Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

High-density DNA en RNA micro arrays-Photolithografische synthese, hybridisatie en voorbereiding van grote nucleïnezuur bibliotheken

Published: August 12, 2019 doi: 10.3791/59936

Summary

In dit artikel presenteren en bespreken we nieuwe ontwikkelingen in de synthese en toepassingen van nucleïnezuur micro arrays die in situ zijn gefabriceerd. Concreet laten we zien hoe de protocollen voor DNA-synthese kunnen worden uitgebreid naar RNA en hoe micro arrays kunnen worden gebruikt om opvraagbaar nucleïnezuur bibliotheken te creëren.

Abstract

Photolithografie is een krachtige techniek voor de synthese van DNA oligonucleotiden op glazen glijbanen, omdat het de efficiëntie van fosforamidtische koppelings reacties combineert met de precisie en dichtheid van UV-licht weerspiegeld van micrometer-grote spiegels. Photolithografie levert micro arrays die geschikt zijn voor honderdduizenden tot enkele miljoenen verschillende DNA-sequenties, 100-NT of langer, in slechts een paar uur. Met deze zeer grote sequentie ruimte zijn micro arrays ideale platforms voor het verkennen van de mechanismen van nucleïnezuur · ligand interacties, die bijzonder relevant zijn in het geval van RNA. We hebben onlangs gerapporteerd over de voorbereiding van een nieuwe set van RNA-fosforamidites compatibel met in situ foto lithografie en die vervolgens werden gebruikt om te groeien RNA oligonucleotiden, homopolymeren, evenals Mixed-base sequenties. Hier illustreren we in detail het proces van RNA-Microarray-fabricage, van het experimentele ontwerp, tot instrumentale opstelling, array synthese, deprotection en uiteindelijke hybridisatie test met behulp van een sjabloon 25mer-reeks met alle vier de basissen als voorbeeld. Parallel gaan we verder dan hybridisatie gebaseerde experimenten en benutten we Microarray photolithografie als een goedkope gateway naar complexe nucleïnezuur bibliotheken. Om dit te doen, worden high-density DNA micro arrays gefabriceerd op een base-Sensitive monomeer dat het mogelijk maakt het DNA gemakkelijk te gesplitst en te krijgen na synthese en deprotectie. Het fabricage protocol is geoptimaliseerd om het aantal synthetische fouten te beperken en in die zin wordt een laag β-caroteen oplossing geïntroduceerd om UV-fotonen te absorberen die anders weer op de synthese substraten kunnen reflecteren. We beschrijven in een stapsgewijze manier het volledige proces van bibliotheek voorbereiding, van ontwerp tot decolleté en kwantificering.

Introduction

Het praktische gebruik van DNA-micro arrays is van oudsher in de studie van de variaties in de genexpressie niveaus tussen twee celpopulaties, met behulp van complementaire strengen en fluorescentie als detectiemethode1. Af en toe venture DNA-micro arrays in bindende gebeurtenissen met niet-nucleïnezuur liganden, zoals eiwitten, met een strategie van systematische sequentie permutatie die een uitgebreid overzicht biedt van het bindende landschap2,3, 4,5. Deze aanpak transformeert effectief micro arrays van loutere hybridisatie oppervlakken in platforms met een brede sequentiedekking, wat een aanwinst zou zijn voor de studie van de rijkere en complexere wereld van RNA structuur en functie. Ondersteund door de uiterst efficiënte fosforamidtische koppelingsreactie6, in situ gesynthetiseerde DNA-arrays kunnen nu ook worden beschouwd als een goedkope bron van DNA7, die vooral relevant wordt gezien de steeds toenemende vraag naar nucleïnezuur materiaal voor genassemblage8,9, op DNA gebaseerde nanostructuren10, informatieopslag of sequencing11,12. Evenzo kunnen sequentie technologieën baat hebben bij de ontwikkeling van methoden die zeer complexe mengsels van RNA oligonucleotiden13opleveren. In deze context zijn array fabricage protocollen die het mogelijk maken om oligonucleotiden in situ en bij hoge dichtheid te synthetiseerd, ideaal geplaatst om tegemoet te komen aan de behoeften van het snel uitbreidende gebied van nucleïnezuur biotechnologie. Met een net zo divers gebied als de biotechnologie kan het doel van elke toepassing echter vereisen dat DNA op microarray wordt geproduceerd bij hoge doorvoer of met een zeer geringe hoeveelheid synthetische fouten14,15of beide, waarbij een nader bekijken van de synthese protocollen van DNA-micro arrays die, historisch, zijn voornamelijk geoptimaliseerd voor hybridisatie assays. Ondertussen, in situ synthese van RNA micro arrays is gebleken dat een uitdagende inspanning, met de meeste van de moeilijkheid in verband met de bescherming groep voor de 2 '-OH functie, meestal een silyl-deel in standaard solid-phase synthese die wordt verwijderd met op fluor gebaseerde reagentia, chemicaliën die onverenigbaar zijn met glas-of silicium oppervlakken. Deze problemen en uitdagingen in DNA en RNA Microarray synthese zijn de laatste tijd het onderwerp geweest van een grote hoeveelheid werk, in het bijzonder met de photolithografie aanpak16.

Photolithografie gebruikt UV-licht om oligonucleotiden te deblokkeren vóór koppeling en vereist maskers om een patroon van UV-blootstelling te construeren, waardoor het ruimtelijk organiseren en beheersen van de groei van oligonucleotiden. Fysieke maskers zijn vervangen door computergestuurde micro spiegels, waarvan het kantelen selectief UV-licht reflecteert op de microarray-ondergrond17,18,19. Als UV-bron gebruiken we 365 nm licht uit een High Power LED bron20. Huidige fotolithografische opstellingen zijn uitgerust met Micro mirror arrays met 1024 × 768 spiegels, overeenkomend met meer dan 780.000 individueel adresseerbare spots ("features") op een klein oppervlak van slechts 1,4 cm2, of 1080p met arrays van 1920 × 1080, of > 2 miljoen spiegels. Elk van de spiegels in het apparaat heeft daarom directe controle over de volgorde die op de corresponderende functie is geteeld. Met uitzondering van UV-licht werkt photolithografie als een Solid-phase synthese techniek en neemt de op cyclus gebaseerde fosforamidtische chemie aan. Alleen het vereist een heel andere beschermingsstrategie voor RNA-synthese om te slagen. We ontwikkelden een nieuwe reeks lichtgevoelige RNA-fosforamidites lager hydrazine-labile beschermende groepen21. Deze monomeren maken het mogelijk om het RNA te debeschermen onder milde omstandigheden die geen invloed hebben op de integriteit van het oppervlak. Een eerste deprotection-stap gebruikt Triethylamine om de beschermende groepen van cyanoethylfosfodiester te verwijderen, terwijl hydrazine wordt gebruikt in een tweede, aparte stap om die bij de 2 '-OH-en exocyclische amine-functies te verwijderen. Daarbij kunnen RNA oligonucleotiden ~ 30-NT in lengte en van elke sequentie nu in situ worden gesynthetiseerd op micro arrays22,23. Parallel hieraan zijn we ook recentelijk begonnen met het aanpakken van de doorvoer, kwaliteit en snelheid van DNA-en RNA-foto lithografie. We meten de koppelings efficiëntie > 99% voor alle DNA-en RNA-amidites (Figuur 1) en onderzochten elke afzonderlijke stap in de oligonucleotide-rek cyclus, van oxidatie tijd tot keuze van activator en tot optimale UV-belichting24 , 25. we hebben nieuwe lichtgevoelige 5 ' Bescherm groepen gebracht die alleen in enkele seconden kunnen worden verwijderd, waardoor de synthese van honderdduizenden 100mers wordt getransformeerd in een paar uur lang proces26. We hebben ook de doorvoer van array fabricage verdubbeld door het blootstellen van twee substraten tegelijk27. Ten slotte hebben we een dT-fosforamidiet met een base-Sensitive succinyl-groep geïntroduceerd als een handige manier om DNA en RNA oligonucleotiden te Cleave, te verzamelen en te analyseren, wat centraal staat in de voorbereiding van de bibliotheek28.

Ondanks het relatief alledaagse aspect van DNA en RNA Solid-phase synthese, in het bijzonder voor nucleïnezuur chemici, blijft Microarray photolithografie een niet-triviale upgrade die een complexe opstelling vereist, zorgvuldige controle en toezicht op het proces, en afzonderlijke instructies voor post-synthetische hantering, afhankelijk van de aard van het oligonucleotide en het type toepassing. In dit artikel willen we een gedetailleerde presentatie geven van de volledige stapsgewijze procedure voor in-situ synthese van DNA-en RNA-micro arrays door foto lithografie, van experimenteel ontwerp tot gegevensanalyse, met de nadruk op de voorbereiding van instrumenten en Verbruiksartikelen. Vervolgens beschrijven we de post-synthetische deprotectie methoden die overeenkomen met het beoogde doel van Microarray fabricage (d.w.z. hybridisatie of het herstel van nucleïnezuur bibliotheken).

Protocol

1. ontwerp met Microarray

  1. Schrijf de reeksen die moeten worden gesynthetiseerd in een teksteditor, 5 ' → 3 ', één regel per reeks. Gebruik voor de kwaliteitscontrole 25mer de sequentie "GTCATCATCATGAACCACCCTGGTC". Gebruik A, C, G en T letters voor DNA nucleotiden en 5, 6, 7 en 8 getallen voor RNA nucleotiden.
  2. In het geval van voorbereiding van de bibliotheek, voeg een extra nummer (dat wil zeggen, 9) aan de 3 ' einde van elke reeks. Dit komt overeen met de koppeling van het basis gevoelige monomeer.
  3. Elke sequentie moet gevolgd worden door een komma. Wijs een naam toe aan elke reeks na de komma en controleer of elke Lane de [Sequence, #sequence_name]-indeling volgt (zonder haakjes). Sla de lijst met reeksen op als een. txt-bestand.
  4. Start MatLab en laad vervolgens het programma chip design. m. Voer het programma uit.
  5. Laad het indelingsbestand Microarray Entirechip in het venster van de eigenschappenvenster. Laad het lay-outbestand van de Millichip als het doel is om de hele array op vier identieke locaties te synthetiseren.
  6. Selecteer in het venster van het Eigenschappenpaneel onder chip specificatiede optie container selecteren en vervolgens synthese gebied. Selecteer onder patroonhet patroon dat de juiste hoeveelheid adresseerbare functies oplevert, waarbij het aantal reeksen × aantal replicaties wordt geteld. Voor de kwaliteitscontrole 25mer selecteert u het patroon 25:36.
  7. Selecteer onder container selecterende optie fiducial. Fiducial functies worden meestal gesynthetiseerd in de hoeken van het synthese gebied en worden gebruikt om hybridisatie gegevens te extraheren. Met fiducial geselecteerd, schrijf een sequentie (5 ' → 3 ') die zal worden gesynthetiseerd op fiducial kenmerken en die kan fungeren als een positieve controle. Voor het 25mer-experiment gebruikt u dezelfde DNA-sequentie.
  8. Onder volgordelaadt u het tekstbestand dat alle geschreven reeksen bevat. Zorg ervoor dat Randomize is geselecteerd. Geef een titel aan het experiment in de Project titel en schrijf in linker volgorde ttttt (overeenkomend met een linker T5 ).
  9. Druk op Generateen zoek de array ontwerp bestanden en-maskers (afbeelding 2) onder MaskGen_delta_rc1/Designs folder. Zorg ervoor dat het een weergave script, een stroom volgorde en een ontwerp bestandbevat.
  10. Open het weergave script voor de voorbereiding van de bibliotheek. Voeg aan de onderkant van het weergave script een extra regel toe die exact de eerste regel van het script kopieert (bijvoorbeeld First_Mask. bmp 150 weergeven). Dit zal de Terminal photoprotecting groep op het 5 ' uiteinde van alle oligonucleotiden verwijderen.
  11. Start het programma taak Maker Autojob , laadt een sjabloon door te klikken op sjabloon laden en klik vervolgens op script weergeven om het weergave scriptbestand te laden dat door MATLAB is gegenereerd. Druk op Generate. Deze stap zal een reeks instructies maken, een jobfile genaamd, die de communicatie van de computer met de micro spiegels en de DNA-synthesizer zal regelen.

2. dia voorbereiding en functionalisatie

  1. Boor één dia op twee posities die overeenkomen met de locatie van de inlaat-en Uitlaatslang op de synthesecel. Gebruik een 0,9 mm diamant bit op een CNC router om nauwkeurig en betrouwbaar te boren. Spoel de geboorde dia's af met ultrapuur water en orden ze in een schuif rek.
  2. Reinig de oppervlakken door de glijbanen te soniceren in een waterbad met 5% van een speciaal reinigingsmiddel op basis van ammoniak gedurende 30 minuten bij 35 °C. Spoel de glijbaan af met dubbel gedistilleerd H2O en breng ze over in een schoon, droog rek.
  3. Leg geboorde en niet-geboorde Microscoop-dia's in een schuif rek. Bereid in een grote gegradueerde cilinder de functionalisatie oplossing voor door het mengen van 475 ml ethanol (EtOH) met 25 ml DDH2O, 10 g het reagens (N-(3-triethoxysilylpropyl),--hydroxybutyramide) en 1 ml azijnzuur. Roer goed tot homogeen en breng vervolgens over in een geschikte, gesloten recipiënt.
  4. Plaats het geladen rek in de container, sluit de deksel en laat de container zachtjes op een rondschudapparaat voor 4 uur op kamertemperatuur rocken.
  5. Gooi na 4 uur de functionalisatie oplossing weg en vervang met 500 mL wasoplossing, bestaande uit 475 mL EtOH, 25 mL ddH2O en 1 ml azijnzuur. Wordt langzaam 20 minuten bij kamertemperatuur geagitate en gooi en vervang vervolgens met 500 mL Fresh Wash oplossing.
  6. Na 20 minuten extra op kamertemperatuur, gooi de oplossing weg, droog de glijbanen af met een stroom argon en genees ze in een voorverwarmde vacuüm oven bij 120 °C. Schakel na 2 uur de oven en de vacuümpomp uit, maar laat de glijbanen 's nachts onder verlaagde druk staan. Breng de oven vervolgens terug naar de atmosferische druk en bewaar de glaasjes in een exsiccator tot verder gebruik.

3. bereiding van synthese reagentia en reactanten

  1. Breng de fosfor poeders (Figuur 1) van de opslagtemperatuur (-25 of-45 °c) naar kamertemperatuur in een exsiccator.
  2. Wanneer de fosforamidites kamertemperatuur bereikt, los het poeder op met een volume ultradroog acetonitril (< 30 ppm H2O) om een concentratie van 30 mm te bereiken voor standaard DNA-en RNA-fosforamidites en 50 mm voor het basis gevoelige DT monomeer ( voorbereiding van de bibliotheek). Voeg een kleine moleculaire zeven zak om een spoor van vochtigheid te vangen.
  3. Bereid een oplossing van 1% (w/w) imidazol in DMSO door het oplossen van 11 g imidazol in 1 L droge DMSO. Schud goed totdat het volledig is opgelost. Bevestig de oplossing aan de hulp poort van de DNA-synthesizer. Dit is het oplosmiddel dat nodig is voor het volledig verwijderen van de 5 ′-photoprotecting groep.
  4. Voor de synthese van Bibliotheken, bereid een oplossing van 1% (w/v) β-caroteen in dichloormethaan door het oplossen van 100 mg β-caroteen in 10 mL dichloormethaan. Schud goed in een amberkleurige glazen fles en wikkel vervolgens in aluminiumfolie.

4. voorbereiding en monitoring van Microarray synthese.

  1. Noteer de temperatuur en vochtigheid in de microarray fabricage ruimte en zorg ervoor dat de DNA-synthesizer voldoende helium druk heeft.
  2. Schakel de UV-LED en de koelventilator in. Bevestig een UV-intensiteits meter op het brandvlak van het binnenkomende UV-licht en zet deze aan (Figuur 3a).
  3. Start op de computer de jobfile/Micromirror/synthese bestanden Controller software (genaamd Wicell). Schakel vervolgens het Digital-apparaat in en laad een geheel wit masker bestand door met de rechtermuisknop op DMDte klikken en vervolgens afbeelding laden te selecteren.
  4. Klik met de rechtermuisknop op het pictogram UVS en selecteer UV sluiter Open. Lees de vermogenswaarde (in mW/cm2) op de intensiteits meter en Tel 60 s. Lees na 60 s de vermogenswaarde opnieuw en noteer de begin-en eindwaarden. Sluit de sluiter door UV sluiter sluiten te selecteren en de intensiteits meter uit te schakelen. Bereken de gemiddelde waarde van de UV-intensiteit in mW/cm2.
  5. Bereken de belichtingstijd die nodig is om een stralingsenergie te bereiken van 6 J/cm2 voor 5 '-NPPOC photodeprotection (DNA-en RNA-micro arrays) en 3 J/cm2 voor 5 '-bznppoc photodeprotection (DNA- Equation 1 bibliotheken), simpelweg door de relatie te volgen.
  6. In de DNA-synthesizer workstation software, maak een sequentie bestand in de sequentie-editor door het kopiëren en plakken van de inhoud van de stroom sequentie gegenereerd door MatLab. Voeg een extra twee wasstappen toe aan de 3 ' end (standaardcyclus letter: "s") om het oppervlak van de ondergrond te wassen voordat u doorgaat naar de eerste koppeling. Sla het sequentie bestand op en exporteer het.
  7. Maak in de protocol editor van de Workstation software een protocol dat een speciale cyclus bevat die is vernoemd naar elk van de letters en cijfers in het sequentie bestand (bijv. als een sequentie bestand alleen letters A, C, G en T bevat, dan moet het Protocol bestand vier cycli bevatten, met de naam A, C, G en T).
  8. Stel de koppelings tijd voor DNA-fosforamidites (cycli A, C, G en T) in op 15 s, tot 120 s voor rU fosforamidiet (cyclus 8) en tot 300 s voor rA, rC en rG fosforamidites (cycli 5, 6 en 7). Voor de bereiding van de bibliotheek stelt u de koppeling van het basis gevoelige, splijtbaar DT monomeer in op 2 × 120 s (tabel 1 en tabel 2).
  9. Zorg ervoor dat de wachttijd tussen twee gebeurtenis 2 out -communicatie gebeurtenissen in elke cyclus overeenkomt met de berekende UV-belichtingstijd om de benodigde stralingsenergie te bereiken. Wat betreft het sequentie bestand, opslaan en exporteren van het Protocol bestand.
  10. In de WiCell-software laadt u de taak, volgorde en protocol bestanden in hun respectievelijke sub-Windows en klik vervolgens op verzenden om de sequentie-en protocol bestanden naar de DNA-synthesizer te sturen.
  11. Tel in het sequentie bestand het aantal koppelingen voor elke fosforamidiet.
  12. Om het vereiste volume (in μL) van de fosforamidtische oplossing te meten die nodig is om elke synthese uit te voeren, vermenigvuldigt u het aantal koppelingen met 60. Voeg 250 μL toe aan elk volume voor veiligheid en priming van de lijn op de DNA-synthesizer. Gebruik een basisvolume van 250 μL voor fosforamidites waarvoor slechts één koppeling nodig is.
  13. Breng de oplossing snel over in de flacons op de DNA-synthesizer die overeenkomt met de poort letter/-nummer in de protocol cycli.
  14. Priem de havens met de fosforamidtische oplossingen met elk 10 priem pulsen om de lijnen met reagens te vullen. De acetonitril waslijn voor het bevestigen van de reactiecel.
  15. Om de synthese cel te monteren, plaats een dikke (250 μm) perfluoroelastomeer (FFKM) pakking eerst op het kwarts blok van de cel. Plaats een geboorde, Gefunctionaliseerde Microscoop-dia bovenop de eerste pakking en controleer of de gaten op de dia's aansluiten op de inlaat-en Uitlaatslang van de synthesecel.
  16. Plaats een tweede, dunne (50 μm) polytetrafluorethyleen (PTFE) pakking over de geboorde glijbaan, rondom de twee gaten. Plaats ten slotte een tweede, Gefunctionaliseerde maar niet-geboorde glijbaan bovenop de tweede pakking (Figuur 3B). Plaats een 4-schroef metalen frame bovenop de gemonteerde dubbelsubstraat cel en draai de schroef aan dezelfde klemkracht (0,45 nm) met behulp van een koppel schroevendraaier.
  17. Bevestig de inlaat-en Uitlaatslang aan de DNA-synthesizer. Prime de acetonitril Wash lijn en controleer de juiste stroom van acetonitril (ACN) via de substraten. Demonteer en Hermonteer de cel als er in dit stadium lekkage van ACN kan worden waargenomen. Meet het volume van ACN op de afval lijn na 7 cycli van de priming van ACN te hebben doorlopen. Dit volume moet 2 mL zijn.
  18. Bevestig de synthesecel op het brandvlak van het binnenkomende UV-licht. In het geval van de voorbereiding van de wisselaar, bevestig een extra inlaat-en uitlaat lijn aan de achterzijde van de cel en vul de achterkamer met de β-caroteen oplossing (2 mL oplossing is voldoende). Zorg ervoor dat er geen lekkage is (Figuur 3C).
  19. Start de synthese door eerst te klikken op Run in de wicell software. Bij de eerste wacht opdracht in het taakbestand, druk op Start op de DNA-synthesizer.
  20. Controleer tijdens de synthese regelmatig of de weergave van masker bestanden samenvalt met UV-belichting en het openen van de sluiter.
  21. Na synthese van reguliere micro arrays koppelt u de cel los van de synthesizer, Demon teert u de cel en gebruikt u een diamantpen om het synthese nummer op de glasplaten te etsen. Etch het nummer op het niet-gesynthetiseerde gezicht van elke dia. Breng de glaasjes in 50 mL centrifugebuizen en bewaar ze in een droog gebied tot verder gebruik.
  22. Na de synthese van micro arrays in de bibliotheek, moet eerst de β-caroteen oplossing uit de kamer worden afgevoerd en vervolgens door 2 × 5 mL CH2cl2spoelen en vervolgens aftappen. Ga verder met demonteren zoals per stap 4,21. De gesynthetiseerde array kan zichtbaar zijn voor het blote oog (Figuur 4).

5. DNA Microarray deprotection

  1. Vul een kleurings glazen pot met 20 mL EtOH en 20 mL ethyleendiamine (EDA). Plaats de DNA-only micro arrays verticaal in de pot, sluit de deksel en laat de glaasjes op kamertemperatuur 2 uur debeschermen.
    Let op: EDA is een acuut toxische, corrosieve en ontvlambare vloeistof. Werk met handschoenen in een goed geventileerde rook afzuigkap.
  2. Na 2 uur haalt u de dia's op met een pincet en spoelt u ze grondig af met dubbel gedistilleerd H2O.
  3. Droog de glaasjes in een microarray centrifuge voor een paar seconden en bewaar vervolgens in een exsiccator.

6. RNA Microarray deprotection

  1. Bereid in een centrifugebuis van 50 mL een droge oplossing van 2:3 Triethylamine/ACN (20 mL en 30 mL van elk, respectievelijk). Breng één RNA Microarray Slide in de centrifugebuis, sluit de deksel en wikkel met plastic afdichtings folie. Schud de centrifugebuis zachtjes op een rondschudapparaat gedurende 1h en 30 min bij kamertemperatuur.
  2. Na 1h en 30 min, verwijder de glijbaan, wassen met 2 × 20 mL droog ACN vervolgens drogen in een microarray centrifuge voor een paar seconden.
    Let op: Triethylamine is een acuut toxische, corrosieve en ontvlambare vloeistof. Acetonitril is giftig en ontvlambaar. Werk met handschoenen in een goed geventileerde rook afzuigkap.
    Opmerking: eerste deprotection stap voltooid.
  3. Maak een 0,5 M hydrazine hydraat oplossing in 3:2 pyridine/azijnzuur. Meng eerst 20 mL azijnzuur en 30 mL pyridine in een gegradueerde cilinder. Wacht tot de oplossing is afgekoeld voordat u 1,21 mL hydrazine hydraat toevoegt. Breng ongeveer 40 mL van de resulterende oplossing over in een centrifugebuis van 50 mL.
    VOORZICHTIG: hydrazine hydraat is een acuut toxische en corrosieve vloeistof. Pyridine is zeer licht ontvlambaar en acuut giftig. Azijnzuur is ontvlambaar en corrosief. Werk met handschoenen in een goed geventileerde rook afzuigkap.
  4. Na de eerste deprotection stap, breng de RNA Slide in de hydrazine hydraat oplossing, sluit de deksel en wikkel met plastic afdichtings folie. Schud de buis voorzichtig op een rondschudapparaat voor 2 uur bij kamertemperatuur. Na 2 uur, verwijder de glijbaan, wassen met 2 × 20 mL droog ACN vervolgens drogen in een microarray centrifuge voor een paar seconden.
    Opmerking: tweede deprotection stap voltooid.
  5. Als de RNA-Microarray ook DNA-nucleotiden bevat, ga dan verder met een derde deprotection-stap. Meng in een centrifugebuis van 50 mL 20 mL EDA met 20 mL EtOH. Voeg de DNA/RNA-Microarray toe aan de 1:1 EDA/EtOH-oplossing en laat 5 minuten op kamertemperatuur.
  6. Na 5 min, verwijder de glijbaan, was met 2 × 20 mL steriel water en droog vervolgens in een microarray centrifuge en bewaar in een exsiccator.

7. hybridisatie met een fluorescendig gelabeld aanvullend onderdeel

  1. Ontdooien geacetseerd Runderalbumine (10 mg/mL) en Cy3-gelabeld aanvullend onderdeel (100 nM) en opwarmen tot kamertemperatuur.
  2. Meng in een steriele micro centrifugebuis van 1,5 mL 150 μL van 2x MES buffer (200 mM 2-(N-morpholino) ethanesulfoninezuur; 1,8 M NaCl; 40 mm edta; 0,02% tween-20) met 26,7 μl Cy3-gelabeld DNA, 13,4 μl geacetateerde BSA en 110 μl steriele H2O. mix en Vortex. Dubbel het volume als beide dia's moeten worden gebruikt voor hybridisatie.
  3. Verwarm een hybridisatie oven voor op een temperatuur onder de Tm van de duplex, maar hoog genoeg om een goede discriminatie tussen Full-match en non-match sequenties te garanderen. Voor de kwaliteitscontrole 25mer, stel de temperatuur in op 42 °C (Tm van 59 °c).
  4. Plaats voorzichtig een zelfklevende 300 μL hybridisatie kamer over het synthese gebied op elke dia en pipet in de hierboven bereide hybridisatieoplossing. Bedek de gaten van de kamer met zelfklevende stippen en wikkel de hele glijbaan in aluminiumfolie.
  5. Plaats de microarray-Slide in de hybridisatie oven, dek af en laat deze zachtjes roteren bij de geselecteerde hybridisatie temperatuur gedurende 2 uur.
  6. Maak na 2 uur de glijbaan los, verwijder de aluminiumfolie en scheur de hybridisatie kamer voorzichtig af. Breng de dia's over in een centrifugebuis met 30 mL niet-stringente reinigings buffer (NSWB; 0,9 M NaCl, 0,06 M fosfaat, 6 mM EDTA, 0,01% Tween20, pH 7,4) en schud krachtig gedurende 2 minuten bij kamertemperatuur.
  7. Breng de dia over in een centrifugebuis met 30 mL strenge reinigings buffer (SWB; 100 mM MES, 0,1 M NaCl, 0,01% Tween20) en schud krachtig gedurende 1 minuut.
  8. Breng ten slotte de dia over in een centrifugebuis met 30 mL eind spoel buffer (FWB; 0,1 x natriumzoutcitraat) en schud een paar seconden. Droog de glijbaan in een microarray centrifuge.
  9. Plaats de droge Microarray, het synthese gebied naar beneden gericht, in de dia-houder van de microarray-scanner. Voor Cy3-gelabelde duplexen, scannen met een resolutie van 5 μm met een 532 nm excitatie golflengte, een 575 nm filter en een fotomultiplicator van 350. Sla de scan met hoge resolutie op als een. TIF-afbeeldingsbestand (afbeelding 5a).

8. extractie en analyse van gegevens

  1. Draai voorafgaand aan de extractie van gegevens de opgeslagen array-scan in een afbeeldingsbewerker om de langste reeks fiducial-functies in de linkerbovenhoek van de scan te situeren. Sla de geroteerde afbeelding op.
  2. Start Nimblescanen druk op bestand | Open en laad de array scan. Door te klikken op Bladeren in de Subsectie ontwerp bestand, laadt u de. NDF -ontwerp bestand dat automatisch is gegenereerd tijdens het ontwerp van het microarray-experiment. Klik vervolgens op openen.
  3. Klik in weergaveop auto contrast/helderheid. Klik op het pictogram handmatig Uitlijnen boven de scan. Plaats vier vierkante markeringen in de vier hoeken van de scan en klik vervolgens nogmaals op het pictogram nu groen. Extraheer de hybridisatie gegevens door te klikken op analyse, rapporten dan sonde rapport.
  4. Open de. test rapportbestand in een spreadsheet editor. Houd de kolommen B en I en gooi de rest weg voordat u doorgaat met het berekenen van gemiddelde waarden en standaarddeviatie van de geëxtraheerde gegevens (Figuur 5B).

9. debescherming van de bibliotheek, splijting en terugwinning

  1. Om DNA-bibliotheken te debeschermen en te klieven, bereidt u een oplossing van 1:1 droge EDA/tolueen voor in een centrifugebuis van 50 ml. Dompel de Slide in de decolleté oplossing, sluit de glijbaan en wikkel met plastic afdichtings folie, draai vervolgens zachtjes in een rondschudder voor 2 uur bij kamertemperatuur.
  2. Verwijder na 2 uur de glijbaan en was met 2 × 20 mL nauwgezet droog ACN. Verwijder de glijbaan en laat de lucht drogen.
  3. Breng met een pipet 100 μL steriele H2O aan op het nu zichtbaar synthese gebied. Pipet de oplossing een paar keer omhoog en omlaag voordat u deze in een micro centrifugebuis van 1,5 mL brengt. Herhaal het proces en combineer het microarray-eluaat in dezelfde buis (Figuur 6).
  4. Damp de 2 × 100 μL spaan eluaat in tot droogheid en Los vervolgens op in 10 μL Nuclease vrije H2O. meet de absorptie op een UV/VIS-spectrofotometer.
  5. Ontzout de DNA-bibliotheek op een pipetpunt van 10 μL, uitgerust met C18 Resin. Transformeer eerst het spaan eluaat in een 0,1 M triethylammoniumacetaat (TEAA) gebufferde oplossing.
  6. Bevochtig de hars met 3 x 10 μL H2O/ACN 1:1 en evenwichts de hars door te wassen met 3 x 10 μl 0,1 M teaa-buffer. Bind het DNA door pipetteren van de spaan eluaat 10 keer omhoog en omlaag door de hars. Was de hars met 3 x 10 μL van 0,1 M TEAA-buffer, 3 x 10 μL van H2O.
  7. Elzen het ontde DNA van de tip door het wassen van de hars met 10 μL H2O/ACN 1:1. Droog de ontde oplossing af en los op in 10 μL steriele H2O. meet de extinctie op een UV/VIS-spectrofotometer (Figuur 7). Damp de bibliotheek in tot droogheid en bewaar deze bij-20 °C tot verder gebruik.

Representative Results

DNA en RNA Microarray hybridisatie
Figuur 5 toont de resultaten van een hybridisatie test die wordt uitgevoerd op een microarray met de DNA-en RNA-versies van een 25mer-sequentie (5 '-GTCATCATCATGAACCACCCTGGTC-3 ' in DNA-vorm). De scan in Figuur 5a verschijnt in een greenscale-indeling die overeenkomt met het excitatie/emissiespectrum van Cy3 fluorescentie, waarbij de intensiteit van de fluorescentie wordt geregistreerd in willekeurige eenheden tussen 0 en 65536. Het ontwerp van de matrix volgde de 25:36 functie-indeling die wordt beschreven in de sectie Protocol. De scan wordt getoond na de juiste oriëntatie van de array, met de linker bovenhoek gevuld met de langste keten van fiducial features. Hier bevatten fiducial-functies de DNA-versie van de 25mer en moeten ze in principe altijd een positief fluorescentie signaal geven om scan uitlijning en gegevensextractie uit te voeren. De hybridiseerde Microarray moet gelijkmatig helder lijken, waarbij de randen van het synthese gebied echter meestal helderder zijn dan het midden (tot 50% helderder). De grote hoeveelheid reeks replicaten, willekeurig verdeeld in het gebied, vermindert de impact van ruimtelijke artefacten. Hier werd elke sequentie (DNA en RNA) gesynthetiseerd op 2.000 willekeurige locaties. Er is meestal een laag fluorescentie geluid (achtergrond), < 50 a.u., wat leidt tot een signaal/ruis verhouding in de orde van 200:1 tot 800:1 in hybridisatie testen. Na gegevensextractie worden fluorescentie intensiteiten gemiddeld uit en getekend ± SD.

Er is een significante variabiliteit in absolute fluorescentie waarden tussen experimenten. Hier tonen we de resultaten voor drie onafhankelijke syntheses met behulp van dezelfde fabricage parameters en dezelfde post-synthetische handling. Het 25mer-DNA, wanneer het wordt gehybridideerd tot zijn complementaire Cy3-gelabelde DNA-streng, zal fluorescentie signalen opleveren, variërend overal van 20.000 tot 30.000, zeer zelden boven of onder. Het 25-Mer-RNA, wanneer het wordt gehybridiseerd op hetzelfde Cy3-gelabelde DNA-complement, geeft fluorescentie intensiteiten op de corresponderende eigenschappen variërend van 15.000 tot 20.000. De intensiteit van de fluorescentie van de RNA/DNA-duplexen daalt echter af en toe onder 8.000, wanneer de corresponderende DNA/DNA-duplexen nog steeds fluorescerend zijn binnen het 20000-30000 bereik. In dergelijke gevallen kunnen de resultaten voor RNA als suboptimaal worden beschouwd. Een synthese of hybridisatie falen, hetzij voor DNA of RNA, zal onmiddellijk merkbaar tijdens het scannen van het duidelijke gebrek aan fluorescentie. Er zijn meerdere mogelijkheden voor de synthese van RNA om ofwel falen of gedeeltelijk slagen en ze zullen worden geschetst in het discussie gedeelte.

Bibliotheek deprotection, splijting en herstel
Afhankelijk van de complexiteit en de dichtheid van de bibliotheek, kan de vorm en omtrek van de gesynthetiseerde array worden gezien zonder vergroting, maar onder goede belichting (Figuur 4), waarbij het DNA nog steeds in beschermde vorm is. Na deprotection met EDA/tolueen, en voor de toevoeging van water om de gespleten bibliotheek te verzamelen, kan het synthese gebied met de nu gedebeschermde oligonucleotiden opvallen als een hydrofiele zone, wanneer de rest van de glazen glijbaan zal verschijnen bedekt met een troebele hydrofobe laag. De directe observatie van het synthese gebied hangt af van de totale oppervlakte die wordt gebruikt voor het synthetiseren van oligonucleotiden: een groter gebruik van het synthese gebied komt overeen met een grotere kans op een duidelijk onderscheid tussen hydrofiele en hydrofobe gebieden op het oppervlak. Omgekeerd, Bibliotheken gesynthetiseerd met behulp van minder spiegels en met kleinere functies zijn mogelijk niet onmiddellijk waarneembaar.

Evenzo is de hoeveelheid teruggewonnen DNA na ontdesalting direct evenredig met de totale oppervlakte die voor synthese wordt gebruikt. Als alle functies worden gebruikt voor de synthese van oligonucleotide, moet de decolleté en terugwinnings procedure tussen 25 en 30 pmol van het DNA opleveren. Een 10% gebruik van het synthese gebied zal dus slechts ongeveer 3 pmol van DNA veroorloven.

Figure 1
Figuur 1 . Chemische structuren van het DNA en RNA-fosforamidites gebruikt in Oligonucleotide Synthese door Microarray foto lithografie. Standaard nitrofenylpropyloxycarbonyl (NPPOC) lichtgevoelige bescherming groepen op de 5 '-OH worden gebruikt in reguliere DNA en RNA Microarray synthese voor hybridisatie doeleinden. Voor de synthese van complexe DNA-Bibliotheken, de meer fotolabile BENZYL-NPPOC (BzNPPOC) hebben de voorkeur bij de 5 '-OH, als BzNPPOC wordt verwijderd twee keer zo snel als NPPOC, die aanzienlijk vermindert totale Microarray synthese tijd. DNA oligonucleotiden voor bibliotheken vereisen ook de koppeling van een splijtbaar DT monomeer aan het uiteinde van de 3. Dit monomeer, dat een succinyl-Ester functie draagt, zal worden gecleaved tijdens deprotection, waardoor het DNA kan worden verzameld van de microchip. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2 . Voorbeeld van een masker als een afbeeldingsbestand dat wordt verzonden naar het Digital-apparaat tijdens blootstelling aan UV-straling. De witte pixels corresponderen met spiegels die in de "on" positie zullen worden gekanteld, wat UV-licht reflecteerd op de synthese cel. Zwarte pixels komen overeen met "uit"-spiegels, waar het UV-licht wordt weerkaatst van de cel. Witte pixels zullen daarom de koppeling mogelijk maken van het volgende inkomende fosforamidiet op de oligonucleotiden op de overeenkomstige eigenschappen op de glas substraten. Oligonucleotiden gesynthetiseerd op de functies waarvan de overeenkomstige spiegels zijn, in dit masker bestand, zullen zwarte pixels echter inert blijven tijdens de volgende koppelingsgebeurtenis. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3 . Foto's van de microarray foto lithografie optische en synthese Setup. A) optisch circuit voor blootstelling aan UV-straling. UV-licht van de UV-LED wordt eerst gehomogeniseerd door middel van een rechthoekige-dwarsdoorsnede lichtpijp en reflecteert vervolgens op de micro spiegels. Micro spiegels die in een "OFF"-positie zijn gekanteld, weerspiegelen UV-licht van de synthese cel, maar micro spiegels in de "ON"-positie reflecteren het licht op de synthese-cel, gelegen op het brandvlak, door eerst een 1:1 Offner-relay te passeren Imaging System. B) de synthese cel, eenmaal geassembleerd, bestaat uit een geboorde dia die eerst op het kwarts blok van de cel wordt geplaatst, gescheiden door een dikke PTFE-pakking (niet weergegeven). Een tweede, niet-geboorde glijbaan wordt dan geplaatst over de geboorde glijbaan, gescheiden door een dunne PTFE pakking. Een metalen frame (niet afgebeeld) houdt de assemblage bij elkaar. C). voor de bereiding van de bibliotheek, zodra de synthese cel is bevestigd op het brandvlak van het binnenkomende UV-licht, wordt de kamer die zich tussen het kwarts blok en de geboorde glijbaan bevindt, gevuld met een 1%-oplossing van β-caroteen in2cl2. Hiervoor wordt een extra inlaat-en Uitlaatslang aan het kwarts blok bevestigd en stroomt de oranje oplossing van de meest rechtse naar de meest linkse positie. De stroom van reagentia en oplosmiddelen voor de synthese wordt getoond in witte pijlen. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 4
Figuur 4 . Het synthese gebied is meestal zichtbaar voor het blote oog. Hier, een DNA-bibliotheek kan worden gezien op het glasoppervlak direct na synthese, met het DNA nog steeds in beschermde vorm. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 5
Figuur 5 . Hybridisatie assays aan de 25mer DNA en RNA sequenties gesynthetiseerd in situ op micro arrays. A) fluorescentie scan van het volledige HYBRIDISEERDE DNA en RNA-Microarray. 25mer DNA en RNA oligonucleotiden worden gehybridideerd tot hun Cy3-gelabelde complementaire strengen. De array werd gescand met een laser op een 532 nm excitatie golflengte, bij een resolutie van 5 μm. B) fluorescentie intensiteiten (willekeurige eenheden) van het DNA: DNA en RNA: DNA-duplexen in drie afzonderlijke experimenten. De licht groene gegevens voor in situ gesynthetiseerde RNA-oligonucleotiden kunnen als suboptimaal worden beschouwd, vergeleken met de intensiteit van de fluorescentie van de corresponderende DNA-sequenties. Foutbalken zijn SD. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 6
Figuur 6 . Schematische weergave van de deprotectie-, splijting-en herstelprocedure voor DNA-bibliotheken die zijn gesynthetiseerd op micro arrays. DNA-sequenties worden geteeld op een base-gevoelige splijtbaar DT nucleoside (weergegeven in het ingezoomde gebied). Na synthese, de debescherming van de DNA oligonucleotiden (basisbescherming groepen worden weergegeven als rode bollen) in EDA/tolueen verlaat het gedebeschermde materiaal elektrostatisch gebonden aan het oppervlak en kan vervolgens worden gepipeterd door het toepassen van een kleine hoeveelheid water op het gesynthetiseerde gebied. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 7
Figuur 7 . Representatief extinctie spectrum (220-350 nm) van een gespleten, ontuwde DNA-bibliotheek met 4.000 verschillende sequenties, 100-NT in lengte. Een totaal van 940 ng DNA werd geïsoleerd uit één array synthese, overeenkomend met 30 PMOL DNA totaal, of 15 pmol per glas substraat. Klik hier om een grotere versie van dit cijfer te bekijken.

Table 1
Tabel 1. Representatieve cyclus protocol voor koppeling/oxidatie/photodeprotection van 5 '-BzNPPOC-da, ervan uitgaande dat de overeenkomstige fosforamiet werd geladen op de poort "A". Koppelings tijd (in seconden) wordt weergegeven op de lijn "koppel monomeer". De UV photodeprotection tijd, hier overeenkomend met een stralingsenergie van 3 J/cm2 (bznppoc photochemistry), wordt berekend als de tijd die is verstreken tussen de twee "gebeurtenis 2 out" communicatie signalen.

Table 2
Tabel 2. Representatieve cyclus protocol voor koppeling/oxidatie/photodeprotection van 5 '-NPPOC-RA, ervan uitgaande dat het overeenkomstige RNA-fosforamidiet op de poort "A" werd geladen. Koppelings tijd (in seconden) wordt weergegeven op de lijn "koppel monomeer". De UV photodeprotection tijd, hier overeenkomend met een stralingsenergie van 6 J/cm2 (nppoc photochemistry), wordt berekend als de tijd die is verstreken tussen de twee "gebeurtenis 2 out" communicatie signalen.

Discussion

Solid-phase DNA en RNA synthese is het brood en de boter van elk nucleïnezuur chemie lab, en hoewel de toevoeging van de photolithografie component is weliswaar een complexe operatie, microarray fabricage gemedieerd door UV-licht is ook een zeer betrouwbaar proces . Het is bovendien de enige beschikbare methode voor in situ RNA-synthese op micro arrays. Nog steeds, zoals in een multi-stage experimentele procedure, er is voldoende ruimte voor menselijke fouten.

Misschien is de meest kritische stap de koppeling van een fosforamidiet, omdat het een constant hoogproductieve chemische reactie moet zijn om oligonucleotiden te kunnen veroorloven met weinig synthetische fouten. In ons Microarray synthese protocol is de fosforamidtische koppeling nog belangrijker voor de algehele synthese kwaliteit, omdat het fabricageproces de capping omzeilt en de zuivering van oligonucleotide voorkomt. Stapsgewijze koppel efficiëntie boven 99% is berekend voor alle lichtgevoelige DNA-en RNA-fosforamidites, zelfs voor zeer korte koppelings tijden (15 s)24 , maar er kunnen soms lagere koppelings opbrengsten optreden, met name in het geval van DG amidites. De stabiliteit van de opgeloste fosforamidites bij kamertemperatuur is eerder onderzocht en werd aangetoond afhankelijk van de aard van de nucleobase, met calciumguanosine fosforamidites vatbaar voor uitgebreide afbraak in slechts een kwestie van dagen29, 30. Maar bij opslag bij-25 °C bleken dG fosforamidites opgelost in ACN als 30 mM oplossing gedurende enkele weken stabiel te zijn. De relatieve instabiliteit van dG fosforamidtische oplossingen bij kamertemperatuur betekent echter dat ze niet gedurende enkele dagen aan de DNA-synthesizer moeten worden gehecht.

Voor RNA-fosforamidites is de koppelings opbrengst zeer afhankelijk van de fosforamidtische kwaliteit (die kan worden beoordeeld met 31P NMR-spectroscopie) en koppelings tijd. Koppelings tijden van 5 minuten voor rA, rG, rC en 2 min voor rU lijken noodzakelijk. Inderdaad, we vonden dat verkorting van de condensatie tijd tot 2 min voor alle RNA-fosforamidites leidde tot significant lagere hybridisatie signalen.

De DNA-synthesizer zelf, evenals de reagentia en oplosmiddelen, moet zeker zo schoon mogelijk zijn om de hoogste opbrengst van oligonucleotide synthese te bereiken. Echter, onoplosbaar materiaal, zouten of deeltjes, kan zich in de loop van de tijd ophopen in de lijnen en slangen van het toedieningssysteem, wat leidt tot een geleidelijke afname van het verbruik van reagentia en reactanten. Wanneer een algemene reiniging van de synthesizer niet een lage output volume oplost, een toename van het aantal pulsen kan een alternatieve oplossing. Met name nuttig in het geval van een lage fosforamidtische consumptie, kan de lijn in het koppelings protocol overeenkomend met het pompen van een mengsel van fosforamidtische en verharder (derde regel van de Subsectie koppeling in tabel 1 en tabel 2) gewijzigd, van 6 naar 9 pulsen zonder merkbaar negatief effect op de kwaliteit van de synthese. Bovendien is het aantal pulsen van Activator dat nodig is om de amiite/Activator-mix te brengen naar het synthese substraat (momenteel 6, vierde lijn in de koppelings Subsectie, Zie tabel 1 en tabel 2) afhankelijk van de DNA-synthesizer zelf, evenals op buislengte in de synthese cel. Dit aantal kan worden aangepast na het vervangen van de fosforamiet met een gekleurde oplossing en het tellen van het aantal pulsen dat nodig is om de gekleurde mix naar het glas substraat te duwen voor koppeling.

De hier beschreven methode maakt het mogelijk om DNA en RNA synthese gelijktijdig te doorgaan, op dezelfde Microarray. Hybriden van DNA en RNA kunnen ook worden bereid zonder enige verandering in de matrix fabricage protocollen, en zolang het driedelige deprotection protocol wordt gevolgd. Echter, opgemerkt moet worden dat RNA-only micro arrays alleen een twee-stappen deprotection vereisen: een decyanoethylatie eerst met et3N gevolgd door hydroxylgroep en base deprotection met hydrazine. DNA-nucleobasissen bleken onder deze omstandigheden niet volledig te zijn gedebeschermd en hebben de extra stap in EDA nodig om de volledige verwijdering van fenoxyacetyl (PAC) groepen te kunnen uitvoeren. Deze extra behandeling met EDA is korter (5 min) dan voor de standaard deprotection van DNA micro arrays31, maar het is voldoende om het na de Triethylamine en hydrazine behandelingen tot voltooiing te brengen. Bovendien beperkt een korte reactietijd met EDA de blootstelling van een volledig deprotected RNA-oligonucleotide aan de basisomstandigheden.

Een voordeel van in-situ RNA array synthese over alternatieve methoden zoals spotting of DNA transcriptie32,33,34 is de mogelijkheid om de gesynthetiseerde RNA microchip in beschermde vorm op te slaan tot gebruik, waardoor de risico op mogelijke afbraak van RNA. Post-synthetische procedures voor RNA impliceren daarentegen dat verbruiksgoederen en reagentia steriel worden gehouden en dat de behandeling onder RNase-vrije condities wordt uitgevoerd. Van nota, we constateerden dat de toevoeging van RNase remmer aan de hybridisatie mix niet sterkere hybridisatie signalen voor de RNA-kenmerken oplevert.

De synthese van DNA-bibliotheken op een basis-gevoelige monomeer is complexer dan de synthese van een paar besturings sequenties op een oppervlak, en als zodanig is zeker meer vatbaar voorontwerp fouten. Maar als het sequentie ontwerp (d.w.z. de aard en het aantal sequenties) juist is, wordt deze lijst getransformeerd in een verzameling belichtings maskers en een geordende reeks koppelings cycli blijft een eenvoudig proces. Echter, belangrijke variaties van standaard Microarray synthese bestaan en zijn essentieel voor een succesvolle fabricage van een high-density Library array.

Eerst wordt een base-Sensitive dT monomeer gekoppeld als de eerste fosforamidiet na synthese van de linker. De koppelings opbrengst van dit monomeer (Figuur 1) bleek relatief laag te zijn, rond 85%28, daarom worden inspanningen geleverd om de opnamesnelheid te verbeteren, hetzij door de concentratie ervan in ACN te verhogen van 30 mm tot 50 mm, of door herhaling van de koppelings stap: twee opeenvolgende koppelings reacties met behulp van nieuwe monomeren of twee afzonderlijke maar opeenvolgende koppelings cycli.

De tweede verandering is de toevoeging van een β-caroteen oplossing in de achterkamer van de synthese cel, die gemakkelijk absorbeert 365 nm licht. Dit is een belangrijke wijziging van de fotolithografische Setup, omdat het voorkomt dat UV-licht terugkaatst op het array substraat. Inderdaad, na het doorkruisen van het interstitiële medium tussen de ondergronden, verlaat het binnenkomende UV-licht door de geboorde glijbaan en bereikt het kwarts blok van de cel. De Fresnel-vergelijkingen voorspellen dat ~ 4% van loodrecht incident UV-licht zal reflecteren van elk van de drie downstream lucht-glas interfaces (afrit zijde van de 2ND substraat en beide zijden van het kwarts blok) en terug op de synthese substraat, die leidt tot onbedoelde blootstelling aan fooprotected oligonucleotiden. Diffractie en verstrooiing dragen ook bij aan "off-target" photodeprotection en dus aan nucleotide inbrengen, die direct van invloed zijn op het foutenpercentage van de synthese, maar deze bijdragen zijn veel kleiner dan reflecties en kunnen vooral worden aangepakt door vermindering van de synthese dichtheid (het verlaten van de gaten tussen de functies). We hebben geconstateerd dat het niveau van β-caroteen oplossing in de onderste kamer van de cel de neiging heeft om iets te verminderen alleen tijdens de eerste minuten van array synthese, en daarom moet worden bewaakt en opnieuw afgesteld.

Tot slot, de derde verandering is de deprotection-oplossing, ter vervanging van EtOH voor tolueen, die de gespleten DNA-bibliotheek gebonden aan het oppervlak houdt, vermoedelijk door elektrostatische interacties. Het aanbrengen van een kleine hoeveelheid water op het synthese gebied na het wassen van ACN zorgt ervoor dat de bibliotheek gemakkelijk kan worden verzameld. Het proces is echter alleen succesvol als het watergehalte in EDA en tolueen minimaal is, waardoor het nucleïnezuur volledig onoplosbaar is in de deprotection cocktail. Als alternatief kunnen DNA-bibliotheken worden gespleten van de chip met behulp van ammoniak9,10,14,35, dan verder gedebeschermd door het verwarmen van de DNA-bevattende waterige ammoniakoplossing tot 55 °c 's nachts. Het herstel van DNA-bibliotheken met ammoniak is echter niet compatibel met RNA. RNA oligonucleotiden op een base-cleavable substraat kunnen van het oppervlak worden verwijderd met behulp van dezelfde EDA/tolueen-procedure als hierboven beschreven, maar alleen op het voorlaatste stadium na de et3N en hydrazine twee-stels deprotectie strategie28.

Alternatieve strategieën om oligonucleotide-Pools te herstellen van micro arrays zonder dat er een specifieke basisbehandeling nodig is, zijn in principe compatibel met foto lithografie en vertrouwen op het gebruik van enzymen. Een enkelvoudige deoxyuracil-nucleotide kan bijvoorbeeld het doelwit zijn van het uracil-DNA-glycosylase (UDG) en uit de rest van de DNA-sequentie worden uitgeschoven, of een enkele RNA-eenheid kan worden herkend door RNase H type 2-enzymen en de fosfodiëester binding 5 ' aan het RNA-gespleten , het vrijgeven van de 5 ' DNA deel23.

We hebben nu een krachtige, betrouwbare en hoge-dichtheids methode voor de synthese van DNA-, RNA-en hybride DNA/RNA-micro arrays. Deze kunnen niet alleen dienen als platformen voor hybridisatie of bindende assays36, maar ze vertegenwoordigen ook een snelle en goedkope manier om complexe nucleïnezuur bibliotheken te produceren. Voor DNA-gebaseerde digitale gegevensopslag kan Microarray-foto lithografie een mogelijke oplossing worden voor het "schrijven"-knelpunt (d.w.z. de codering van informatie door synthese). Het succes in digitale codering op DNA en in de Novo gen assembly is afhankelijk van sequentie getrouwheid die, op synthese niveau, zich vertaalt in het foutenpercentage. Synthetische en optische fouten in onze huidige array fabricage protocollen zullen elders worden besproken en gerapporteerd. Parallel hieraan worden momenteel inspanningen geleverd om de productieschaal en de doorvoer verder te verhogen.

Disclosures

De auteurs verklaren dat ze geen banden hebben met enige organisatie met een winstoogmerk.

Acknowledgments

Dit werk werd gesteund door het Oostenrijkse wetenschaps Fonds (FWF Grants P23797, P27275 en P30596) en de Swiss National Science Foundation (Grant #PBBEP2_146174).

Materials

Name Company Catalog Number Comments
Slide functionalization
Acetic acid >99.8% Sigma 33209 For RNA deprotection
CNC router Stepcraft 300 CK
Ethanol absolute VWR 1.07017.2511 For deprotection and functionalization
N-(3-triethoxysilylpropyl)-4-hydroxybutyramide Gelest SIT8189.5 Silanizing reagent
Nexterion Glass D microscope slides Schott 1095568
Polymax 1040 Heidolph Orbital shaker
Proclean 507 Ultrasonic water bath Ulsonix To clean slides after drilling
Tickopur RW 77 Special Purpose Cleaner Sigma Z860086 To clean slides after drilling
Microarray synthesis
0.25 M dicyanoimidazole in ACN Biosolve 0004712402BS Activator
0.7 XGA DMD Texas Instruments Digital Micromirror Device
20 mM I2 in pyridine/H2O/THF Sigma L860020-06 Oxidizer
250 μm thick Chemraz 584 perfluoroelastomer FFKM Lower teflon gasket
2'-O-ALE RNA phosphoramidites ChemGenes
365 nm high-power UV-LED Nichia NVSU333A
5'BzNPPOC DNA phosphoramidites Orgentis
5'NPPOC DNA phosphoramidites FlexGen
Acetonitrile Biosolve 0001205402BS For DNA synthesis
Amidite Diluent for DNA synthesis Sigma L010010 For dissolving phosphoramidites
Cleavable dT ChemGenes Base-sensitive monomer for library preparation
DMSO Biosolve 0004474701BS As exposure solvent
DNA and RNA microarray deprotection
Ethylenediamine >99.5% Sigma 3550 For deprotection
Expedite 8909 PerSeptive Biosystems DNA synthesizer
Hydrazine hydrate 50-60% hydrazine Sigma 225819 For RNA deprotection
Imidazole Sigma 56750
Industrial Strength lower-density PTFE tape Gasoila Thin, upper teflon gasket
Pyridine >99% Sigma P57506 For RNA deprotection
Triethylamine >99% Sigma T0886 For RNA deprotection
β-carotene Sigma C9750 For library preparation
Hybridization and scanning
20x Sodium Saline Citrate Roth 1054.1
5'Cy3-labelled complementary strand Eurogentec For duplex hybridization
Biopur Safe-Lock microcentrifuge tube Eppendorf
BSA (10 mg/mL) Promega R3961
EDTA molecular biology grade Promega H5031
GenePix 4100A Molecular Devices Microarray scanner
Hybridization oven Boekel Scientific 230500
MES monohydrate Sigma 69889
MES sodium Sigma M3058
NaCl >99.5% Sigma 71376
SecureSeal SA200 hybridization chamber Grace BioLabs 623503
Spectrafuge mini Labnet C1301 Microarray centrifuge
Tween-20 molecular biology grade Sigma P9416
Data extraction
Excel Microsoft For data extraction
MatLab MathWorks Microarray design
NimbleScan 2.1 Roche NimbleGen
Desalting and quantification
NanoDrop One Spectrophotometer Thermo Scientific
Toluene Merck
ZipTip C18 Millipore ZTC18s008 Desalting pipet tips

DOWNLOAD MATERIALS LIST

References

  1. Bumgarner, R. Current protocols in molecular biology. 101, 22 (2013).
  2. Berger, M. F., Bulyk, M. L. Universal protein-binding microarrays for the comprehensive characterization of the DNA-binding specificities of transcription factors. Nature Protocols. 4, (3), 393-411 (2009).
  3. Tietjen, J. R., Donato, L. J., Bhimisaria, D., Ansari, A. Z. Sequence-specificity and energy landscapes of DNA-binding molecules. Methods in enzymology. 497, 3-30 (2011).
  4. Katilius, E., Flores, C., Woodbury, N. W. Exploring the sequence space of a DNA aptamer using microarrays. Nucleic Acids Research. 35, (22), 7626-7635 (2007).
  5. Franssen-van Hal, N. L. W., et al. Optimized Light-Directed Synthesis of Aptamer Microarrays. Analytical Chemistry. 85, (12), 5950-5957 (2013).
  6. Matteucci, M. D., Caruthers, M. H. Nucleotide Chemistry .4. Synthesis of Deoxyoligonucleotides on a Polymer Support. Journal of the American Chemical Society. 103, (11), 3185-3191 (1981).
  7. Eroshenko, N., Kosuri, S., Marblestone, A. H., Conway, N., Church, G. M. Gene Assembly from Chip-Synthesized Oligonucleotides. Current Protocols in Chemical Biology. 2012, (2012).
  8. Kosuri, S., et al. Scalable gene synthesis by selective amplification of DNA pools from high-fidelity microchips. Nature Biotechnology. 28, (12), 1295 (2010).
  9. Richmond, K. E., et al. Amplification and assembly of chip-eluted DNA (AACED): a method for high-throughput gene synthesis. Nucleic Acids Research. 32, (17), 5011-5018 (2004).
  10. Schmidt, T. L., et al. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries. Nature Communications. 6, (2015).
  11. Grass, R. N., Heckel, R., Puddu, M., Paunescu, D., Stark, W. J. Robust Chemical Preservation of Digital Information on DNA in Silica with Error-Correcting Codes. Angewandte Chemie International Edition. 54, (8), 2552-2555 (2015).
  12. Erlich, Y., Zielinski, D. DNA Fountain enables a robust and efficient storage architecture. Science. 355, (6328), 950-953 (2017).
  13. Garalde, D. R., et al. Highly parallel direct RNA sequencing on an array of nanopores. Nature Methods. 15, (3), 201-206 (2018).
  14. Cleary, M. A., et al. Production of complex nucleic acid libraries using highly parallel in situ oligonucleotide synthesis. Nature Methods. 1, (3), 241-248 (2004).
  15. LeProust, E. M., et al. Synthesis of high-quality libraries of long (150mer) oligonucleotides by a novel depurination controlled process. Nucleic Acids Research. 38, (8), 2522-2540 (2010).
  16. Lietard, J., Damha, M. J., Somoza, M. M. Enzymatic and Chemical Synthesis of Nucleic Acid Derivatives. Fernández-Lucas, J. Wiley Online Books. (2018).
  17. Fodor, S. P. A., et al. Spatially Addressable Parallel Chemical Synthesis. Science. 251, (4995), 767-773 (1991).
  18. Singh-Gasson, S., et al. Maskless fabrication of light-directed oligonucleotide microarrays using a digital micromirror array. Nature Biotechnology. 17, (10), 974-978 (1999).
  19. Pease, A. C., et al. Light-Generated Oligonucleotide Arrays for Rapid DNA-Sequence Analysis. Proceedings of the National Academy of Sciences of the United States of America. 91, (11), 5022-5026 (1994).
  20. Holz, K., Lietard, J., Somoza, M. M. High-Power 365 nm UV LED Mercury Arc Lamp Replacement for Photochemistry and Chemical Photolithography. ACS Sustainable Chemistry & Engineering. 5, (1), 828-834 (2017).
  21. Lackey, J. G., Mitra, D., Somoza, M. M., Cerrina, F., Damha, M. J. Acetal Levulinyl Ester (ALE) Groups for 2′-Hydroxyl Protection of Ribonucleosides in the Synthesis of Oligoribonucleotides on Glass and Microarrays. Journal of the American Chemical Society. 131, (24), 8496-8502 (2009).
  22. Lackey, J. G., Somoza, M. M., Mitra, D., Cerrina, F., Damha, M. J. In-situ chemical synthesis of rU-DNA chimeras on chips and enzymatic recognition. Chimica Oggi-Chemistry Today. 27, (6), 30-33 (2009).
  23. Lietard, J., Ameur, D., Damha, M., Somoza, M. M. High-density RNA microarrays synthesized in situ by photolithography. Angewandte Chemie International Edition. 57, (46), 15257-15261 (2018).
  24. Agbavwe, C., et al. Efficiency, Error and Yield in Light-Directed Maskless Synthesis of DNA Microarrays. Journal of Nanobiotechnology. 9, (2011).
  25. Sack, M., et al. Express photolithographic DNA microarray synthesis with optimized chemistry and high-efficiency photolabile groups. Journal of Nanobiotechnology. 14, (2016).
  26. Kretschy, N., Holik, A. K., Somoza, V., Stengele, K. P., Somoza, M. M. Next-Generation o-Nitrobenzyl Photolabile Groups for Light-Directed Chemistry and Microarray Synthesis. Angewandte Chemie International Edition. 54, (29), 8555-8559 (2015).
  27. Sack, M., Kretschy, N., Rohm, B., Somoza, V., Somoza, M. M. Simultaneous Light-Directed Synthesis of Mirror-Image Microarrays in a Photochemical Reaction Cell with Flare Suppression. Analytical Chemistry. 85, (18), 8513-8517 (2013).
  28. Lietard, J., et al. Base-cleavable microarrays for the characterization of DNA and RNA oligonucleotides synthesized in situ by photolithography. Chemical Communications. 50, (85), 12903-12906 (2014).
  29. Krotz, A. H., et al. Solution stability and degradation pathway of deoxyribonucleoside phosphoramidites in acetonitrile. Nucleosides Nucleotides & Nucleic Acids. 23, (5), 767-775 (2004).
  30. Hargreaves, J. S., Kaiser, R., Wolber, P. K. The Degradation of Dg Phosphoramidites in Solution. Nucleosides Nucleotides & Nucleic Acids. 34, (10), 691-707 (2015).
  31. McGall, G. H., et al. The efficiency of light-directed synthesis of DNA arrays on glass substrates. Journal of the American Chemical Society. 119, (22), 5081-5090 (1997).
  32. Collett, J. R., et al. Functional RNA microarrays for high-throughput screening of antiprotein aptamers. Analytical Biochemistry. 338, (1), 113-123 (2005).
  33. Buenrostro, J. D., et al. Quantitative analysis of RNA-protein interactions on a massively parallel array reveals biophysical and evolutionary landscapes. Nature Biotechnology. 32, (6), 562-568 (2014).
  34. Wu, C. -H., Holden, M. T., Smith, L. M. Enzymatic Fabrication of High-Density RNA Arrays. Angewandte Chemie International Edition. 53, (49), 13514-13517 (2014).
  35. Tian, J., et al. Accurate multiplex gene synthesis from programmable DNA microchips. Nature. 432, (7020), 1050-1054 (2004).
  36. Lietard, J., et al. Mapping the affinity landscape of Thrombin-binding aptamers on 2'F-ANA/DNA chimeric G-Quadruplex microarrays. Nucleic Acids Research. 45, (4), 1619-1632 (2017).
High-density DNA en RNA micro arrays-Photolithografische synthese, hybridisatie en voorbereiding van grote nucleïnezuur bibliotheken
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Lietard, J., Schaudy, E., Hölz, K., Ameur, D., Somoza, M. M. High-Density DNA and RNA microarrays - Photolithographic Synthesis, Hybridization and Preparation of Large Nucleic Acid Libraries. J. Vis. Exp. (150), e59936, doi:10.3791/59936 (2019).More

Lietard, J., Schaudy, E., Hölz, K., Ameur, D., Somoza, M. M. High-Density DNA and RNA microarrays - Photolithographic Synthesis, Hybridization and Preparation of Large Nucleic Acid Libraries. J. Vis. Exp. (150), e59936, doi:10.3791/59936 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter