, bu hastalıkların patolojik mekanizmalarını daha iyi anlamak ve yeni terapötik hedefleri ve stratejileri belirlemek için çok önemlidir. Uygun olmak için, bir in vitro model bir insan hastalığının patolojik özelliklerini çoğaltmak gerekir. Ancak, nörodejeneratif hastalık bağlamında, ilgili bir in vitro model değerli bir terapötik fırsat olarak nöral hücre değiştirme sağlamalıdır.

Böyle bir model sadece terapötik moleküllerin taramasına izin vermez ama aynı zamanda nöral protokol farklılaşması optimize etmek için kullanılabilir [Örneğin, Parkinson hastalığında transplantasyon bağlamında (PD)]. Bu çalışmada, insan sinirsel organoids (No) ve 2) nöron dopaminerjik (da) farklılaşma üç boyutlu (3D) organoid üreten içinde 1) insan glioblastoma gelişimi iki in vitro protokolleri açıklanmaktadır. Bu amaçla, insan embriyonik kök hücresi (hESC) farklılaşma elde edilen boyut kalibrasyonlu nörokürlerin üretimini sağlayan iyi standartlaştırılmış bir protokol kuruldu. İlk model, nöral nevuslardır içinde glioblastoma gelişimi sırasında meydana gelen moleküler ve hücresel olayları ortaya çıkarmak için kullanılabilir, da nevuslardır sadece Parkinson hastalığında hücre tedavisi için da nöronların uygun bir kaynak temsil değil, aynı zamanda olabilir ilaç testi için kullanılabilir.

Introduction

Dünya Sağlık Örgütü (WHO) düşük dereceli (sınıf ı II) veya yüksek dereceli (grade III ve IV) olarak astrositomları sınıflandırır. Glioblastoma multiforme (GBM) bir astrositom grade IV, primer beyin tümörlerinin en ölümcüldür, bu tedaviler tüm mevcut formları dayanıklıdır1. Nöroşirürji, kemoterapi ve radyoterapi dahil olmak üzere standart bakım tedavisine rağmen, GBM ölümcül kalır ve 15 aylık genel hayatta kalma oranı son 15 yıl2' de önemli ölçüde değişmemiştir. GBM patogenezini anlamada önemli ilerlemeler sağlamak için ilgili modellerin kullanımı anahtardır. Şimdiye kadar, GBM çalışma hücre hatları, kemirgen organottifik dilimleri ve fare veya transjenik fareler içine hasta türeyen hücrelerin ksenotransplantasyon güvenmiştir spontan tümörler geliştirmek3,4. Bu modeller beyin metastam ve tümör saldırganlık çalışması için yararlı olmasına rağmen, onlar türler arasında farklılıklar ile sınırlıdır, ve sonuç yanlış insan dokularına çevrilebilir olabilir. Dahası, insan hücreleri ile mevcut modeller de ana doku yokluğunda sınırlıdır/tümör etkileşimleri3,4. Deneysel modeller temel bilimin terapötik hedeflere çevirisi için önemlidir. Bu nedenle, GBM-başlatma hücreleri (Gıcs) ile birlikte kültürlü insan nöral organoidler üretmek için bir protokol açıklayan GBM gelişimi morfolojik ve fonksiyonel özellikleri taklit ilgili bir sistem sağlayabilir. Bu sistem, işgal hücrelerin ve nekroz alanlarının difüzör göçü gibi GBM gelişiminin bazı in vivo özelliklerini yeniden üretir ve tümör Biyolojisi ile ilgili gen ifadesini vurgular. Daha önce ortaya çıktığı gibi, bazı kritik MicroRNAs 3D sinir dokusu içinde GIC geliştirme sırasında indüklenir5,6.

PD büyük bir nörodejeneratif bozukluk ve multipl nöronal alt türleri7ile ilişkili. Belirtiler (örneğin, bradikezi, asimetrik dinlenme tremor, rijitlik ve duruş istikrarsızlık) Progressive başlangıçlı olsa bile, tam etiyolojisi açıkça kurulmaz. Nitekim, birçok çalışmada büyük risk faktörleri genetik ve çevresel faktörlerin bir arada neden olabilir kanıtlar vurgulandı. Parkinson belirtileri, dopaminergik nöronların bilateral dejenerasyonu ile ilişkilidir (sn), bu da striatum8,9' a yansıtılmaları için (da) aksonların kaybolmasına yol açan. Bu nedenle, striatal dopamin düzeylerinin azaltılması PD hastalarında motor fonksiyon bozukluğu ilerlemesi ile ilişkilidir. Dopaminerjik nöronlar tirozin hidroksilaz (TH) içerir, dopamin10için amino asit l-Tirozini l-3, 4-dihiddroxyphenylalanine (l-dopa, dopamin öncüsü) dönüştüren katekolaminergik nörotransmitter sentezinde anahtar bir enzim. TH proteini ifadesinde bir düşüş sonrasında ıncı aktivitesinin erken kaybı PD 'nin bir damgasını oluşturur.

Bu çalışmada, insan nöral organoidleri kullanarak iki protokol açıklanmaktadır, özellikle TH-pozitif hücreler ile zenginleştirilmiş bir orta beyin benzeri fenotip doğru odaklı bir.

Protocol

Bu protokol Cenevre Üniversitesi insan Araştırmaları Etik Komitesi 'nin yönergelerine uyur.

1. farklılaşmış insan embriyonik kök hücrelerinin bakım ve kültürü (hESCs)

  1. Belirli bir ekstrelüler matris ile ön kaplama yemekleri ile besleyici içermeyen koşullarda hSECs 'nin bakım ve genişlemesini gerçekleştirin.
    1. Çözülme 300 μL 4 °C ' de (tipik menzil konsantrasyonu 18-22 mg/mL, buz üzerinde tutun) ve 15 mL soğuk DMEM orta ile hafifçe karıştırın, ekstrellüler matrisin erken bir jelasyonunu önlemek için. Ekleme 7,5 ml her iki T150 flasks için ekstrellüler girmiyorsun.
    2. 37 °C ' de en az 1 saat (maksimum gecede) için ekstrellüler matriks ile kaplanmış yemekleri inküt.
    3. Orta ve tohum hESCs 6,5 x 104 hücreli/cm2yoğunluğuna çıkarın.
  2. HESC orta ve 1% penisilin/streptomisin içinde H1 (hESC hücre hattı) koruyun.
  3. Hücreleri enzimatik prosedürle geçirin: 37 °C ' de 1-2 dk. T75 cm2 Flask 'A 7,5 ml enzimatik çözelti ekleyin. Hücreler tamamen ayrıldıktan sonra, 7,5 mL DMEM-F12 ekleyin ve sonra 300 x g'de 5 dakika santrifüjün. Daha iyi bir hayatta kalma için izin vermek için, istenen yoğunlukta hücre dışı matris kaplı yemekler üzerine yeniden plaka hücreleri, Rho ilişkili protein kinaz (ROCK) inhibitörü (10 μM) içeren aynı ortamda 24 saat.

2. GBM çalışmaları için hESC-türev nöral organoidler

  1. 3D kültürünü başlatmadan önce 24 saat, hESC ortamını, 10 μM kaya inhibitörü ile takviye edilen serum içermeyen bir ortam ile değiştirin (her iki bileşen de bir mikrokuyu içinde toplama aşamasında hücre hayatta kalma ve spontan nöroküre oluşumunu desteklemek için gereklidir. plaka). Hücreler 60% konfluency olmalıdır. Ertesi gün (0. gün), hESC kolonilerini tek hücreler olarak ayırın: ortamı çıkartın, sonra CA2 +/mg2 +olmadan PBS ile durulayın, 5 ml enzimatik çözünme solüsyonu ekleyin ve 37 °c ' de 1-2 dk. boyunca inküye yapın.
  2. 10 μM kaya inhibitörü ile serum içermeyen ortamdaki hücreleri toplayın ve 5 dakika boyunca 300 x g 'lik hücrelerde Santrifüjü kaldırın ve 10 μm kaya inhibitörü ile tamamlayıcı olarak 10 ml serum-ücretsiz orta hücrelerde sayınız.
  3. Paralel olarak, mikrowell plaka ile durulayın 2 mL serum-ücretsiz orta başına ve plaka Santrifüjü 1200 x g 5 dakika tüm kabarcıkları kaldırmak için, hangi nöroküre oluşumu önleyebilir.
  4. 10 μM kaya inhibitörü ile takviye edilen serum-ücretsiz orta 12,5 mL hücrelerde 28,2 x 106 hazırlayın. 1000 hücreleri/mikrokuyu dispense. Hücreleri 5 dakika 300 x g 'de santrifüjler ve plakayı, 37 °c ' de (maksimum 36 h), kuluçorda yerleştirin. Örneğin: 30 insan nöral organoidleri elde etmek için,% 70-% 80 ' lik bir T150 Flask kullanın (yaklaşık 30.000.000 hücre).
  5. Ertesi gün (gün 1), küreler toplamak (bir P1000 ile) ve 6 iyi plaka yerleştirin. Her iyi, eklemek 2 mL B27 orta ve DMEM-F12 GlutaMAX ve Nörobasal Orta (Mix 1:1), ile tamamlayıcı 1% B27 takviyeleri ve 1% olmayan esansiyel amino asitler (NEAA). Hızlı nöral indüksiyon tanıtmak için, 10 μM TGFβ/Activin/nodal inhibitörü ve 0,5 μM kemik morfojenik protein (BMP) inhibitörü oluşan Dual-SMAD inhibisyonu kokteyl ile orta ek. Bu adımda ileri, küreler rotasyon kültürlü (60 rpm, orbital Shaker). Rotasyon küreler birlikte veya plaka yapışmasını önlemek için önemlidir.
  6. Her 2-3 gün Orta değiştirin: plaka viraj ve küreler 5 dakika aşağı düşmek izin, Orta (2 mL) yarısını kaldırmak ve büyüme faktörleri ve inhibitörleri ile tamamlayıcı 2 mL taze B27 orta ekleyin. Küreler Santrifüjü yapmayın.
  7. Aşağıdaki zaman kursuna göre nöral indüksiyon gerçekleştirin:
    1. Gün 1-4, bir kültür, bir çift-SMAD ile desteklenen B27 orta küreler. Dual-SMAD inhibisyonu kokteyl (10 μM TGFβ/Activin/nodal inhibitörü ve 0,5 μM BMP inhibitörü) nöral indüksiyon teşvik.
    2. 4-11 günden itibaren, 10 ng/ml epidermal büyüme faktörü (EGF) ve 10 ng/ml temel fibroblast faktörü (bFGF) ekleyerek çift-Smad kokteyli ile desteklenen B27 ortamına HESC türevi nöral rozet (küreler içine) proliferasyonu teşvik.
      Not: 11. günde, hücrelerin çoğu Nestin için pozitif olmalıdır.
    3. Gün 11-13, bir kültür, B27, 0,5 μM BMP inhibitörü ile desteklenen orta küreler.
    4. Gün 13-21, kültür, 10 ng/mL glial türetilmiş nörotrofik faktör (GDNF), 10 ng/mL beyin türeyen nörotrofik faktör (BDNF) ve 1 μM γ-secretaz inhibitörü ile tamamlayıcı B27 orta küreler. GDNF ve BDNF nöronal ve glial farklılaşma teşvik. Γ-secretaz inhibitörü daha fazla nöral olgunlaşma sağlar.
    5. 21. gün, bir hidrofilik Politetrafloroetilen (PTFE) membran (6 mm çapı, 0,4 μm) üzerinde küreler (yaklaşık 1.000 küreler) plaka 6 kuyu plakası için tasarlanmış bir kültür plaka Ekle yatırılır. Bu adımda herhangi bir döndürme durdurun. Parlak alan mikroskobu ile gözlenen Rosettes varlığı, nöral farklılaşma başlamasını gösterir. Nöral rozet PTFE membran üzerinde kaplama küreler sonra 2-3 gün görülebilir.
    6. Büyüme faktörleri ve inhibitörleri ile tamamlayıcı 1 mL B27 orta ekleyin (takip gibi) her iyi membran Ekle altında, her 2-3 gün (genellikle Pazartesi, Çarşamba ve Cuma), farklılaşma aşağıdaki 3 hafta için.
    7. 21-25 günden itibaren, aynı nöral olgunlaşma ortamında insan sinirsel organoidleri yetiştirmek (CF. Adım 2.7.4).
    8. Gün 25-28, sadece 1 μM γ-secretaz inhibitörü ile B27 orta tamamlayıcı.
    9. Gün 28-39, γ-secretaz inhibitörü eklemeyi durdurun ve sadece B27 orta insan nöral nevuslardır kültürü devam.
      Not: 3 hafta sonra, nöral organoidler GıC implantasyonu için kullanıma hazırdır. Nöral olgunlaşma boyunca, nöral olgunlaşmamış Marker Nestin 'in azalması ve olgun nöral işaretçilerinin β3-tubulin ve GFAP artışı gözlenmiştir.

3. glioblastoma-başlatma hücrelerinin yalıtım ve ekimi (Gıcs)

  1. Yüksek dereceli insan GBM biyopsisi ile GICs izole. 0,1 mm EDTA (4:1)% 0,25 tripsin içeren bir kabı içinde tümör parçası transfer ve yavaşça 30-60 dk (tümör boyutuna bağlı olarak) için 37 °c ' de karıştırın.
  2. Plate 75 cm2 doku kültürü şişeler içinde ayrılmış hücreler cm2 başına 2500-5000 hücrelerde kaplama: dmem/F-12 orta (1:1) içeren 1% N2, 1% B27, ve 1% G5 takviyeleri (GIC hayatta kalma lehine), bFGF ve EGF ile tamamlayıcı (her ikisi de 10 ng/ml,) ve penisilin/streptomisin% 1 ' i teşvik etmek.
  3. Bir kez GıC iyi kurulan ve büyüyen, GıC orta N2 ve G5 takviyeleri kaldırın.
  4. Hücreler organoid üzerine eklemeden önce bir gün, Gıcs ayırmak ve onları saymak.
  5. 2 mL GıC orta ile mikrowell plaka durulayın ve kabarcıkları kaldırmak için maksimum hızda plaka Santrifüjü (1000 x g). Microwell başına bir gliomasphere elde etmek için 1.000 hücrelerinde GICs yerleştirin. Gece 37 °C ' de (Şekil 1C) Inküye yapın. Bu adım anahtardır ve iyi kalibre edilmiş GIC 'ler için izin verir ( Şekil 2a,C'de nekrotik ve aşırı boyutlu gics örneği gösterilir).
  6. GBM istilası başlatmak için, büyük bir pipet ucu (Şekil 1F) ile nöral doku üzerine bir gliomasphere ekleyin. 6 kuyu plakasını dikkatlice kuluçevine yerleştirin.

4. PD çalışmaları için hESC-türev dopaminerjik organoidler

  1. Gün 0:% 60 konfluency (gün 0) kadar 2D kültürde hESCs yükseltmek, sonra serum-ücretsiz orta ile hESCs pluripotency özelliklerini korumak için kullanılan kök hücre medya değiştirin. 0,5 μM BMP inhibitörü ve 10 μM TGFβ/Activin/nodal inhibitörü (Dual-SMAD inhibisyonu kokteyli) ile kültür ortamını tamamlayıcı olarak nöral indüksiyon başlatın, sonra 10 μM kaya inhibitörü ekleyin 24 h geçiş sırasında hücrelerin hayatta kalma oranını artırmak için.
  2. 1. gün: 0,5 μM BMP inhibitörü, 10 μm tgfβ/activin/nodal inhibitörü ve 10 μm kaya inhibitörü ile tamamlayıcı serum-ücretsiz orta başına 2,5 ml ile mikrokuyu plaka hazırlayın. Nöral tüpün ventral desenine doğru hücreleri belirlemek için 100 ng/mL Sonic Hedgehog (SHH), 100 ng/mL fibroblast büyüme faktörü 8 (FGF8) ve 2 μM düzgünleştirilmiş agonist ekleyin. Plaka Santrifüjü (sadece orta ve hücrelerle birlikte) 1200 x g 'de 5 dakika boyunca hava kabarcıklarını mikrokuyulardan çıkarmak için.
    1. 2D nöral indüksiyon 1 gün sonra, orta çıkarın ve CA2 +/MgCl2 +olmadan PBS ile hızlı bir şekilde yıkayın. T75 cm2 flask 'de 7,5 ml rekombinant enzimatik çözeltisi ekleyerek kolonileri tek hücrelerde süspansiyon ile ayırın. 37 °C ' de 2 dakika boyunca inkübe sonra 7,5 mL DMEM-F12 ile tamamlayın.
    2. 300 x g 'de hücre süspansiyon ve Santrifüjü toplayın 5 dk. süpernatant kaldırmak ve mikrowell plaka hazırlamak için kullanılan aynı ortamda hücreleri saymak.
    3. Mikrowell başına 1000 hücre içeren nörokürler oluşturmak için izin veren bir hücre süspansiyonu elde etmek için orta hacmi ayarlayın (örneğin, burada kullanılan mikrokuyu plaka iyi başına 4.700 Mikrokuyucuklu içerir). Yani, hazırlamak 4.700.000 hücreleri Orta 2,5 mL ve önceden plaka yerleştirilen orta önceki 2,5 mL ekleyin.
    4. Her bir mikrokuyu hücrelerinde doğru dağıtmak için, hafifçe plaka sallayın ve 5 dk için mikrokuyu plaka 300 x g Santrifüjü, Ocak 37 °c ' de 24 h için küreler oluşturmak için tabur.
  3. 2. gün: mikrokuyuları hafif bir şekilde orta ve topla ve ardından küreler doku-tedavi altı-kuyu plakasında aktarın. % 1 B27, 1x NEAA, 2 mM L-glutamin ve penisilin/streptomisin 1% ile desteklenen Nörobazal orta ile orta değiştirin. Ayrıca, bölge faktörleri SHH, FGF8, düzleştirilmiş agonist ve Dual-SMAD inhibisyonu küçük molekülleri ekleyin.
    1. 37 °C ' de (60 rpm, orbital Shaker) rotasyonlu küreler yerleştirin ve her 2-3 günde bir yarım orta taze takviye yapın.
  4. 3. gün: nöral indüksiyon geliştirmek ve bir orta beyin kimliği ile nöral progenatörler dönüştürmek Için, 3 μM GSK-3β inhibitörü ile orta ek, WNT/β-katenin yol etkinleştirir. 13. güne kadar orta GSK-3β inhibitörü koruyun. Hem Küre yoğunluğunu azaltmak hem de küre toplama önlemek için iki yeni doku-tedavi 6 kuyu plakaları bölünmüş.
    Not: 8. gün, hücrelerin çoğu Nestin için pozitif olmalıdır.
  5. 8. gün: nöral olgunlaşma başlatın: bölgeselleşme faktörleri Shh, FGF8, düzeltilir agonist ve Dual-Smad inhibisyonu kokteyl 0,5 mm dibutyryl Camp (olgunlaşma lehine), 20 Nm inhibitörü histon deasetilaz (hücre döngüsü çıkışı için), 1 μM γ-secretase değiştirin inhibitör ve büyüme faktörleri, 10 ng/ml GDNF, 10 ng/ml BDNF, 1 ng/ml dönüşüm büyüme faktörü β3 (tgfβ3), ve 5 ng/ml FGF20 (her iki lehine da progenitör Survival). Her 2-3 günde bir ortamı değiştirin.
  6. 21. gün: nöral organoid oluşturun: PTFE membran (6 mm çapında) üzerinde hava-sıvı arayüz koşulları altında 100 nörokürler etrafında tohum. Membranı bir kültür plakası sokasına (0,4 mm) aktarın ve daha önce açıklandığı gibi nöroküre farklılaşması için kullanılan 1,2 mL nöral olgunlaşma ortamını ekleyin.
    1. Bu adımda herhangi bir döndürme durdurun. Gerekli farklılaşma zaman noktası elde edilinceye kadar her 2-3 günde bir ortamı değiştirin.
      Not: nöral olgunlaşma Ile Ilgili olarak, nöral olgunlaşmamış işaretçinin Nestin 'in azalması ve olgun nöral işaretçilerinin β3-tubulin ve GFAP artışı gözlenmiştir. Yüksek TH ve NURR1 ifadeleri (Şekil 3c) gözlenen ve nöral nevuslardır olgunluk onaylamak11.

5. dopaminerjik farklılaşma geçerliliği için TH ve Nurr1 Gen ifadesinin ölçülmesi

  1. RNA ekstraksiyonu: belirtilen farklılaşma gününde, 350 μL RLT tampon ile Lyse 40 nörokürler (RNA ekstraksiyon kiti ile birlikte verilir) 2-mercaptoetanol ile 3,5 μL ile desteklenmektedir. Üreticinin talimatlarını takiben RNA ekstraksiyon kiti kullanarak RNA 'ya lysed nörokürlerin özü.
  2. Toplam RNA konsantrasyonlarını ölçün.
  3. Nicel gerçek zamanlı polimeraz zincir reaksiyonu (qPCR) için Ters transkripsiyon kiti kullanılarak toplam RNA ekstraksiyonu 300 ng Ters transkripsiyon gerçekleştirin ve üreticinin talimatlarını izleyin.
  4. Asimetrik Siyanin boya tespiti temelinde gerçek zamanlı PCR algılama sistemlerinde qPCR analizini gerçekleştirin. Temizlik genler ile veri normalleştirmek: gliseraldehit-3-fosfat dehidrojenaz (GAPDH) ve uzama faktörü 1-alfa (EF1). Astar dizileri Tablo 1' de açıklanmıştır.

6. yüksek basınçlı sıvı kromatografi (HPLC) tespiti

  1. Dopamin varlığını algılamak için elektrokimyasal algılama ile yüksek basınçlı sıvı kromatografi (HPLC) kullanın. Dopamin 100 ml 0,1 N perklorik asit (HClO4) içinde parçalanması nöral organoidler tarafından çıkarılan 15 dk 4 °c ' de her 5 dakikada bir güçlü bir vortekslenir ile. Santrifüjden sonra, dopamin dozu için süpernatant 'ı-20 °c ' de toplayın ve saklayın.
  2. Analitleri, 1 mL/dakika akış hızında izokrat modda ters fazlı HPLC ile ayırmak için C-18 sütununu (5 μm, 4,6 mm x 150 mm) kullanın. Dopamin tespiti + 200 MV potansiyeline sahip klima hücresi seti ile bir Kulometrik Dedektör kullanılarak yapılmalıdır.

7. microelectode dizi (MEA) platformu ile ham veri kaydı

  1. Nöroküreler gözenekli MEA cihazının merkezine aktarmak için bir diseksiyon mikroskop kullanın.
  2. Elektrofizyolojik kayıtlar için bir amplifikatör ve veri toplama sistemi kullanın. Sinyal-gürültü oranı (SNR) 5 dakika kayıt sırasında voltajın standart sapması olarak ölçer, aynı 5 dk dönemde kaydedilen sivri ortalama zirve-to-pik voltaj olarak sinyal kullanarak.

Representative Results

Bu protokolün kritik adımlarının iyi tanımlanmalı ve düzgün şekilde işlenmesi gerekir. Bu nedenle, her adım için zaman aşımı ve farklılaşma protokolü için kullanılan bileşikler gösteren kültür koşullarının bir diyagramı sırasıyla Şekil 1a ve No artı GBM ve da nöral organoidler Için Şekil 3A 'da gösterilmektedir. Şekil 1B, C, D, E, F, hücreleri, küreler ve Hayır gösterir ve her adım için tipik morfoloji gösterir. Şekil 1G, H, ben bazı nöral işaretçileri ile immünofluorescence boyama gösterir.

Figure 1
Şekil 1 : İnsan nöral nevuslardır (No) farklılaşma protokolü. (A) insan embriyonik kök hücrelerinden (HESC) türetilen No nesil için standardize protokol. (B) HESC ortamdaki ekstrasellüler matriks üzerinde korunur. (C) kalibre edilmiş nöroküreler oluşturmak için microwell plakaları kullanılmıştır. 2 hafta içinde, nörokürler PTFE membranı içeren kesici uç üzerine kaplama yapıldı (ölçek çubuğu = 50 μm). (D) 6 kuyu plakasının bir kuyusu içinde eklemin içine No makroskopik görünümü. İlk günlerde, rozet (siyah ok) (E) görüldü. (F) üst KıSMıNDA bir No artı GIC küre makroskopik görünümü. (G-ı) NO artı GIC küre immünofluorescence Analizi (EGFR-pozitif; ölçek çubuğu = 50 μm) (G) ve tek başına, nöronal Marker βııı-tubulin için bağışıklık reaktivite gösterdi ve nestin için biraz olumlu; Ancak, synapsin 1 zayıf bir sinyal gösterdi (H, ı) (ölçek çubukları = 100 μm ve 50 μm, sırasıyla). Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız. 

Figure 2
Şekil 2 : Necrotik küreler ve OLGUNLAŞMAMıŞ No Illustration. Nöroküreler (A) ve No (B), iyi veya büyük boyutlu (C) (ölçek çubuğu = 10 μm) çok fazla olduğunda nekroz geçirilebilir. (D) bir domates muhabiri ile enfekte biri hiçbir tümör hücresi istilası izlemek için yardım, ölçek Bar, 10 μm. nöral tüpler (E) ve hiçbir nöral tüpler (F) (ölçek çubuğu = 50 μm) ile olgunlaşmamış No örneği. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Figure 3
Şekil 3 : Da nöral nevuslardır üretimi için standardize protokol ve elektrofizyolojik ve morfolojik analizler. (A) da nöral organoidlerin üretimi için standartlaştırılmış protokol. (B) da nöral organoid immünofluorescence Analizi; TH-İmmünoreaktif hücreler Co-ifade Nurr1, bir orta beyin özel Marker (ölçek çubuk = 50 μm). Veriler ortalama ± SEM (n = 3) olarak temsil edilir. (C) grafikler QRT-PCR tarafından DEĞERLENDIRILEN TH ve Nurr1 Gen ifadesinin kinetiği temsil eder. (D) temsilci HPLC: dopamin zirvesinde (ok) HPLC tarafından da nöral nevuslardır lizat tespit edildi. (E) Mea platformuyla kaydedilmiş ham veri örneği. Kalan izleme gürültü ise her başak dikey bir çizgi (zaman damgaları) tarafından görüntülenir. (F) Mea 'da bir nöroküre temsil eden resim. (G) ham verilerden algılanan tipik sivri (mavi ve kırmızı eğrilerin) süper konumu. Siyah kalın eğrisi, karşılık gelen kırmızı eğrilerin ortalamasını gösterir. (H) raster grafiği algılanan her başak ile ilişkili zaman damgalarını gösterir. Farklı renkler farklı elektrotları vurgulamaktadır. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız. 

Gen Foward Ters
Nurr1 (Aktaş) GGAGGTCCATGCTAAACTTGACA
TH GÜLSEN BIR daha
EEF1 Emre k (GCCTGGATGGTTCAGGATA)
HÜSEYIN bozkurt Gcacaagagagalagaalağakarararararar AGGGGAGATTCAGTGTGGGT

Tablo 1: Bu protokolde kullanılan astar.

Discussion

Bu protokolün en önemli yönlerinden biri, hücre kültürü ve küreler ve nöral nevuslardır morfoloji yakın izlenmesi sırasında HESC pluripotency bakımı içerir. hESCs çok duyarlıdır ve her manipülasyon erken kontrolsüz farklılaşma yanı sıra hücre ölümü yol açabilir. Deneysel yeniden üretilebilirliği artırmak ve anormal karyotip olayların oluşumunu önlemek için, kromozom stabilitesini doğrulamadan sonra en düşük geçit sırasında birkaç hESCs toplu saklama tavsiye edilir. Dahası, her deneme için yeni bir şişe çözme ve hücrelerin davranışını her gün kontrol etmek için tavsiye edilir. Eğer küreler anormal yüksek boyutta daha az refraktif ise, muhtemelen toplama ve ölmek başlayacaktır.

Bu sistem üzerine bir gelişme ya perfüzyon ya da bir vaskülarize sistemi uygulama (endotel hücreleri ekleyerek veya bir 3D fluidik mikroçip içinde)12,13. Ancak, nöral nevuslardır kalınlığı kontrol (≤ 300 μm) oksijen ve besin verimli pasif perfüzyon sağlar ve nekroz önler. Başka bir gelişme bağışıklık hücrelerinin (microglia) giriş olduğunu. Bu sınırlamalar akılda, nöral organoids artı bir GıC sistemi çeşitli nedenlerle ilgili bir araç olabilir. İlk olarak, bu sistem ilaç taramasının bir terapötik bileşiğin bir nevuslardır veya tümör hücresini nasıl etkileyebileceğini izlemesine izin verir. İkincisi, hücre-hücre etkileşimleri incelenebilir ve bireysel ve toplu istilalar temel mikro-çevresel belirleyici görselleştirilebilir ve5,6,13keşfedilebilir.

Parkinson hastalığı bağlamında, da nöronlar içinde zenginleştirilmiş bir nöral nevuslardır hastalık gelişimini incelemek için ilgili ve doğru bir 3D modeli temsil edebilir. Önceki çalışmalarda, Parkinson hastalarına indüklenen pluripotent kök hücreleri da nöronlar doğru ayırt etkilenen nöronal alt türleri incelemek için kullanılmıştır. Dikkat, α-synuclein birikimi ve oksidatif strese duyarlılık gibi hastalıkla ilgili bazı fenotürleri14,15. Dahası, nöral nevuslardır terapötik molekülleri ekrana bir araç olarak kullanılabilir. Bununla birlikte, dopamin üretimi ve elektrofizyolojik aktivite gibi DA nöron hayatta kalma ve işlevselliğini değerlendirmek için belirli ve ilgili okumalar ayarlanmalıdır. Bu protokol, nöral organoidler oluşturmak için iki standart ve doğru kök hücre tabanlı yaklaşımlar sağlar.

Disclosures

Yazarlar hiçbir rakip mali çıkarları beyan.

Acknowledgments

Yazarlar la Ligue Genevoise contre le Cancer (Cenevre, Isviçre), ıSREC Vakfı (Lozan, Isviçre) ve Clayton Araştırma Vakfı (Houston, TX, ABD) mali destek için teşekkür ederiz. Dahası, yazarlar, HES-HO ve Wyss merkezi mali destek için teşekkür ederiz. Krause 'nin laboratuvarına yararlı tartışmalar ve destek ve Dr. Halah Kutaish 'i proofreading için teşekkür ederiz.

Materials

Name Company Catalog Number Comments
6-well plate (6-well plate) Falcon / Corning 07-201-588
ABI Prism 7900 HT detection system  (Real-Time PCR detection systems) Applied Biosystems Discontinued
Aggrewell 400 (Microwell culture plates ) StemCell Technologies 34421
Amplifier (W2100-HS32)  (Amplifier) Multi Channel Systems
Anti-EGFR (phospho Y1101) antibody Abcam ab76195 1/100 dilution
Anti-GFAP Antibody Dako  Z334  1/1000 dilution
Anti-Nestin, Human Antibody Millipore  ABD69  1/400 dilution
Anti-Synapsin I Antibody Chemicon  AB1543P  1/500 dilution
B27 supplements (B27) Life Technologies / Invitrogen 1238 For both protocol, stock solution 100x, final solution 1x
Brain-derived neurotrophic factor  (BDNF) Cell Guidance GFH1-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
CHIR-99021 (GSK-3β inhibitor ) Axon Medchem ct99021 For Dopaminergic protocol,  stock solution 7.5 mM in DMSO, final solution 3 µM
Compound E a γ–secretase inhibitor (γ–secretase inhibitor) Calbiochem CAS 209986-17-4 For both protocol (gamma-secretase inhibitor XXI),  stock solution 5 mM in DMSO, final solution 1 µM
Coulochem III  (Coulometric detector parameters) Thermo scientific
Dibutyryl cyclic-AMP (Dibutyryl cAMP) Sigma D0627 For Dopaminergic protocol,  stock solution 0.5 M in DMSO, final solution 0.5 mM
Dimethyl Sulfoxide Pure (DMSO) Sigma-Aldrich C6164 Compounds solvent, ready to use
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 12491-015 For cell culture, ready to use
Dulbecco's Modified Eagle Medium Mixture F-12 (DMEM-F12) Gibco 11320033 For cell culture, ready to use
EDTA 0.1 mM (EDTA) Life Technologies AM9912 For cell culture, ready to use
Epidermal Growth Factor (EGF) Gibco PHG0313 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
Fibroblast Growth Factor 20 (FGF20) Peprotech 100-41 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 5 ng/mL
fibroblast growth factor 8  (FGF8) Peprotech GFH176-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
Fibroblast growth factor-basic (bFGF) Gibco PHG0024 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
G5 supplements (G5) Invitrogen 17503012 For GIC culture, stock solution 100x, final solution 1x
Glial cell-derived neurotrophic factor (GDNF) Cell Guidance GFH2-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
Hydrophilic polytetrafluoroethylene  membrane (PTFE membrane) BioCell-Interface Discontinued
LDN-193189 (BMP inhibitor) Axon Medchem /Stemgen 04-0072-02 /1509 Dual/Smad,  stock solution 5 mM in DMSO, final solution 0.5 µM
L-glutamine (L-glutamine) Gibco 25030081 L-Glutamine (200 mM), stock solution 200 mM, final solution 2 mM
Matrigel (extracellular matrix) BD Biosciences 354277 hESC-qualified Matrix, stock solution 18-22 mg/mL, final solution 180-220 µg/mL
Millicell-CM Culture plate insert  (0.4 µm) (Culture plate insert) Millipore PICM03050
Monoclonal Anti-β-Tubulin III antibody Sigma  T8660  1/1000 dilution
MS Orbital Shaker, MS-NOR-30 (Orbital shaker) Major Science MS-NRC-30
N2 supplements (N2) Invitrogen 17502-048 For GIC culture, stock solution 100x, final solution 1x
Nanodrop (Nanodrop) Thermo Fisher Scientific Discontinued
Neurobasal (Neurobasal) Life Technologies / Gibco 21103049 Maintenance and maturation embryonic neuronal cell populations , ready to use
Non-Essential Amino Acids  (NEAA) Gibco 11140 Non-essential Amino Acids 100X, stock solution 100x, final solution 1x
Nurr1 Antibody (M-196) Santa Cruz Sc-5568 1/100 dilution
Nutristem  (hESC medium ) Biological Industries 05-100-1A Stem cell media, ready to use
Penicilin / Streptomycin  (Penicilin / Streptomycin ) Life Technologies / Gibco 15140122 For cell culture, stock solution 5 mg/mL, final solution 50 µg/mL 
Perchloric acid 0.1N (HCLO4) Merck 100519 For HPLC, ready to use
Phosphate Buffered Saline without Ca2+/Mg2+  (PBS without Ca2+/Mg2+ ) Life Technologies 14190250 For cell culture, ready to use
PrimeScript RT-PCR Kit (Reverse transcription kit) Takara RR014A
Purmorphamin (smoothened agonist) Calbiochem SML0868 For Dopaminergic protocol,  stock solution 10 mM in DMSO, final solution 2 µM
Rho-associated Kinase Y-27632 (ROCK) Abcam Biochemicals ab120129-1 Rock Inhibitor,  stock solution 50 mM in DMSO, final solution 10 µM
RNeasy mini kit (RNA extraction kit ) Qiagen 74104
SB-431542 (TGFβ/Activin/Nodal inhibitor ) Ascent Asc- 163 Dual-Smad,  stock solution 50 mM in DMSO, final solution 10 µM
Sonic Hedgehog (SHH) Cell Guidance GFH168-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
StemPro Accutase (hESC enzymatic solution) Gibco A11105-01 hESC enzymatic solution, ready to use
Symmetry C-18,5 mm (4.6 150mm2)  (Reversed-phase column) Waters Corporation
T150 flask (T150 flask) Falcon 08-772-1F
TH Antibody (F-11) Santa Cruz Sc-25269 1/200 dilution
Transforming Growth Factors beta 3 (TGFβ3) Cell Guidance GFH109-2 For Dopaminergic protocol,  stock solution 100 µg/mL in pure ethanol , final solution 1 ng/mL
Trichostatine A (inhibitor of histone deacetylase ) Sigma T8552 For Dopaminergic protocol,  stock solution 100 µM in DMSO, final solution 20 nM
TrypLE (recombinant enzymatic solution) Invitrogen 12604021 recombinant enzymatic solution, ready to use
Trypsin 0.25% (enzymatic solution) Life Technologies 15050065 enzymatic solution, ready to use
W2100, Multi Channel Systems (Data acquisition system ) WAT045905
X-vivo (serum free medium) Lonza BE04-743Q serum free medium, ready to use

DOWNLOAD MATERIALS LIST

References

  1. Louis, D. N., et al. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary. Acta Neuropathologica. 131, (6), 803-820 (2016).
  2. Stupp, R., et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. New England Journal of Medicine. 352, (10), 987-996 (2005).
  3. Daphu, I., et al. In vivo animal models for studying brain metastasis: value and limitations. Clinical and Experimental Metastasis. 30, (5), 695-710 (2013).
  4. Huszthy, P. C., et al. In vivo models of primary brain tumors: pitfalls and perspectives. Neuro Oncology. 14, (8), 979-993 (2012).
  5. Nayernia, Z., et al. The relationship between brain tumor cell invasion of engineered neural tissues and in vivo features of glioblastoma. Biomaterials. 34, (33), 8279-8290 (2013).
  6. Cosset, E., et al. Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials. 107, 74-87 (2016).
  7. Pringsheim, T., Jette, N., Frolkis, A., Steeves, T. D. The prevalence of Parkinson's's disease: a systematic review and meta-analysis. Movement Disorders. 29, (13), 1583-1590 (2014).
  8. Rajput, A. H., et al. Globus pallidus dopamine and Parkinson's motor subtypes: clinical and brain biochemical correlation. Neurology. 70, (16 Pt 2), 1403-1410 (2008).
  9. Jellinger, K. A. Pathology of Parkinson's's disease. Changes other than the nigrostriatal pathway. Molecular and Chemical Neuropathology. 14, (3), 153-197 (1991).
  10. Bernheimer, H., Birkmayer, W., Hornykiewicz, O., Jellinger, K., Seitelberger, F. Brain dopamine and the syndromes of Parkinson’s and Huntington. Clinical, morphological and neurochemical correlations. Journal of Neurological Science. 20, (4), 415-455 (1973).
  11. Tieng, V., et al. Engineering of midbrain organoids containing long-lived dopaminergic neurons. Stem Cells and Development. 23, (13), 1535-1547 (2014).
  12. Chen, C. S. 3D Biomimetic Cultures: The Next Platform for Cell Biology. Trends in Cell Biology. 26, (11), 798-800 (2016).
  13. Friedl, P., Sahai, E., Weiss, S., Yamada, K. M. New dimensions in cell migration. Nature Reviews Molecular Cell Biology. 13, (11), 743-747 (2012).
  14. Byers, B., et al. SNCA triplication Parkinson's's patient's iPSC-derived DA neurons accumulate alpha-synuclein and are susceptible to oxidative stress. PLoS ONE. 6, (11), e26159 (2011).
  15. Flierl, A., et al. Higher vulnerability and stress sensitivity of neuronal precursor cells carrying an alpha-synuclein gene triplication. PLoS ONE. 9, (11), e112413 (2014).
Beyin kanseri ve nörodejeneratif hastalıkların Incelenmesi için insan nöral Organoidler
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).More

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter