Method Article

Characterization of Membrane Transporters by Heterologous Expression in E. coli and Production of Membrane Vesicles

DOI:

10.3791/60009

December 31st, 2019

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

We describe a method for the characterization of proton-driven membrane transporters in membrane vesicle preparations produced by heterologous expression in E. coli and lysis of cells using a French press.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Several methods have been developed to functionally characterize novel membrane transporters. Polyamines are ubiquitous in all organisms, but polyamine exchangers in plants have not been identified. Here, we outline a method to characterize polyamine antiporters using membrane vesicles generated from the lysis of Escherichia coli cells heterologously expressing a plant antiporter. First, we heterologously expressed AtBAT1 in an E. coli strain deficient in polyamine and arginine exchange transporters. Vesicles were produced using a French press, purified by ultracentrifugation and utilized in a membrane filtration assay of labeled substrates to demonstrate the substrate specificity of the transporter. These assays demonstrated that AtBAT1 is a proton-mediated transporter of arginine, γ-aminobutyric acid (GABA), putrescine and spermidine. The mutant strain that was developed for the assay of AtBAT1 may be useful for the functional analysis of other families of plant and animal polyamine exchangers. We also hypothesize that this approach can be used to characterize many other types of antiporters, as long as these proteins can be expressed in the bacterial cell membrane. E. coli is a good system for the characterization of novel transporters, since there are multiple methods that can be employed to mutagenize native transporters.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Proteins involved in the trafficking of metabolites constitute an essential level of physiological regulation, but the vast majority of plant membrane transporters have not yet been functionally characterized. Several strategies have been implemented to characterize novel transport proteins. Heterologous expression in model organisms such as E. coli and eukaryotic cells such as yeast, Xenopus oocytes, mammalian cells, insect cells and plant cells have all been used to determine their transport activity1. Eukaryotic cells are favored for the expression of eukaryotic proteins, because the basic cellular composition, signal transducing pathways, transcription and translation machineries are compatible with the native conditions.

Yeast has been an important model organism for the characterization of novel transport proteins in plants. The first plant transport protein that was successfully expressed in yeast (Saccharomyces pombe) was the hexose transporter HUP1 from Chlorella2. Since then, many plant transport proteins have been functionally characterized using a yeast expression system. These include, plant sugar transporters (SUC1 and SUC23, VfSUT1 and VfSTP14) and the auxin transporters (AUX1 and PIN5). Disadvantages of utilizing yeast to express plant proteins can include impaired activity of plastid-localized proteins because yeast lacks this organelle, mistargeting6, and formation of misfolded aggregates and activation of stress responses in yeast due to overexpression of membrane proteins7,8,9.

Heterologous expression of transport proteins in Xenopus oocytes have been widely used for the electrophysiological characterization of transporters10. The first plant transport proteins characterized using heterologous expression in Xenopus oocytes were the Arabidopsis potassium channel KAT110 and the Arabidopsis hexose transporter STP111. Since then, Xenopus oocytes have been employed to characterize many plant transport proteins such as plasma membrane transporters12, vacuolar sucrose transporter SUT413 and vacuolar malate transporter ALMT914. An important limitation of Xenopus oocytes for transport assays is that the concentration of intracellular metabolites cannot be manipulated1. Moreover, professional knowledge is required to prepare Xenopus oocytes and the variability of the oocyte batches is difficult to control.

Heterologous expression in the model organism E. coli is an ideal system in terms of characterization of novel plant transport proteins. With a fully sequenced genome15, the molecular and physiological characteristics of E. coli are well known. Molecular tools and techniques are well established16. In addition, different expression vectors, non-pathogenic strains and mutants are available17,18,19. Furthermore, E. coli has a high growth rate and can be easily grown under laboratory conditions. Many proteins can be easily expressed and purified at high amounts in E. coli9. When proteins cannot be assayed directly in cellular systems, reconstitution of proteins into liposomes has also been a successful, albeit challenging innovation for the characterization of purified membrane proteins. Functional characterization of the plant mitochondrial transport proteins including solute transporters such as phosphate transporters in soybean, maize, rice and Arabidopsis, dicarboxylate-tricarboxylate carrier in Arabidopsis have been accomplished by using this model system20,21. However, recombinant proteins of the tomato protein SICAT9 were found to be nonfunctional in reconstitution experiments, and other members of the CAT transporter family were found to be nonfunctional in Xenopus oocyte assays22. Thus, additional molecular tools are needed for the characterization of membrane transporters.

Five polyamine transport systems are found in E. coli23. They include two ABC transporters mediating the uptake of spermidine and putrescine, a putrescine/ornithine exchanger, a cadaverine/lysine exchanger, a spermidine exporter and a putrescine importer. The putrescine exchanger PotE was originally characterized using a vesicle assay, where inside out vesicles were prepared by lysing cells with a French press and measuring the uptake of radiolabeled putrescine into the vesicles in exchange for ornithine24. Vesicle assays were also used to characterize a calcium transporter, which mediated the transport of calcium in response to a proton gradient25. These experiments prompted us to develop a strategy for the characterization of other polyamine exchangers. We first created a strain of E. coli deficient in PotE and CadB exchangers. Here, we demonstrate the functional characterization of a plant polyamine antiporter by heterlogous expression in the modified E. coli strain, generation of membrane vesicles using a French press, and radiolabeled assays.

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

1. Generation of the E. coli Double Knock Out Mutant with P1 Transduction

  1. Obtain the E. coli single-knockout mutant strains ΔPotE and ΔCadB from the E. coli Genetic Stock Center (http://cgsc.biology.yale.edu).
    NOTE: The ΔPotE strain is kanamycin resistant26 and the ΔCadB strain is tetracycline resistant27.
  2. Construct the PotE/CadB double knockout (DKO) strain using the P1 transduction protocol28.
    1. Lysate preparation
      1. Dilute an overnight culture of ΔPotE in fresh LB (1:100) supplemented with 10-25 mM MgCl2, 5 mM CaCl2, and 0.1-0.2% glucose.
      2. Grow at 37 °C for 1-2 h.
      3. Add 40 µL of P1 phage lysate to the culture, and continue growing at 37 °C. Monitor for 1-3 h until the culture has lysed
        NOTE: When the culture is lysed, cellular debris will be visible in the tube and the culture will have a significant loss of turbidity.
      4. Add several drops of chloroform (50-100 µL) to the lysate and vortex. Centrifuge at 12,000 x g for 2 min to remove cellular debris and transfer the supernatant to a fresh tube.
    2. Transduction
      1. Grow ΔCadB strain overnight in LB medium.
      2. Harvest the cells by centrifugation at 4,000 x g for 2 min and resuspend in 1/5-1/3 the harvested culture volume in fresh LB supplemented with 100 mM MgSO4 and 5 mM CaCl2.
      3. Add the ΔCadB cell suspension to the tube with phage from step 1.2.1.4 and mix rapidly.
      4. Add 200 µL of 1 M Na-Citrate (pH5.5), then add 1 mL of LB. Incubate at 37 °C for 1 h to allow the expression of the antibiotic resistant marker.
      5. Spin cells at 4000 x g for 5 min.
      6. Resuspend in 100 µL LB supplemeted with 100 mM Na-Citrate (pH 5.5) and vortex well to disperse cells.
      7. Select the recombinant strains on LB agar plates with 50 µg/mL kanamycin and 10 µg/mL tetracycline and then confirm by Polymerase Chain Reaction (PCR) with appropriate primers26,27.
      8. Verify the PCR fragments by sequencing.

2. Expression of the Target Gene (AtBAT1) in E. coli Mutant

  1. Amplify the full-length sequence of the target gene by PCR and insert into the Gateway entry vector pENTR/D-TOPO29.
    NOTE: In this case ATBAT1.1 was amplified using forward primer 5'CGGCGATCAATCCTTTGTT and reverse primer 5'GCTAAGAATGTTGGAGATGG, an initial denaturation at 98 °C for 2 min and then 30 cycles of denaturation at 98 °C for 0.1 min, annealing at 59 °C for 0.3 min, extension at 72 °C for 0.40 min and final extension at 72 °C for 10 min. The PCR product was purified using a PCR cleanup kit, quantified using a spectrometer. Insertion of the PCR product into the Gateway vector was done following the manufactrurers directions.
    1. Transform the entry vector into competent Top10 E. coli cells by heatshock and select for successful recombinants on LB media with 50 µg/mL kanamycin following standard molecular cloning protocols30.
    2. Extract plasmid DNA using a plasmid extraction kit, following the manufacturer's directions, and sequence to confirm the correct insertion.
  2. Transfer the target gene into the E. coli destination vector, pBAD-DEST49 by Gateway LR cloning to create an expression vector29.
    1. Transform the expression vector into competent Top10 E. coli cells by heatshock for 30 s and select successful recombinants on LB media with 100 µg/mL ampicillin30.
    2. Extract plasmid DNA30 and sequence to confirm the correct insertion.
  3. Transform expression vector into E. coli ΔpotE740(del)::kan, ΔcadB2231::Tn10 and select on LB plates with ampicillin, kanamycin, and tetracycline30.
  4. In order to determine the optimal concentration of arabinose for induction, express the target gene under the control of the araBAD promoter in LB media with gradient concentrations of arabinose as described29.
  5. Collect the cell pellets and assess protein expression by SDS-PAGE and visualization of protein bands as described in the product manual29.
    NOTE: The E. coli ΔpotE740(del)::kan, ΔcadB2231::Tn10 was used as the control sample without BAT1 expression. E.coli double knock out mutant cells with the empty pBAD-DEST49 vector was not used as a control due to the presence of the ccdB gene in the vector.

3. Generation of Inside-out Membrane Vesicles

  1. Culture the E. coli mutant cells expressing the target protein by growing a single colony overnight in 5 mL of polyamine-free media (2% glycerol, 6 g of K2HPO4, 3 g of KH2PO4, 0.5 g of NaCl, NH4Cl, 50 mg of thiamine, 0.79 g yeast complete synthetic media adenine hemisulfate (10 mg/L), L-Arginine (50 mg/L), L-Aspartic acid (80 mg/L), L-Histidine hydrochloride monohydrate (20 mg/L), L-Leucine (100 mg/L), L-Lysine hydrochloride (50 mg/L), L-Methionine (20 mg/L), L-Phenylalanine (50 mg/L), L-Threonine (100 mg/L), L-Tryptophan (50 mg/L), L-Tyrosine (50 mg/L), L-Valine (140 mg/L), Uracil (20 mg/L)). Transfer this culture to 500 mL of polyamine-free media supplemented with 0.0002% arabinose and grow until the cell culture reaches an OD600 of 0.6-0.8 (usually ~5 h).
  2. Collect the cell pellet by centrifugation at 2,000 x g for 15 min at 4 °C. Resuspend the pellet and wash three times with 0.1 M potassium phosphate buffer, pH 6.6, containing 10 mM EDTA (Buffer 1). The final volume of cells in Buffer 1 after the third spin should be 10 mL.
  3. Generate inside-out membrane vesicles by French Press treatment (10,000 p.s.i.) of the intact cells using a 35 mL French pressure Cell.
  4. Prior to loading the sample into the standard French pressure cell, lubricate the piston and O-rings to make it easier to insert into the cell.
    NOTE: These instructions are specific for the use of the standard pressure cell31.
    1. Carefully screw the closure plug into the lower end of the cell. Ensure that the cell is right-side up based on the lettering on the side of the cell. Insert the piston into the cell and move it into the cell, until the max fill line on the piston reach the top of the piston. Flip the unit over and place on the provided stand between the three posts.
    2. Pour the cell suspension into the body of the cell.
      NOTE: We have been using only 10 mL, so there will be plenty of room left in the French pressure cell chamber, which has a capacity of 35 mL.
    3. Mount the standard pressure cell on the French pressure cell unit.
      1. First check that the power is off. On the left side of the panel is the Ratio Selector switch. It has three positions: Down at the end of the run, Low for using a smaller pressure cell, and High for use with the standard French pressure cell. If the French press was previously used with the smaller cell the piston may not be fully retracted. Set this switch to Down.
    4. Turn the machine on with the switch on the RHS at the back of the unit and turn the Pause-Run switch to the Run position. This will result in the piston being fully retracted. Move the switch back to Pause, and shut the machine off.
    5. Loosen the thumb screws and move the safety clamp that spans to two stainless steel columns to the side. It will swing out to the right. With one hand holding the base of the closure plug in place, pick the French pressure cell up with both hands, and rotate it 180°, so the piston is now in the upright position. Set it onto the platform, and move the safety clamp back in place so that this clamp holds the French pressure cell in position.
    6. Note the Flow Valve assembly on the closure plug needs to be accessible to the operater and positioned so that the valve can be turned freely. Open the the flow valve assembly with a few counter clockwise turns. Position the the arms of the piston so that they are oriented in a two o'clock and eight o'clock position. Tighten the thumbs screws so that the standard pressure cell is held in place.
    7. Insert the Sample outlet tube into the closure plug, and connect a short piece of flexible tubing so that the broken cell debris can be collected in a falcon tube. We usually use an 300 mL ice-filled beaker to hold the falcon tube upright, and to keep the cell debris chilled.
    8. Make sure the Pause-Run switch is set to Pause, and the valve assembly is in the open position. Turn the machine back to on, adust the Ratio Selector switch to High, and turn the Pressure Increase Valve on the front panel to the right about a half turn.
    9. The piston will begin to rise from the base to displace the air in chamber. Direct the air coming out of the Tygon tubing attached to the sample outlet tube to the tube in the beaker.
    10. When the first drops of liquid come out, close the the flow valve assembly by turning it clockwise. This creates a metal to metal seal, with the pressure cell, so do not overtighten.
    11. The front of the French Press has a chart on the front panel to generate the proper pressure on the biological cells inside the pressure cell. In this case, increase the pressure by turning the Pressure Increase Valve clockwise, until the Gauge reaches 640 psi. This will create an internal pressure of 10,000 psi.
    12. Once the cell has reached target pressure open the flow valve assembly slightly by turning it counter clockwise. Adjust the the opening of the valve to allow a flow rate of only about 10 drops per min.
    13. When the stop line on the piston body reaches the top of the flow cell. Switch the Pause-Run Switch to Pause. This is critical because having the piston inserted farther into the cell will damage the unit. Open the flow valve assembly and collect the remaining drops.
    14. Turn Ratio Selector switch to Down, and then set the Pause Run switch to Run. When the bottom plate is fully retracted set the Run switch to Pause, and turn the machine off.
    15. Remove the French pressure cell from the French press, and disassemble for cleaning. Store all parts dry with a light covering of glycerol. Remove and replace any gaskets or seals with signs of wear.
  5. Remove unbroken cells and cell debris of the French press eluent by centrifugation at 10,000 x g for 15 min at 4 °C. Discard the pellet, and transfer supernatant to ultracentrifuge tubes.
  6. Pellet membrane vesicles from the resulting supernatant by ultracentrifugationat 150,000 g for 1 h at 4 °C.
  7. Wash the membrane vesicles once, without resuspension, in 1 mM Tris-maleate, pH 5.2 containing 0.14 M KCl, 2 mM 2-mercaptoethanol and 10% glycerol and resuspend in the same buffer (Buffer 2)23 using a Dounce tissue grinder. Typically the membrane fraction from 500 mL of culture would be suspended in 5 mL of buffer, and a concentration of 5-10 mg of membrane protein/mL using the Biochinic Acid assay32.
  8. Store 100 µL aliquots of membrane preparations at -80 °C in 1.5 mL microcentrifuge tubes.

4. Western Blot and Orientation of Transporter Assay

  1. Wash and resuspend vesicles from step 3.7 in 30 mM Tris pH 7.8 + 0.1 mM CoCl2.
  2. To 100 µL samples, add 1 µL of 2 mg/mL carboxypeptidase A in 0.1 M NaCl, 30 mM Tris, 0.2 mM CoCl2 pH 7.8.
  3. Inculate for 20 min at 20 °C. Stop digestion by adding 5 µL of 0.5 M NaEDTA, 0.5 M 2-mercaptoethanol pH 7.5.
  4. To fully inactivate the enzyme, incubate the solution for 1 h at room temperature.
    NOTE: Vesicles without the catboxypeptidase A treatment were used as a control.
  5. Analyze samples by electrophoresis in the presence of lithium dodecyl sulfate. Add 5-10 µL of 150 mg/mL lithium dodecyl sulfate, 450 mg/mL glycerol, 0.1 mg/mL bromophenol blue, 0.4 M Tris pH 7.5 to 100 µL of sample.
  6. Perform immunoblotting by laying a nitrocellulose filter moistened with 25 mM sodium-hydrogen phosphate pH 7.5 upon the polyacrylamide gel. Place these between two moistened cellulose filters and finally between two moistened plastic scouring pads. Place this assemblage between the electrodes of a chamber containing 25 mM sodium-hydrogen phosphate pH 7.5 at 2-4 °C.
  7. Allow electrotransfer of proteins to proceed for 3 h at 20 V and 2-3 A.
  8. Block the nitrocellulose membrane overnight at 2 °C in a blocking buffer of 0.15 M NaCl, 10 mM Tris, pH 7.5 and 0.5 mg/mL Tween 2033.
  9. Incubate the nitrocellulose filter for 2 h with a 1:5000 dilution of Anti-His (C terminal)-HRP antibody in the blocking buffer (20 mL) and wash twice with 50 mL of buffer for a total of 60 min.
  10. To visualize the immunoblot, dissolve 6 mg of 4-chloro-1-naphthol in 20 mL of denatured alcohol and add 80 mL of 15 mM Tris pH 7.5 and 50 µL of 30% H2O2. Bathe the filter paper in the substrate solution for 20 min. The reagent will react with the antibody to form a blue precipitate on the nitrocellulose membrane. When sufficient color has developed, rinse the membrane with water, and allow to dry.

5. Transport Assay

  1. Incubate 100 μL aliquots of membrane vesicles at 12 °C for 5 min.
  2. Initiate transport by adding radiolabeled polyamines to the membrane vesicles at a final concentration of 50 µM (unless otherwise stated). Make 3H-substrate (spermidine or putrescine) solutions in an assay buffer consisting of 10 mM Tris-HCl, 10 mM potassium phosphate, pH 8.0 and 0.14 M KCl23 (Buffer 3) with modifications depending on the assay.
  3. Conduct transport assays for 1 min at 12 °C in 1.5 mL microfuge tubes.
  4. After 1 min, transfer the reaction mixtures to filtration manifold and filter through a 0.45 µm nitrocellulose membrane filter.
    1. Add 3 mL of ice-cold assay buffer containing a 10-fold higher concentration of unlabeled polyamines followed by 3 mL of assay buffer without the polyamines to reduce nonspecific binding.
    2. Transfer the washed filters to 20 mL disposable scintillation vials containing 10 mL of scintillation liquid and determine radioactivity by using a liquid scintillation counter. The scintillation counter measures the radioactivity in the sample and reports it as disintegrations per min (dpm).
  5. Calculate the net polyamine uptake as the difference between the uptake at 1 min by vesicles incubated at 12 °C and uptake at 0 min by vesicles incubated on ice.
    NOTE: The mass of substrate imported into the vesicles is calculated as follows. If the sample volume in the microfuge tube is 0.2 µL and the starting concentration of substrate is 100 µM, then the total mass of substrate in the microfuge tube is 20 x 10-12 M. Because of the very high specific activity of commercially labelled substrates (often 2.22 x 109 dpm/mM) the mass of the isotope added can be ignored in the calculation. So if the total amount of isotope that was added to the microfuge tube was 100 x 106 dpm and the vesicles had a net uptake of 1,000 dpm, then the total mass of substrate taken up by the vesicles was 1% of the total number of moles of substrate or 2 x 10-13 M.
    1. Determine Km for the substrate by measuring the uptake of 10, 25, 50, 250 and 500 μM radiolabeled substrate into vesicles expressing the target protein. Calculate Michaelis-Menten kinetics using a nonlinear regression method using the Michaelis Menton model of the statistical software package34.
  6. For the competition experiments, add 100 μM, 500 μM, 1 mM, 1.5 mM or 2 mM nonlabelled competitive substrate made in the assay buffer to the 1.5 mL microcentrifuge tube containing 100 µL of vesicles at 12 °C.
    1. Add radiolabeled polyamine (50 µM) to the microcentrifuge tube simultaneously.
    2. Measure radioactivity trapped inside vesicles as mentioned above by repeating steps 5 through 5.4.2.
    3. Determine apparent Km (Km,app) for the competitive substrates by measuring the uptake of 10, 25, 50, 250 and 500 μM radiolabeled polyamines in the presence of 100 μM or higher nonlabelled substrate and using a nonlinear regression method to plot the curve.

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The major steps in this protocol are summarized pictorially in Figure 1. Briefly, E. coli cells deficient in all polyamine exchangers and expressing AtBAT1 are cultured, centrifuged, washed with a buffer and subjected to cell lysis using a French press. Lysis tends to produce vesicles that are mostly inside-out and trap the buffer outside the cells. Cell debris is removed by centrifugation, and a second ultracentifugation step is used to col...

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

In the present study, we outline a method for the characterization of an antiporter by first expressing the protein in E. coli and then generating membrane vesicles, so that the heterologously-expressed protein can be assayed in a cell-free system. In addition to equipment found in most molecular biology labs, this strategy requires the use of a French press, an ultracentrifuge, and access to a facility to conduct radioisotope assays.

A basic requirement of this technique is that the ...

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors have nothing to disclose.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Support for this project came from the BGSU Graduate College, and the BGSU Office of Sponsored Programs and Research.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
2-mercaptoethanolSigma-AldrichM6250
3H-putrescinePerkinElmerNET185001MC
3H-spermidinePerkinElmerNET522001MC
4-chloro-1-naphtholSigma-AldrichC8890
14C arginineMoravek Inc.MC137
ArginineSigma-AldrichA-5006
Anti-His (C-term)-HRP antibodyThermoFisherR931-25Detects the C-terminal polyhistidine (6xHis) tag, requires the free carboxyl
group for detection
ArabinoseSigma-AldrichA3256
BCA protein assay kitThermoFisher23227Pierce BCA protein asay kit.
Bromophenol blueBio-Rad161-0404
Carboxypeptidase BSigma-AldrichC9584-1mg
CentrifugeSorvallSS-34 fixed angle rotor and GA-6 fixed angle rotor
Dounce tissue grinderLabGenome7777-7Corning 7777-7 pyrex homogenizer with pour spout.
Ecoscint-HNational DiagnosticsLS275scintillation cocktail
EDTASigma-Aldrich
Filtration manifoldHoeferFH225V
French Pressure CellGlen MillsFA-080A120
GABASigma-AldrichA2129
GlutamateSigma-AldrichG6904
Glycerol
GraphPad Prism softwarehttp://www.graphpad.com/prism/Prism.htm
Hydrogen peroxideKROGER
Potassium ChlorideJ.T. Baker3040-01
Liquid scintillation counterBeckmanLS-6500
MaleateSigma-AldrichM0375
NanodropThermoFisher
Nitrocellulose membrane filtersMerck Milliporehawp025000.45 µM
PCR clean up kitGenscriptQuickClean II
Potassium Phosphate dibasicThermoFisherP290-500
putrescinefluka32810
Potassium Phosphate monobasicJ.T.Baker4008
SpermidineSigma-aldrichS2501
Strains :E. coli ΔpotE740(del)::kan, ΔcadB2231::Tn10This manuscriptAvailable upon request.Strain is deficient in the PotE and CadB polyamine exchangers.
Tris-baseResearch ProductsT60040-1000
UltracentrifugeSorvall MTX 15046960Thermo Fisher S150-AT fixed angle rotor
Ultracentrifuge tubesThermoFisher45237Centrifuge tubes for S150-AT rotor
Vector: pBAD-DEST49ThermoFisherGateway expression vector for E. coli

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Haferkamp, I., Linka, N. Functional expression and characterisation of membrane transport proteins. Plant Biology (Stuttgart). 14 (5), 675-690 (2012).
  2. Sauer, N., Caspari, T., Klebl, F., Tanner, W. Functional expression of the Chlorella hexose transporter in Schizosaccharomyces pombe. Proceedings of the National Academy of Sciences of the United States of America. 87 (20), 7949-7952 (1990).
  3. Sauer, N., Stolz, J. SUC1 and SUC2: two sucrose transporters from Arabidopsis thaliana; expression and characterization in baker's yeast and identification of the histidine-tagged protein. The Plant Journal. 6 (1), 67-77 (1994).
  4. Weber, H., Borisjuk, L., Heim, U., Sauer, N., Wobus, U. A role for sugar transporters during seed development: molecular characterization of a hexose and a sucrose carrier in fava bean seeds. Plant Cell. 9 (6), 895-908 (1997).
  5. Huang, J. G., et al. GhDREB1 enhances abiotic stress tolerance, delays GA-mediated development and represses cytokinin signalling in transgenic Arabidopsis. Plant, Cell & Environment. 32 (8), 1132-1145 (2009).
  6. Bassham, D. C., Raikhel, N. V. Plant cells are not just green yeast. Plant Physiology. 122 (4), 999-1001 (2000).
  7. Garcia-Mata, R., Bebok, Z., Sorscher, E. J., Sztul, E. S. Characterization and dynamics of aggresome formation by a cytosolic GFP-chimera. Journal of Cell Biology. 146 (6), 1239-1254 (1999).
  8. Liu, J., Sitaram, A., Burd, C. G. Regulation of copper-dependent endocytosis and vacuolar degradation of the yeast copper transporter, Ctr1p, by the Rsp5 ubiquitin ligase. Traffic. 8 (10), 1375-1384 (2007).
  9. Drew, D., et al. GFP-based optimization scheme for the overexpression and purification of eukaryotic membrane proteins in Saccharomyces cerevisiae. Nature Protocols. 3 (5), 784-798 (2008).
  10. Schachtman, D. P., Schroeder, J. I., Lucas, W. J., Anderson, J. A., Gaber, R. F. Expression of an inward-rectifying potassium channel by the Arabidopsis KAT1 cDNA. Science. 258 (5088), 1654-1658 (1992).
  11. Boorer, K. J., Forde, B. G., Leigh, R. A., Miller, A. J. Functional expression of a plant plasma membrane transporter in Xenopus oocytes. FEBS Letters. 302 (2), 166-168 (1992).
  12. Miller, A. J., Zhou, J. J. Xenopus oocytes as an expression system for plant transporters. Biochimica et Biophysica Acta. 1465 (1-2), 343-358 (2000).
  13. Reinders, A., Sivitz, A. B., Starker, C. G., Gantt, J. S., Ward, J. M. Functional analysis of LjSUT4, a vacuolar sucrose transporter from Lotus japonicus. Plant Molecular Biology. 68 (3), 289-299 (2008).
  14. Kovermann, P., et al. The Arabidopsis vacuolar malate channel is a member of the ALMT family. The Plant Journal. 52 (6), 1169-1180 (2007).
  15. Blattner, F. R., et al. The complete genome sequence of Escherichia coli K-12. Science. 277 (5331), 1453-1462 (1997).
  16. Terpe, K. Overview of bacterial expression systems for heterologous protein production: from molecular and biochemical fundamentals to commercial systems. Applied Microbiology and Biotechnology. 72 (2), 211-222 (2006).
  17. Miroux, B., Walker, J. E. Over-production of proteins in Escherichia coli: mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels. Journal of Molecular Biology. 260 (3), 289-298 (1996).
  18. Wagner, S., et al. Consequences of membrane protein overexpression in Escherichia coli. Molecular & Cellular Proteomics. 6 (9), 1527-1550 (2007).
  19. Bernaudat, F., et al. Heterologous expression of membrane proteins: choosing the appropriate host. PLoS One. 6 (12), e29191(2011).
  20. Takabatake, R., et al. Isolation and characterization of cDNAs encoding mitochondrial phosphate transporters in soybean, maize, rice, and Arabidopis. Plant Molecular Biology. 40 (3), 479-486 (1999).
  21. Picault, N., Palmieri, L., Pisano, I., Hodges, M., Palmieri, F. Identification of a novel transporter for dicarboxylates and tricarboxylates in plant mitochondria. Bacterial expression, reconstitution, functional characterization, and tissue distribution. Journal of Biological Chemistry. 277 (27), 24204-24211 (2002).
  22. Snowden, C. J., Thomas, B., Baxter, C. J., Smith, J. A., Sweetlove, L. J. A tonoplast Glu/Asp/GABA exchanger that affects tomato fruit amino acid composition. The Plant Journal. 81 (5), (2015).
  23. Kashiwagi, K., Igarashi, K. Identification and assays of polyamine transport systems in Escherichia coli and Saccharomyces cerevisiae. Methods in Molecular Biology. 720, 295-308 (2011).
  24. Kashiwagi, K., Miyamoto, S., Suzuki, F., Kobayashi, H., Igarashi, K. Excretion of putrescine by the putrescine-ornithine antiporter encoded by the potE gene of Escherichia coli. Proceedings of the National Academy of Sciences of the United States of America. 89 (10), 4529-4533 (1992).
  25. Tsuchiya, T., Rosen, B. P. Calcium transport driven by a proton gradient and inverted membrane vesicles of Escherichia coli. Journal of Biological Chemistry. 251 (4), 962-967 (1976).
  26. Baba, T., et al. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Molecular Systems Biology. 2, (2006).
  27. Nichols, B. P., Shafiq, O., Meiners, V. Sequence analysis of Tn10 insertion sites in a collection of Escherichia coli strains used for genetic mapping and strain construction. Journal of Bacteriology. 180 (23), 6408-6411 (1998).
  28. Sauer, B. P1vir phage transduction. , https://openwetware.org/wiki/Sauer:P1vir_phage_transduction (2011).
  29. Invitrogen. pBAD-DEST49 Gateway Destination Vector. , https://www.thermofisher.com/order/catalog/product/12283016 (2010).
  30. Green, M. R., Sambrook, J. Molecular Cloning: a laboratory Manual. , 4th edition, Cold Spring Harbor Laboratory Press. (2012).
  31. GlennMills. Thermo Electron French Press Operation Manual. , http://www.glenmills.com/wp-content/uploads/2011/06/GLEN-MILLS-INC.-FRENCH-PRESS-Operating-Manual-Feb-2007-Rev-11.pdf (2007).
  32. Smith, P. K., et al. Measurement of protein using biochinic acid. Analytical Biochemistry. 150, 76-85 (1985).
  33. Wright, J. K., Overath, P. Purification of the lactose: H+ carrier of Escherichia coli and characterization of galactoside binding and transport. European Journal of Biochemistry. 138 (3), 497-508 (1984).
  34. PRISM. GaphPad Software. , https://www.graphpad.com/data-analysis-resource-center/ (2019).
  35. Kirchberger, S., et al. Molecular and biochemical analysis of the plastidic ADP-glucose transporter (ZmBT1) from Zea mays. Journal of Biological Chemistry. 282 (31), 22481-22491 (2007).
  36. Deniaud, A., et al. Expression of a chloroplast ATP/ADP transporter in E. coli membranes: behind the Mistic strategy. Biochimica et Biophysica Acta. 1808 (8), 2059-2066 (2011).
  37. Sze, H. H+-Translocating ATPases: Advances Using Membrane Vesicles. Annual Review of Plant Physiology. 36, 175-208 (1985).
  38. Bush, D. R. Proton-coupled sugar and amino acid transporters in plants. Annual Review of Plant Physiology Plant Molecular Biology. 44, 513-542 (1993).
  39. Futai, M. Orientation of membrane vesicle from Escherichea coli prepared by different procedures. Journal of Membrane Biology. 115, 15-28 (1974).
  40. Seckler, R., Wright, J. K. Sideness of native membrane vesicles of Escherichea coli and orientation of the reconstituted lactose: H+ carrier. European Journal of Biochemistry. 142 (2), 269-279 (1984).
  41. LaVallie, E. R., Lu, Z., Diblasio-Smith, E. A., Collins-Racie, L. A., McCoy, J. M. Thioredoxin as a fusion partner for production of soluble recombinant proteins in Escherichia coli. Methods in Enzymology. 326, 322-340 (2000).
  42. Goodman, D. B., Church, G. M., Kosuri, S. Causes and effects of N-terminal codon bias in bacterial genes. Science. 342 (6157), 475-479 (2013).
  43. Wacker, M., et al. N-linked glycosylation in Campylobacter jejuni and its functional transfer into E. coli. Science. 298 (5599), 1790-1793 (2002).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

French PressUltracentrifugationMembrane Filtration AssaySubstrate SpecificityWestern BlotTransport Assay

Related Articles