Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Kök Hücre Kaynaklı Viral Ag-Spesifik T Lenfositler Farelerde HBV Replikasyonlarını Baskılar

doi: 10.3791/60043 Published: September 25, 2019

Summary

Burada sunulan kök hücre kaynaklı viral antijen (Ag) özgü T lenfositlerin benimseyen hücre transferi (ACT) kullanarak farelerde hepatit B virüsü (HBV) replikasyonu nun etkin bastırılması için bir protokoldür. Bu işlem HBV enfeksiyonunun act tabanlı potansiyel immünoterapisi için uyarlanabilir.

Abstract

Hepatit B virüsü (HBV) enfeksiyonu küresel bir sağlık sorunudur. Dünya çapında etkilenen 350 milyondan fazla kişi ile, HBV enfeksiyonu karaciğer kanserinin önde gelen nedeni olmaya devam etmektedir. Bu, özellikle gelişmekte olan ülkelerde önemli bir sorundur. Bağışıklık sisteminin HBV'ye karşı etkili bir yanıt vermemesi kronik enfeksiyona yol açar. HBV aşısı mevcut ve yeni antiviral ilaçlar oluşturulmaktadır rağmen, virüs-rezervuar hücrelerinin eradikasyonu önemli bir sağlık konusu olmaya devam etmektedir. Burada açıklanan viral antijen üretimi için bir yöntemdir (Ag) -spesifik CD8+ sitotoksik T lenfositler (CTLs) indüklenen pluripotent kök hücrelerden türetilen (iPSCs) (yani, iPSC-CTLs), HBV replikasyonbastırmak için yeteneğine sahip. HBV replikasyonu farelerde hbv ekspresyonu plazmidi pAAV/HBV1.2'nin karaciğere hidrodinamik enjeksiyonu ile etkin bir şekilde indüklenir. Daha sonra, HBV yüzey Ag-spesifik fare iPSC-CTLs büyük ölçüde karaciğer ve kanda HBV replikasyon bastırır ve hepatositlerde HBV yüzey Ag ekspresyonunu önler, benimsenden aktarılır. Bu yöntem, hidrodinamik enjeksiyon sonrası farelerde HBV replikasyonu gösterir ve kök hücre kaynaklı viral Ag-spesifik CTLs HBV replikasyonbastırmak olabilir. Bu protokol HBV immünoterapi için yararlı bir yöntem sağlar.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Akut enfeksiyon dan sonra, adaptif bağışıklık sistemi (yani, humoral ve hücresel bağışıklık) akut HBV ile ilgili hepatit toplu kontrol eder. Yine de, HBV-endemik bölgelerde insanların bir dizi virüsleri ortadan kaldırmak ve daha sonra kronik bireyler olarak dönüştürmek olamaz. Kronik hastaların %25'inden fazlası (>250 milyon kişi) dünya çapında ilerleyici karaciğer hastalığı gelişir ve karaciğer sirozu ve/veya hepatosellüler karsinom (HCC)1. Sonuç olarak, ısrarla enfekte hücrelerin eradikasyonu genel bir sağlık sorunu olmaya devam etmektedir, mevcut bir aşı olmasına rağmen2 ve çok sayıda antiviral ilaçlar geliştirilmektedir. HBV enfeksiyonu için standart tedavi IFN-α, nükleozit ve nükleotid analogları içerir. Bu ajanlar doğrudan antiviral aktivite ve bağışıklık modülatör kapasiteleri var. Bununla birlikte, HBe antijeninin (Ag)+ anti-HBe antikor (Ab) ve serum HBV deoksiribonükleik asit (DNA) kaybı ile birlikte seropdönüşümü tedavi edilen hastaların yaklaşık %20'sinde ayrı ayrı görünür ve virüsün tüm immünolojik kontrolü HBsAg yoksunluğu ile doğrulanan en fazla% 53. Ayrıca, tedaviye yanıt genellikle dayanıklı değildir. Rekombinant HBs Ag ile profilaktik aşılama enfeksiyonu önlemede son derece etkilidir, ancak terapötik HBs Ag aşısı etkili değildir. Açıkçası, T hücre aracılı bağışıklık yanıtları HBV enfeksiyonu ve karaciğer bozukluğu kontrolünde kritik bir rol oynamaktadır; ancak, kronik hepatit hastalarında, HBV-reaktif T hücreleri genellikle silinir, işlevsiz, ya da tükenmiş dönüştürmek4,5,6. Sonuç olarak, kalıcı HBV enfeksiyonu olan bireylerde, anti-viral ilaç, immüno-modüler sitokinler veya küratif bağışıklama yoluyla HBV'ye özgü bağışıklığı (yani T hücre tabanlı bağışıklık) geri getirme girişimleri başarıya ulaşamaz.

HBV Ag-spesifik T hücrelerinin benimseyen hücre transferi (ACT) sonunda kalan hepatositler wih HBV7ortadan kaldırmak için yönlendirilen etkili bir tedavidir,8. HBV'ye özgü KTK'ların HBV enfekte olmuş farelere aktiretinin geçici, hafif hepatite ve hepatositlerde HBV ribonükleik asit (RNA) transkriptlerinde dramatik bir düşüşe neden olduğu gösterilmiştir. Bu çalışmalarda, CTLs HBV genlerin transkripsiyonunu inhibe etmedi ama HBV transkript bozulması gelişmiş9. HBV'ye özgü CtL'ler viral enfeksiyonu önlemek ve HBV10,11'intemizlenmesine aracılık etmek için önemlidir. ACT tabanlı ilaçlar için, in vivo resettlement için yüksek reaktivite ile HBV özgü T hücrelerinin in vitro genişleme ideal bir yöntem olduğu ileri sürülmüştür12,13,14; Bununla birlikte, mevcut yaklaşımlar potansiyel tedaviler için hastalardan HBV'ye özgü T hücrelerinin uygun miktar ve niteliklerini üretme, ayırma ve büyütme yetenekleri açısından kısıtlanmıştır.

Klinik çalışmalarda HBV virüs bulaşmış hepatositlere özgü mühendislik T hücreleri vasıtası ile hücre bazlı tedavilerin güvenliği, pratikliği ve prospektif terapötik aktivitesi mevcut olsa da, olumsuz etkileri hakkında endişeler vardır yanlış eşleşmeli T hücre reseptöründen çapraz reaktivite nedeniyle otoimmün yanıtlardan kaynaklanan (TCR)15,16, non-spesifik TCR17 tarafından hedef dışı Ag tanıma ve bir şierik Ag reseptörü (CAR) tarafından hedef dışı toksisite 18.000 , Sağlıklı dokularla 19. Şu anda, genetiği değiştirilmiş T hücreleri, sadece in vivo kısa süreli kalıcılık var, genellikle ara veya daha sonra etkili T hücreleridir. Bugüne kadar, pluripotent kök hücreler (PSCs) naif tek tip Ag-spesifik T hücreleri20, 21,22,23yüksek sayıda üretmek için kullanılabilir tek kaynaktır. İndüklenen PSC'ler (iPSC'ler) sadece birkaç transkripsiyon faktörünün gen transdüksiyonu yoluyla hastanın somatik hücrelerinden dönüştürülür. Sonuç olarak, iPSC'ler embriyonik kök hücreler (ESCs)24benzer özelliklere sahip. Doku replasmanına ek olarak, doku replasmanına ek olarak, kendini yenileme esnekliği ve olasılığı sayesinde, iPSC tabanlı tedaviler rejeneratif tıpta yaygın olarak uygulanabilir. Ayrıca, iPSCs altında yatan alaylar önemli ölçüde mevcut hücre tabanlı tedavileri artırabilir.

Bu yöntemin genel amacı, ACT tabanlı immünoterapi için iPSC'lerden (yani iPSC-CTLs) hbv'ye özgü ctl'ler üretmektir. Alternatif tekniklere göre avantajları HBV'ye özgü iPSC-CTL'lerin tek tip TCR ve naif fenotip olmasıdır, bu da ACT'den sonra daha fazla bellek T hücre gelişimiile sonuçlanır. HBV'ye özgü iPSC-CTL'lerin AKTIV'sinin karaciğerde fonksiyonel CD8+ T hücrelerinin geçişini artırdığı ve hem karaciğerlerde hem de yönetilen farelerin kanlarında HBV replikasyonlarını azalttığı gösterilmiştir. Bu yöntem HBV immünoterapi için viral Ag-spesifik iPSC-CTLs potansiyel kullanımını ortaya koymaktadır ve viral immünoterapi için diğer viral Ag-spesifik iPSC-T hücreleri oluşturmak için adapte edilebilir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tüm hayvan deneyleri Texas A&M Üniversitesi Hayvan Bakım Komitesi (IACUC; #2018-0006) tarafından onaylanır ve Laboratuvar Hayvan Bakımı Nın Değerlendirilmesi ve Akreditasyonu Derneği'nin yönergelerine uygun olarak yürütülmektedir. Fareler 6-9 yaş ları arasında kullanılır.

1. IPSC'lerden viral Ag'ye özgü CD8+ T hücrelerinin (iPSC-CD8+ T hücreleri) üretimi

  1. Retroviral yapılar oluşturulması
    NOT: TCR α ve β genleri 2A kendi kendine ayrılma sırası ile bağlantılıdır. Retroviral vektör MSCV-IRES-DsRed (MiDR) DsRed+ 23olduğunu .
    1. Alt klon HBs183-191 (FLLTRILTI)-spesifik A2-sınırlı insan-mindik hibrid TCR (s183 TCR) genleri (Vα34 ve Vβ28) S183 MiDR yapı oluşturmak için MiDR içine (Şekil 1A)25.
  2. Retroviral transdüksiyon
    NOT: Platin-E (Plat-E) hücreleri retrovirüslerin (s183 TCR genlerini taşıyan) paketlenmesinde kullanılır ve bu hücreler retroviral transdüksiyon için kullanılır. Plat-E hücreleri, öğürme, pol ve ekotropik env dahil retroviral yapı proteinini ifade etmek için EF1α organizatörü aracılığıyla benzersiz ambalaj yapıları ile geliştirilen 293T hücrelerinin altında yatan etkili bir retrovirüs ambalaj hücreleridir.
    1. 100 mm'lik bir kültür çanamında, transfeksiyondan 1 gün önce 37 °C'de %10 fetal buzağı serumu (FCS) içeren 8mL DMEM kültür ortamındaki 3 x 106 Plat-E hücreleri bulunur.
    2. Gün 0, transfect s183 MiDR plat-E hücreleri içine bir DNA transfeksiyonreaktifi 25kullanarak inşa .
    3. 1. günde, tohum 1 x 106 iPSCs (GFP+) bir jelatin önceden kaplanmış kültür plakaiçine.
    4. 2-3. günlerde, Plat-E hücre kültüründen süpernatant içeren retrovirüsler iPSC'leri s183 TCR ile 1,6-dibromohexane çözeltisi25varlığında aktarın.
    5. 4. günde, s183 TCR gen transdüktöri iPSC'leri, santrifüjü 5 dk için 400 x g ve 100 mm kültür kabında 3 × 10 5 iPSC'yi 3 x 106 ışınlanmış SNL76/7 (irNLS76/7) besleyici hücreleri ile önceden kaplanmış olarak 3 × 105 iPSC'yi deneyin25.
    6. 5 veya 6. Canlı hücreler üzerinde gating, sıralama GFP ve DsRED çift pozitif hücreleri (s183 TCR gen-transduced iPSCs) yüksek hızlı hücre ayırıcı sı. Adım 1.2.5 benzer, co-kültür irSNL76/7 besleyici hücreler üzerinde sıralanmış hücreleri gelecekteki kullanım için25.
  3. HBV'ye özgü iPSC-CD8+ T hücrelerinin farklılaşması
    NOT: OP9-DL1/DL4 stromal hücreleri hem Notch ligands DL1 ve DL4 aşırı ekspres ve iPSCs ile co-culturing iPSCs Notch sinyal aracılı T hücre farklılaşması teşvik edebilirsiniz26.
    1. %20 fetal sığır serumu (FBS) içeren α-minimum esansiyel ortam (MEM) ortamlarında OP9-DL1-DL4 hücre monotabakasında s183 TCR genile transdükre edilen iPSC'leri (s183/iPSCs) yetiştirin. Kültüre murine Flt3 ligand (mFlt-3L; son konsantrasyon = 5 ng/mL) ekleyin.
    2. 0. günde, daha önce OP9-DL1-DL4 hücreleri ile yetiştirilen 10 cm'lik kültür kabında 0.5-1.0 x 105 S183/iPSC tohum. OP9-DL1-DL4 hücrelerinin %80-%90 biraraya geldiğini doğrulayın.
    3. 5. günde, 10 mL fosfat-tamponlu salin (PBS) ile iPSC'leri durulayın, PBS'den aspire edin, bunu %0,25 tripsin'in 4 mL'sine ekleyin ve 10 dakika boyunca 37 °C'lik bir kuluçka makinesinde kuluçkaya yatırın. Hücreleri içeren tüm sindirim solüsyonları ve santrifüjiçeren 400 x g'de 15-30 °C'de 5 dk.
    4. 10 mL iPSC ortamdaki süpernatant ve resuspend hücreleri aspire edin. Hücre süspansiyonuna 10 cm'lik yeni bir Petri plakası aktarın ve 37 °C'de 30 dakika kuluçka makinesinde kuluçkaya yatırın.
    5. 30 dakika sonra, kayan hücreleri içeren iPSC ortamını toplayın. Hücre süspansiyonuna 70 μm'lik bir süzgeçten geçirin ve hücre numarasını hesaplayın.
    6. Tohum 5 x 105 hücre kültür çanak daha önce büyümüş OP9-DL1-DL4 hücreleri% 80-90 bir koşul ile adım 1.3.1 açıklandığı gibi.
      NOT: T hücre farklılaşması için, her 2-3 gün, iPSC kaynaklı hücrelerin OP9-DL1-DL4 hücrelerinin taze bir tabaka ile yeniden tohum gerekir.
  4. Değerlendirme
    1. Ayırıcı iPSC'lerin morfolojik değişiklikleri
      1. Çeşitli günlerde mikroskop altında hücreleri gözlemleyin.
        NOT: 5. gün koloniler mezoderm benzeri özelliklere sahiptir, insan dermal fibroblastlarını andıran klasik bir mil şeklinde morfoloji ve in vitro büyüme yi öngösterirler. 8. gün, küçük yuvarlak hücre kümeleri görünmeye başlar.
    2. Akış sitometrisi ile iPSC'lerin farklılaştırıcı analizi
      1. Eş kültürün çeşitli günlerinde, daha önce açıklandığı gibi iPSC kaynaklı hücreleri analiz25 (Şekil 1B,C).
    3. Ayırıcı iPSC'lerin fonksiyonel analizi
      1. Ortak kültürün 28. gününde, yüzen hücreleri hasat ederek kültürlerden iPSC-CD8+ T hücreleri toplamak, kalan hücreleri %0,25 tripsin ile denemek, iPSC ortamının 8 mL'sinde yeniden askıya almak, 15-30 °C'de 400 x g'de 5 dk santrifüj, ortamı kaldırmak, sonra 10 mL'lik ortamdaki hücreleri yeniden askıya alın.
      2. Yeniden asılı hücreleri 30 dakika boyunca 37 °C'lik bir kuluçka makinesinde 10 cm'lik taze bir tabakta tutun ve yüzen hücreleri birleştirin. Sonra hücreleri soğuk bir PBS ile bir kez durulayın.
      3. Incubate 3 x 106 T hücre tükenmiş splenositler (CD4-CD8-) H-2 sınıf I nakavt dalak, HLA-A2.1-transgenik (HHD) fareler 5 μM s183 peptid (FLLTRILTI) 200 μL medya 4 ° C için 30 dakika.
      4. s183 peptid (T hücreleri: splenosit = 1:4; 0.75 x 106 T hücreleri kullanın) ile darbeli splenositler ile iPSC-CD8+ T hücrelerinin bir karışımını üretin. 37 °C'deki hücrelerin karışımını 40 saat boyunca co2 kuluçka makinesinde kuluçkaya yatırın. Son 7 saat boyunca, hücre aktivasyonu sırasında taşıma işlemlerini engellemek için kültüre 4 μL seyreltilmiş brefeldin A ekleyin (1x kültür medyasında seyreltilecek olan 1000x'in son konsantrasyonu).
      5. Hücreleri lekeleyin ve daha önce açıklandığı gibi hücre içi IFN-γ'ın akış sitometrik analizini yapın (Şekil 2).

2. HBV plazmidin hidrodinamik teslimatı ile HBV replikasyonunun indüksiyonu

NOT: pAAV/HBV1.2 yapısı daha önce açıklandığı gibi oluşturuldu9. HBV 1.2 komple DNA vektör pAAV dahil edilmiştir.

  1. Kuyruk damarı ile HBV plazmid hidrodinamik teslimatları
    1. Isı HHD fareler kuyruk damarı dilate için kafeste 5 dakika için bir ısı lambası kullanarak.
    2. Bir dizginleyici ile hayvan gözaltına ve% 70 etanol sprey ile fare kuyrukları temiz.
    3. Karaciğere plazmid uy.
    4. Bir ölçüm ölçeği kullanarak fare nin gövde ağırlığını ölçün.
    5. Vücut kütlesi PBS'nin %8 eşdeğerinde 10 μg HBV plazmid seyreltin (örn. 20 g fare için 1,6 mL). 26 G × 12" (0,45 × 12 mm) hipodermik iğne ile 3 mL şırınga da seyreltilmiş plazmid yükleyin.
    6. Kuyruğun orta üçte iki lateral kuyruk damarlarından birini bulun ve iğneyi her iki lateral vene yerleştirin. 3 - 5 s içinde kuyruk ven yoluyla HBV plazmid içeren enjeksiyon uyguluyor.
  2. Enfekte farelerin kan serumundan viremin in sayısallaştırılması
    NOT: HBV replikasyonu fare serumunda 3-35 gün arasında gerçekleşir. DNA replikasyonu 7. HBV DNA'sı 35.
    1. Enfekte farelerden kan serumu toplanması
      1. Her fareden 3, 5, 7 ve 10 gün sonra 1,5 mL mikrosantrifüj tüpte retro-orbital kanama ile mikrosentrifüge tüpünde yaklaşık 0,1 mL kan toplayın, ardından 20 dakika boyunca oda sıcaklığında (RT) kuluçkaya yatırın.
      2. Numuneyi 4 °C'de 15 dakika boyunca 6.000 x g'de santrifüj edin ve santrifüjden sonra serum supernatant'ı toplayın.
    2. Üreticinin tavsiyelerine uygun olarak, ticari olarak kullanılabilen BIR DNA çıkarma kiti kullanarak kan serumundaki DNA'yı arındırın. Kısaca, silika tabanlı bir sütundaki hücreleri lyse, yıkar gerçekleştirmek ve elüsülasyon sütununa% 100 etanol ekleyerek DNA ayıklamak ve 6000 x g 1 dk. RNase içermeyen su 50 μL DNA elute.
    3. Gerçek zamanlı PCR analizi için elüsyondan 100 ng HBV DNA kullanın. Aşağıdaki astar ve probları kullanın: ileri 5' TAGGAGGCTGTAGGCATAAATTGG 3'; ters 5' GCACAGCTTGGAGGCTTGT 3'; sonda 5' TCACCTCTGCCTAATC 3'.
      1. Standart eğri için plazmid (pAAV/HBV1.2) içeren HBV genomunu kullanın ve toplam 10 μL hacimde gerçek zamanlı PCR gerçekleştirin(Şekil 3).
    4. PCRreaksiyonu Tablo 1'de gösterildiği gibi toplam 10 μL hacimde ayarlayın.
    5. PcRprogramını Tablo 2'de gösterildiği gibi termocycler'da ayarlayın. Programlanmış sıcaklık geçiş hızı denatürasyon/tavlama için 20 °C/s, uzatma için 5 °C/s'dir. Gerçek zamanlı PCR izleme için her döngü için annealing aşamasının sonundafloresanölçer ölçün.

3. Viral Ag-spesifik iPSC-CD8+ T hücrelerinin ACT ile HBV replikasyonunun azaltılması

  1. Benimseyen hücre transferi (ACT)
    1. Bölüm 1.3'te açıklandığı gibi 8 gün boyunca mFlt-3L ve mIL-7 varlığında OP9-DL1-DL4 stromal hücreleri üzerine s183/iPSC'leri (1.3.7) ayırt edin.
    2. 22. günde, 10 cm'lik tabaktan trypsin ile iPSC-CD8+ T hücreleri toplayın, ardından 10 mL taze ortamda her 10 cm'lik plakayı yıkayın ve yeniden askıya alın. Hücreleri 10 cm'lik taze bir tabağa ekleyin ve bölüm 1.3'te yapıldığı gibi 30 dk boyunca kuvöze dönün. 30 dakika sonra, yüzen hücreleri toplamak.
    3. Hücre kümelerini ortadan kaldırmak ve hücre numarasını saymak için hücreleri geçirmek için 70 μm naylon süzgeç kullanın. Hücreleri soğuk PBS çözeltisinde 1,5 x 107 hücre/mL konsantrasyonuna uyarlayın ve gerekirse hücre kümelerini tekrar ortadan kaldırmak için hücreleri geçirmek için 70 μm naylon süzgeç kullanın. ACT kadar buz hücreleri tutun.
    4. Kuyruk damarından 4-6 haftalık HHD farelere 200°L hücre süspansiyonu (3 x 106 hücre) enjekte edin.
  2. HBV replikasyonunun indüksiyonu
    1. Hücre transferinden sonraki 14.
  3. Enfekte karaciğerden virüs protein iması
    1. 3, 5, 7, 14 ve 21 enfeksiyon sonrası fareleri kurban edin. Ötenazi için, her kafeste, ilk aşamada 1-2 L karbondioksit (CO2)kullanın. Hayvan bilinç kaybı geliştirdiğinde, 4-5 L/dk civarında CO2 akış hızı kazanın. CO2 inhalasyon kullanarak fare ötenazisini yapın.
    2. Makas ve forceps kullanarak periton yüzey deri keserek karaciğer ayırın ve biraz geri periton boşluğu astar iç deri ortaya çıkarmak için karaciğer sürükleyerek. Enfekte farelerin karaciğer örneklerini toplayıp kesin (uzunluk x genişliği x yüksekliği = 0,5 cm x 0,3 cm) katıştırma kasetine kolayca sığdırın ve 4-24 saat boyunca %10 nötr tampon formalini bloke edin.
    3. 2,5 M formik asit kullanarak karaciğer örneklerini dekalsite; ksilenin içinde 3 dakika durulayın, %100 etanolde 2x durulayın, %95 etanolde 2x durulayın, 2 dakika deiyonize (DI) suda 2 x durulayın, sonra 1 mM etilenediaminetetraasetik asit (EDTA) ile karaciğer örneklerini dekalsify. 20 dk. alt kaynama sıcaklığında (90 °C) tutun.
    4. 30 dk. 1x PBS ile 4 dakika boyunca sabit karaciğer dokuları serin ve parafin dokuları gömmek. Su yerine etanol artan konsantrasyonları bir dizi dokuları dehydrate, ve sonra ksilen daldırma batırmak. Sızmış dokuları balmumu bloklara gömün. Boyama için eşit dikey ve yatay kesit olun. Sürgülü bir mikrotom ile 4 μm kesitler hazırlayın.
    5. Ksilen ve etanol kullanarak deparafinizasyon ve rehidrasyon yoluyla bölümleri geçirin, sonra bölümlerin immünofloresan boyama gerçekleştirmek.
    6. 200 μL HBV yüzeyag spesifik antikor (bloklama çözeltisinde 1:100 seyreltme) ile kesitleri lekele. %75-%100 nemlendirilmiş bir haznede RT'de 2 saat antikor içeren bölümleri kuluçkaya yatırın ve 5 dakika boyunca 1x PBS'de 5 x yıkayın.
    7. Slaytları boyamak için nükleer boyama için 4',6-diamidino-2-fenilindole (DAPI) içeren bir anti-fade reaktif kullanın. Seyreltilmiş DAPI boyama çözeltisinin yaklaşık 300 μL'si (1x PBS'de 300 nM) ile coverslip'i ekleyin ve kapsanan tüm kapak kaymasını doğrulayın. Floresan mikroskop altında incelene kadar slaytları 4 °C'de karanlıkta tutun.
  4. Enfekte farelerde inflamatuar hücre infiltrasyonu
    1. 3.3.1.'de açıklandığı gibi fareleri kurban edin. Karaciğer toplamak ve adım 3.3.4 açıklandığı gibi bölümleri yapmak.
    2. İnflamatuar hücrelerin karaciğere infiltrasyonunun değerlendirilmesi için hematoksilin ve eozin (H&E) ile kesiti lekeleyin.
    3. Slaytları 4 °C'de floresan mikroskop altında daha fazla analiz edinekadar karanlıkta saklayın.
    4. İnflamatuar hücrelerin karaciğere infiltrasyonlarını tespit etmek için floresan mikroskop altında slaytlarıgörselleştirin (Şekil 4).
  5. Enfekte karaciğerHBV DNA tespiti
    1. Viral DNA'nın izole edilmesi.
    2. Ötenazi fareler ve bölüm 3.3 göre karaciğer örnekleri toplamak.
    3. Nonindet P-40 (NP-40) lysis tampon (50 mM Tris-HCL, 1 mM EDTA, 1% NP-40) bir proteaz inhibitör kokteyl içeren karaciğer dokuları Lyse.
    4. Çekirdekleri ve hücre enkazkaldırmak için 16.000 x g kısaca santrifüj.
    5. Mikrokokal nükleaz (nükleaz S7; 150 birim/mL) ve CaCl2 (5 mM) ile 37 °C'de 90 dk'da nükleokapsidlerin (NC) dışındaki nükleik asidi alçaltmak için sitoplazmik lysate'yi kuluçkaya yatırın.
    6. 10 mM EDTA ilavesi ile s7 nükleazını inaktive edin.
    7. Nükleokapsidleri polietilen glikol (PEG) ile çökeltin, %0,5 sodyum dodecil sülfat (SDS) ile bozun ve 0,6 mg/mL proteinaz K (PK) ile 37 °C'de 1 saat boyunca sindirin.
    8. Fenol kloroform ekstraksiyon ve etanol yağış ile viral nükleik asitleri kurtarmak.
    9. Çıkarılan viral DNA'yı %1,2'lik agarose jelüzerinde çözün ve standart Güney leke analizi ile32 P etiketli HBV DNA sondası kullanarak tespit edin.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Burada gösterildiği gibi, HBV viral Ag-spesifik iPSC-CD8+ T hücreleri in vitro kültür sistemi tarafından oluşturulur. Bu viral Ag-spesifik iPSC-CD8+ T hücrelerinin ACT sonra önemli ölçüde bir murine modelinde HBV replikasyon bastırmak(Ek Dosya 1). Fare iPSC bir insan-fare hibrid HBV TCR geni kodlama MIDR retroviral yapı ile transdükmen edilir (HBs183-191-spesifik, s183), sonra gen-transdükse iPSC'ler notch ligands (hem DL1 ve DL4) ifade OP9-DL1/DL4 hücreleri ile eş kültürlü rFlt3L ve rIL-7 varlığında moleküller. In vitro co-culture'un 28. CD3+CD8+ popülasyonunun akış sitometrik analizi HBV TCR transdüksiyonunun viral s183'e özgü CD8+ T hücrelerinin oluşumunu önemli ölçüde artırdığını göstermektedir (Şekil 1).

In vitro co-culture'un 28. iPSC-CTL'ler, hücre içi boyama veya ELISA ile tespit edilen büyük miktarlarda IL-2 ve IFN-Υ üretirler (Şekil 2). HBV enfeksiyonu HLA-A2.1 transgenik (HHD) farelerde 10 μg pAAV/HBV1.2 DNA plazmidinin fare kuyruk damarlarından hidrodinamik enjeksiyonile indüklenir. HHD farelerinin serumunda 3-21 gün arasında HBV replikasyonu saptandı. DNA replikasyonu 6.

ACT'den iki hafta sonra farelere hidrodinamik pAAV/HBV1.2 DNA plazmidenjeksiyonu yapılır. Viral titre enjeksiyondan sonra çeşitli zaman noktalarında serumdan gerçek zamanlı PCR ile ölçülür. Sonuçlar, hbv viral Ag-spesifik T hücreleri alan farelerde viral replikasyonun kontrol hücreleri alan farelere göre tüm zaman noktalarında önemli ölçüde azaldığını göstermektedir(Şekil 4A). HBV yüzey protein ekspresyonu da tedavinin yukarıdaki ayarında karaciğerde incelenir. Fareler HBV enjeksiyonundan sonraki çeşitli günlerde ötenazi yetirilir ve karaciğer örnekleri histolojik inceleme için izole edilir. Örnekler HBV yüzey proteini için boyanmış ve floresan mikroskobu altında incelenir. HBV yüzey proteini, hbv viral Ag-spesifik pre-iPSC-CTLalan farelerde, kontrol hücreleri alan farelerle karşılaştırıldığında önemli ölçüde azalmış olarak gözlenmiştir(Şekil 4B). Bu deney, viral Ag-spesifik iPSC-CD8+ T hücrelerinin murine modelinde HBV replikasyonlarını azaltma yeteneğine sahip olduğunu açıkça göstermektedir.

Figure 1
Şekil 1: HBV viral Ag-spesifik iPSC-CD8+ T hücrelerinin üretimi.
Fare iPSC'leri aşağıdaki retroviral yapılarla transeedilir: HBs183-91 TCR (MiDR-s183 TCR) veya OVA257-264 TCR (MiDR-OVA TCR) ve transduced iPSC'ler T soy farkı için OP9-DL1/DL4 stromal hücreleri ile eş kültürlüdür. (A) Retroviral yapı Nın şematik gösterimi MiDR-s183 TCR'nin s183-spesifik TCR'yi ifade eder. = ambalaj sinyali; 2A = picornavirus self-cleaving 2A dizisi; LTR = uzun terminal tekrarları. (B) 0, 7, 14 ve 22. (C) 28. CD3+CD8+ hücreleri (solda) belirtildiği gibi geçitli ve CD8 ve TCRVβ28 (sağda) ifadesi için analiz edilir. Gösterilen veriler üç ayrı deneyi temsil eder. Değerler ± SD (**p < 0.01; eşleştirilmiş t-testleri) anlamına gelir. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 2
Şekil 2: HBV viral Ag-spesifik iPSC-CD8+ T hücrelerinin fonksiyonel analizi.
In vitro co-culture'un 28. MiDR-s183 TCR ile transeksed iPSC-T hücreleri ve CD8+ T hücreleri HHD farelerden T-tükenmiş splenositler (AAP) tarafından uyarılır ve s183 peptid (FLLTRILTI) ile darbeli. (A) 7 saat sonra IFN-Υ hücre içi boyama (CD8+ hücrelerde kapılı) (T/AAP = 1:4). (B) 40 s. Gösterilen veriler den sonra IFN-γ'ın ELISA'sı üç ayrı deneyi temsil eder. Değerler ± SD (n.s., p > 0.05; eşleştirilmiş t-testleri) anlamına gelir. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 3
Şekil 3: HHD farelerinde HBV replikasyonunun hidrodinamik enjeksiyon ile indüksiyonu.
HHD fareler hidrodinamik kuyruk ven enjeksiyonu ile HBV plazmid ile i.v. administrated vardır. Plazmidin 10 μg toplam vücut kütlesi PBS% 8 ile enjekte edilir. Enjeksiyondan sonra belirtilen zaman noktalarında serum kandan izole edilir ve DNA gerçek zamanlı PCR için çıkarılır. Gösterilen veriler üç ayrı deneyi temsil eder. Değerler ortalama ± SD. Veri üç bağımsız deney grubu başına beş fare yi temsileder. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 4
Şekil 4: Viral Ag-spesifik iPSC-CD8+ T hücrelerinin ACT ile HBV replikasyonunun azaltılması.
HHD fareler i.v. viral Ag-spesifik iPSC-CD8+ T hücre ataları ile (in vitro kültürün 22. gününde) transfer edilir ve hücre transferinden sonra 2. (A) Serum HBV kopyaları. Enjeksiyondan sonra belirtilen zaman noktalarında serum kandan izole edilir ve GERÇEK Zamanlı PCR analizi için DNA çıkarılır. Gösterilen veriler üç ayrı deneyi temsil eder. Değerler ± SD. (B) Karaciğer doku histolojisi anlamına gelir. Fareler 8 gün sonrası HBV enfeksiyonunda ötenazi yapılır. Karaciğer örnekleri histolojik inceleme için izole edilir ve lekelenir. Üst panel enfekte farelerde HBsAg protein ekspresyonunu gösterir (IHC boyama) ve alt panel inflamatuar hücre infiltrasyongösterir (HE-boyama). Veriler, üç bağımsız deneyden oluşan grup başına beş fareyi temsil eder. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

DNA şablonu 2 ml
DNA ana hibridizasyon karışımı ((Taq DNA polimeraz, PCR reaksiyon tamponu, 10 mM MgCl2 ve dNTP karışımı) 1 ml
25 mM MgCl2 0,8 ml
Prob 0.3 μM 3 ml
Her astar5 μM 3.2 ml
Toplam 10 ml

Tablo 1: PCR reaksiyon hacmi

Sıcaklık Zaman
Denatürasyon 95 °C 5 s
Tavlama 53 °C 10 s
Uzantısı 72 °C 20 s
5 °C

Tablo 2: PCR programı

Ek Dosya 1: Bu dosyayı indirmek için lütfen buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bu protokol, bir murine modelinde HBV replikasyonlarını bastırmak için ACT olarak kullanılmak üzere viral Ag-spesifik iPSC-CTLs oluşturmak için bir yöntem sunar. Kronik HBV enfeksiyonunda viral genom kararlı bir mini kromozom oluşturur, hepatositin ömrü boyunca devam edebilen kovalent kapalı dairesel DNA (cccDNA). Viral mini kromozomun temizlenmesinin hedeflanması kronik HBV enfeksiyonunun tedavisine neden olabilir. Mevcut antiviral tedavi virüsün ters transkriptazını hedefler ancak nadiren cccDNA tarafından yönlendirilen HBV replikasyonu üzerinde immünolojik kontrol sağlar. HBV'ye özgü CD8+ CTL'ler enfekte hepatositlerin öldürülmesine aracılık edebilir ve cccDNA'nın temizlenmesini hızlandırabilir. Bununla birlikte, HBV'ye özgü CtL'ler silinir, işlevsizdir veya kronik HBV enfeksiyonu olan hastalarda bitkinlik giderilir. HBV'ye özgü CtL'ler ile ACT kronik HBV enfeksiyonu için uygun bir tedavi dir28,29. Naif veya merkezi bellek T hücre türetilmiş T lenfositler (yani, son derece reaktif bağışıklık hücreleri) ACT tabanlı tedaviler için ideal etkileri onların büyük çoğalması nedeniyle, ölümcül farklılaşmış hücrelere göre ölüm için daha düşük eğilim, ve mükemmel homeostatik sitokinlere yanıt verebilme yeteneği. Ancak, bu tür ACT genellikle hastalardan CTLs yeterli sayıda elde zorlukları nedeniyle mümkün olmamıştır. Daha önce iPSCs Ag-spesifik CTLs veya Tregs yeniden programlama hücre tabanlı tedaviler için kullanılabilir gösterilmiştir20,23,27,30. Bu rapor viral Ag-spesifik iPSC-CTLs oluşturmak ve HBV replikasyonu bir murine modelinde ACT tabanlı immünoterapi için bu hücreleri kullanmak için bir yöntem göstermektedir.

HBV replikasyonunun transgenik fare modelleri olmasına rağmen, transgenik gen ürünlerinin indüklediği merkezi tolerans farelerin HBV Ags'e karşı bağışıklık toleranslı olmasına neden olduğu için bu modeller zordur. Ayrıca, tümleşik HBV genomu her fare hücresinde31,32olarak devam ettikçe transgenik fareler viral açıklık izlemek için uygun değildir. Ayrıca, başarılı aşılar enfeksiyonu önlemek için geliştirilmiş olmasına rağmen, HBV enfeksiyonu sonrası tedavi veya immünoterapi geliştirilmemiştir. Ayrıca HBV patogenezine yönelik deneysel yaklaşımlar engellenmiştir, çünkü HBV enfeksiyonunun konak aralığı erkekler ve şempanzelerle sınırlıdır ve HBV'nin yayılması için in vitro kültür sistemi yeterli değildir. CD8+ T hücreleri viral enfeksiyon çeşitli karşı verici etki hücreleri vardır; ancak HBV'ye karşı T hücre yanıtı çok fazla değildir. Özgüllük, işleyişi ve bağışıklık yanıtı monte etmek için yeterli sayıda eksikliği neden olabilir. Bu rapor, farelerde HBV replikasyonuetkin bir şekilde indükleyen hidrodinamik enjeksiyon yöntemini ortaya koymaktadır. Bu yöntem, büyük miktarda HBV plazmidindoğrudan karaciğere ulaştırılmasını sağlar. Model, enjeksiyondan sonraki farklı günlerde HBV mRNA, protein ve DNA tespiti ile 8 haftadan uzun süre sürekli viremi sergiler. Farelerde HBV replikasyonu için bu yöntem HBV immünoterapi için yararlıdır.

Özetle, hidrodinamik enjeksiyon prosedürü ile farelerde HBV replikasyonu başarıyla indüklendi ve HBV replikasyonu için immünoterapi olarak viral Ag-spesifik iPSC-CTLs kullanıldı. Ancak, yöntemin iki sınırlaması vardır: (1) üç haftadan fazla in vitro T hücre farklılaşması ACT için oluşturulan T hücrelerinin çeviri uygulamalarını azaltabilir; ve (2) HBV hidrodinamik enjeksiyon verimli karaciğerde HBV replikasyon neden olabilir; ancak, kalıcı HBV enfeksiyonunun ana nedeni olan cccDNA'yı oluşturmaz. Bununla birlikte, yöntem HBV replikasyonu ve tedavisi için alternatif bir yaklaşım sağlar. Anti-HBV ilaçlar ve viral Ag-spesifik iPSC-CTLs ACT kullanarak bir kombinasyon rejimi HIV rezervuarları azaltmak için muhtemeldir, bu nedenle kronik HIV enfeksiyonu için bir tedavi ile sonuçlanan.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarların açıklayacak bir şeyi yok.

Acknowledgments

Yazarlar HBs183-91 (s183) (FLLTRILTI) için cDNA sağlamak için Toronto Genel Hastanesi Araştırma Enstitüsü'nden Dr Adam J Gehring teşekkür- özel A2-sınırlı insan-murine hibrid TCR genleri, ve Dr Pei-Jer Chen Ulusal Tayvan Üniversitesi sağlamak için pAAV/HBV 1.2 yapısı. Bu çalışma Ulusal Sağlık Enstitüsü Hibe R01AI121180, R01CA221867 ve R21AI109239 J. S tarafından desteklenmiştir.

Materials

Name Company Catalog Number Comments
HHD mice Institut Pasteur, Paris, France H-2 class I knockout, HLA-A2.1-transgenic (HHD) mice
iPS-MEF-Ng-20D-17 RIKEN Cell Bank APS0001
SNL76/7 ATCC SCRC-1049
OP9 ATCC CRL-2749
pAAV/HBV1.2 plasmid Dr. Dr. Pei-Jer Chen (National Taiwan University Hospital, Taiwan) HBV DNA construct
HBs183-91(s183) (FLLTRILTI)-specific TCR genes Dr. Adam J Gehring (Toronto General Hospital Research Institute, Toronto, Canada) FLLTRILTI-specific A2-restricted human-murine hybrid TCR genes (Vα34 and Vβ28)
OVA257–264-specific TCR genes Dr. Dario A. Vignali (University of Pittsburgh, PA) SIINFEKL-specific H-2Kb-restricted TCR genes
Anti-CD3 (17A2) antibody Biolegend 100236
Anti-CD44 (IM7) antibody BD Pharmingen 103012
Anti-CD4 (GK1.5) antibody Biolegend 100408
Anti-CD8 (53-6.7) antibody Biolegend 100732
Anti-IFN-γ (XMG1.2) antibody Biolegend 505810
Anti-TNF-a (MP6-XT22) antibody Biolegend 506306
α-MEM Invitrogen A10490-01
Anti-HBs antibody Thermo Fisher MA5-13059
ACK Lysis buffer Lonza 10-548E
Brefeldin A Sigma B7651
DMEM Invitrogen ABCD1234
FBS Hyclone SH3007.01
FACSAria Fusion cell sorter BD 656700
Gelatin MilliporeSigma G9391
GeneJammer Agilent 204130
HLA-A201-HBs183-91-PE pentamer Proimmune F027-4A - 27
HRP Anti-Mouse Secondary Antibody Invitrogen A27025
mFlt-3L Peprotech 250-31L
mIL-7 Peprotech 217-17
Nuclease S7 Roche 10107921001
Paraformaldehyde MilliporeSigma P6148-500G Caution: Allergenic, Carcenogenic, Toxic
Permeabilization buffer Biolegend 421002
Polybrene MilliporeSigma 107689
ProLong™ Gold Antifade Mountant with DAPI Invitrogen P36931
QIAamp MinElute Virus Spin Kit Qiagen 57704

DOWNLOAD MATERIALS LIST

References

  1. Scaglione, S. J., Lok, A. S. Effectiveness of hepatitis B treatment in clinical practice. Gastroenterology. 142, (6), 1360-1368 (2012).
  2. Osiowy, C. From infancy and beyond... ensuring a lifetime of hepatitis B virus (HBV) vaccine-induced immunity. Human Vaccines & Immunotherapeutics. 14, (8), 2093-2097 (2018).
  3. Gish, R. G., et al. Loss of HBsAg antigen during treatment with entecavir or lamivudine in nucleoside-naive HBeAg-positive patients with chronic hepatitis B. Journal of Viral Hepatitis. 17, (1), 16-22 (2010).
  4. Kurktschiev, P. D., et al. Dysfunctional CD8+ T cells in hepatitis B and C are characterized by a lack of antigen-specific T-bet induction. Journal of Experimental Medicine. 211, (10), 2047-2059 (2014).
  5. Fisicaro, P., et al. Antiviral intrahepatic T-cell responses can be restored by blocking programmed death-1 pathway in chronic hepatitis B. Gastroenterology. 138, (2), 682-693 (2010).
  6. Schurich, A., et al. The third signal cytokine IL-12 rescues the anti-viral function of exhausted HBV-specific CD8 T cells. PLoS Pathogens. 9, (3), 1003208 (2013).
  7. Gehring, A. J., et al. Engineering virus-specific T cells that target HBV infected hepatocytes and hepatocellular carcinoma cell lines. Journal of Hepatology. 55, (1), 103-110 (2011).
  8. Xia, Y., et al. Interferon-gamma and Tumor Necrosis Factor-alpha Produced by T Cells Reduce the HBV Persistence Form, cccDNA, Without Cytolysis. Gastroenterology. 150, (1), 194-205 (2016).
  9. Huang, L. R., Wu, H. L., Chen, P. J., Chen, D. S. An immunocompetent mouse model for the tolerance of human chronic hepatitis B virus infection. Proceedings of the National Academy of Sciences U.S.A. 103, (47), 17862-17867 (2006).
  10. Wong, P., Pamer, E. G. CD8 T cell responses to infectious pathogens. Annual Review of Immunology. 21, 29-70 (2003).
  11. Murray, J. M., Wieland, S. F., Purcell, R. H., Chisari, F. V. Dynamics of hepatitis B virus clearance in chimpanzees. Proceedings of the National Academy of Sciences USA. 102, (49), 17780-17785 (2005).
  12. Hinrichs, C. S., et al. Adoptively transferred effector cells derived from naive rather than central memory CD8+ T cells mediate superior antitumor immunity. Proceedings of the National Academy of Sciences U.S.A. 106, (41), 17469-17474 (2009).
  13. Hinrichs, C. S., et al. Human effector CD8+ T cells derived from naive rather than memory subsets possess superior traits for adoptive immunotherapy. Blood. 117, (3), 808-814 (2011).
  14. Kerkar, S. P., et al. Genetic engineering of murine CD8+ and CD4+ T cells for preclinical adoptive immunotherapy studies. Journal of Immunotherapy. 34, (4), 343-352 (2011).
  15. Kuball, J., et al. Facilitating matched pairing and expression of TCR chains introduced into human T cells. Blood. 109, (6), 2331-2338 (2007).
  16. van Loenen, M. M., et al. Mixed T cell receptor dimers harbor potentially harmful neoreactivity. Proceedings of the National Academy of Sciences USA. 107, (24), 10972-10977 (2010).
  17. Cameron, B. J., et al. Identification of a Titin-derived HLA-A1-presented peptide as a cross-reactive target for engineered MAGE A3-directed T cells. Science Translational Medicine. 5, (197), (2013).
  18. Fedorov, V. D., Themeli, M., Sadelain, M. PD-1- and CTLA-4-based inhibitory chimeric antigen receptors (iCARs) divert off-target immunotherapy responses. Science Translational Medicine. 5, (215), (2013).
  19. Maus, M. V., et al. T cells expressing chimeric antigen receptors can cause anaphylaxis in humans. Cancer Immunolology Research. 1, (1), 26-31 (2013).
  20. Haque, R., et al. Programming of regulatory T cells from pluripotent stem cells and prevention of autoimmunity. Journal of Immunology. 189, (3), 1228-1236 (2012).
  21. Vizcardo, R., et al. Regeneration of human tumor antigen-specific T cells from iPSCs derived from mature CD8(+) T cells. Cell Stem Cell. 12, (1), 31-36 (2013).
  22. Nishimura, T., et al. Generation of rejuvenated antigen-specific T cells by reprogramming to pluripotency and redifferentiation. Cell Stem Cell. 12, (1), 114-126 (2013).
  23. Lei, F., et al. In vivo programming of tumor antigen-specific T lymphocytes from pluripotent stem cells to promote cancer immunosurveillance. Cancer Research. 71, (14), 4742-4747 (2011).
  24. Kim, J. B., et al. Oct4-induced pluripotency in adult neural stem cells. Cell. 136, (3), 411-419 (2009).
  25. Lei, F., Haque, R., Xiong, X., Song, J. Directed differentiation of induced pluripotent stem cells towards T lymphocytes. Journal of Visualized Experiments. (63), e3986 (2012).
  26. Lei, F., Haque, M., Sandhu, P., Ravi, S., Ni, Y., Zheng, S., Fang, D., Jia, H., Yang, J. M., Song, J. Development and characterization of naive single-type tumor antigen-specific CD8+ T lymphocytes from murine pluripotent stem cells. OncoImmunology. 6, (2017).
  27. Haque, M., et al. Melanoma Immunotherapy in Mice Using Genetically Engineered Pluripotent Stem Cells. Cell Transplantation. 25, (5), 811-827 (2016).
  28. Tan, A. T., et al. Use of Expression Profiles of HBV DNA Integrated Into Genomes of Hepatocellular Carcinoma Cells to Select T Cells for Immunotherapy. Gastroenterology. (2019).
  29. Wu, L. L., et al. Ly6C(+) Monocytes and Kupffer Cells Orchestrate Liver Immune Responses Against Hepatitis B Virus in Mice. Hepatology. (2019).
  30. Haque, M., et al. Stem cell-derived tissue-associated regulatory T cells suppress the activity of pathogenic cells in autoimmune diabetes. Journal of Clinical Investigation Insights. (2019).
  31. Chisari, F. V., et al. Structural and pathological effects of synthesis of hepatitis B virus large envelope polypeptide in transgenic mice. Proceedings of the National Academy of Sciences USA. 84, (19), 6909-6913 (1987).
  32. Wirth, S., Guidotti, L. G., Ando, K., Schlicht, H. J., Chisari, F. V. Breaking tolerance leads to autoantibody production but not autoimmune liver disease in hepatitis B virus envelope transgenic mice. Journal of Immunology. 154, (5), 2504-2515 (1995).
Kök Hücre Kaynaklı Viral Ag-Spesifik T Lenfositler Farelerde HBV Replikasyonlarını Baskılar
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).More

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter