Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

줄기 세포 유래 바이러스 Ag 특이적 T 림프구는 마우스에서 HBV 복제를 억제

doi: 10.3791/60043 Published: September 25, 2019

Summary

여기에 제시된 것은 줄기세포 유래 바이러스 항원(Ag)-특이적 T 림프구의 입양세포 전달(ACT)을 이용하여 마우스에서 B형 간염 바이러스(HBV) 복제의 효과적인 억제를 위한 프로토콜이다. 이 절차는 HBV 감염의 잠재적인 ACT 기지를 둔 면역 요법을 위해 적응될 수 있습니다.

Abstract

B형 간염 바이러스 (HBV) 감염은 글로벌 건강 문제입니다. 전 세계적으로 3억 5천만 명 이상이 영향을 받은 HBV 감염은 간암의 주요 원인으로 남아 있습니다. 이것은 특히 개발도상국에서 주요 관심사입니다. HBV에 대하여 효과적인 반응을 탑재하는 면역 계통의 실패는 만성 감염으로 이끌어 냅니다. HBV 백신이 존재하고 새로운 항 바이러스 의약품이 생성되고 있지만, 바이러스 저수지 세포의 박멸은 주요 건강 주제로 남아 있습니다. 여기서 기재된 바이러스 항원(Ag)-특이적CD8+세포독성 T 림프구(CTL)의 생성을 위한 방법은 유도된 만능 줄기 세포(iPSCs)(즉, iPSC-CTL)로부터 유래되며, 이는 HBV 복제를 억제하는 능력을 갖는다. HBV 복제는 HBV 발현 플라스미드, pAAV/HBV1.2의 유체역학적 주입을 통해 마우스에서 효율적으로 유도되며, 간으로 유도된다. 이어서, HBV 표면 Ag 특이적 마우스 iPSC-CTL은 입양적으로 전달되어 간 및 혈액에서의 HBV 복제를 크게 억제할 뿐만 아니라 간세포에서 HBV 표면 Ag 발현을 방지한다. 이 방법은 유체역학적 주입 후 마우스에서 HBV 복제를 입증하고 줄기 세포 유래 바이러스 Ag-특이적 CTLs가 HBV 복제를 억제할 수 있음을 보여준다. 이 프로토콜은 HBV 면역 요법에 유용한 방법을 제공한다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

급성 감염 에 이어, 적응 면역 체계 (즉, 체액성 및 세포 면역)는 급성 HBV 관련 간염의 대부분을 제어합니다. 아직도, HBV 풍토성 지구에 있는 사람들의 수는 바이러스를 제거하고 그 후에 만성 개별로 변환할 수 없습니다. 전 세계 만성 환자(>2억 5천만 명)의 25% 이상이 진행성 간 질환을 일으켜 간경변 및/또는 간세포암종(HCC)을 초래합니다1. 그 결과, 고집이 세게 감염된 세포의 박멸은 유효한 백신2가 있고 수많은 항바이러스 약이 개발되고 있더라도 일반적인 건강 문제 남아 있습니다. HBV 감염을 위한 표준 처리는 IFN-α, 뉴클레오시드, 및 뉴클레오티드 유사체를 포함한다. 이 에이전트는 직접적인 항 바이러스 활성 및 면역 조절 용량. 그럼에도 불구하고, HBe 항원(Ag)+담체의 혈청 변환(Ab) 및 혈청 HBV 데옥시리보핵산(DNA)의 손실은 치료된 환자의 약 20%에서 개별적으로 나타나며, 바이러스의 전체 면역학 적 대조군 BBsAg의 박탈에 의해 확인은 더 이상 5 %3입니다. 또한 치료에 대한 반응은 종종 내구성이 없습니다. 재조합 HBs Ag를 가진 예방 백신 접종은 감염 예방에 매우 효과적이지만 치료적 HBs Ag 예방 접종은 효과적이지 않습니다. 명확 하 게, T 세포 매개 면역 반응 HBV 감염 및 간 손상 제어에 중요 한 역; 그러나, 만성 간염 환자에서, HBV 반응성 T 세포는 수시로 삭제됩니다, 역기능, 또는 소모된4,5,6. 따라서, 지속적인 HBV 감염을 가진 개인에서, 항 바이러스 요법, 면역 조절 사이토 카인, 또는 치료 예방 접종을 통해 HBV 특이적 면역 (즉, T 세포 기반 면역)을 회복하려는 시도는 성공하지 못했습니다.

HBV Ag 특이적 T 세포의 입양 세포 전달(ACT)은 결국 남은 간세포 wih HBV7,8을박멸하도록 지시된 효율적인 치료법이다. HBV 감염 마우스내의 HBV 특이적 CTLs의 ACT는 간세포에서 과도, 경증 간염 및 HBV 리보핵산(RNA) 전사체의 극적인 하락을 유발하는 것으로 나타났다. 이러한 연구에서 CTL은 HBV 유전자의 전사를 억제하지 는 않았지만 HBV 전사체9의분해를 향상시켰습니다. HBV 특이적 CTL은 바이러스 감염을 방지하고 HBV10,11의클리어런스를 중재하는 데 중요합니다. ACT 기반 요법의 경우, 생체 내 재정착을 위한 높은 반응성을 가진 HBV 특이적 T 세포의 시험관 내 확장은 이상적인 방법12,13,14; 그럼에도 불구하고, 현재의 접근법은 잠재적인 치료를 위해 환자에게서 HBV 특이적 T 세포의 적절한 수량 및 자질을 생성, 분리 및 성장시키는 능력에 관하여 제한됩니다.

임상 시험은 HBV 바이러스 감염 간세포에 특정엔지니어링 T 세포를 통해 세포 기반 치료의 안전성, 실용성 및 장래 치료 활성을 제시하지만, 불리한 효과에 대한 걱정이 있습니다. T 세포 수용체(TCR)15,16,비특이적 TCR17 및 키메라 Ag 수용체에 의한 오프-타겟 오프 독성에 의한 교차 반응성으로 인해 자가면역 반응에서 발생(CAR) 18세 , 건강한 조직19개. 현재, 생체 내에서 단기 지속성만을 가지는 유전자 변형 T 세포는 일반적으로 중간 또는 이후의 이펙터 T 세포이다. 현재까지 다능성 줄기세포(PSC)는 순진한 단일형 Ag-특이적T세포(20,21,22,23)의높은 숫자를 생성할 수 있는 유일한 공급원이다. 유도된 PSCs (iPSCs)는 몇몇 전사 인자의 유전자 전달의 사용을 통해 환자의 체세포에서 단순히 변환됩니다. 그 결과, iPSCs는 배아 줄기 세포(ESCs)24와유사한 특성을 갖는다. 자기 갱신하는 무한한 능력에 대한 유연성과 가능성으로 인해, 조직 교체 이외에, iPSC 기반 치료는 재생 의학에서 널리 적용될 수 있다. 게다가, 근본적인 iPSCs연대는 현재 세포 기지를 둔 치료를 실질적으로 향상할 수 있습니다.

이 방법의 전반적인 목표는 ACT 기반 면역 요법을 위한 iPSC(즉, iPSC-CTL)로부터 다량의 HBV 특이적 CTL을 생성하는 것이다. 대체 기술에 비해 장점은 HBV 특이적 iPSC-CTL이 단일 유형 TCR 및 순진한 표현형을 가지고 있다는 것입니다. HBV 특이적 iPSC-CTL의 ACT는 간에서 기능성CD8+ T 세포의 이동을 증가시키고 투여된 마우스의 간 및 혈액 모두에서 HBV 복제를 감소시킨다는 것이 입증되었다. 이 방법은 HBV 면역 요법을 위한 바이러스 Ag 특이적 iPSC-CTL의 잠재적사용을 밝히고 바이러스 면역요법을 위한 다른 바이러스 성 Ag 특이적 iPSC-T 세포를 생성하도록 적응될 수 있다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

모든 동물 실험은 텍사스 A&M 대학 동물 관리 위원회(IACUC; #2018-0006)의 승인을 받았으며, 실험실 동물 관리 협회의 평가 및 인증 가이드라인에 따라 수행됩니다. 생쥐는 생후 6-9주 동안 사용된다.

1. iPSCs에서 바이러스 성 Ag 특이적 CD8+ T 세포의 생성 (iPSC-CD8+ T 세포)

  1. 레트로바이러스 구조의 창조
    참고: TCR α 및 β 유전자는 2A 자가 절기 서열과 연결됩니다. 레트로바이러스 벡터 MSCV-IRES-DsRed(MiDR)는 DsRed+ 23입니다.
    1. 서브 클론 HBs183-191 (FLLTRILTI)-특이적 A2 제한 인간-뮤린 하이브리드 TCR(s183 TCR) 유전자(Vα34 및 Vβ28)를 MiDR 내로 생성하여 s183 MiDR 구문(도1A)25.
  2. 레트로바이러스 전이
    참고 : 플래티넘-E (Plat-E) 세포는 레트로 바이러스 (운반 s183 TCR 유전자)를 포장하는 데 사용되며, 이는 레트로 바이러스 성 전션에 사용됩니다. Plat-E 세포는 293T 세포의 근간이 되는 효과적인 레트로바이러스 패키징 세포이며, 이는 개그, 폴 및 에코트로픽 을 포함하는 레트로바이러스 구조 단백질을 발현하기 위해 EF1α 프로모터를 통해 독특한 패키징 구성을 통해 개발되었다.
    1. 100 mm 배양 접시상에, 종자 3 x 106 Plat-E 세포를 DMEM 배양 배지의 8 mL에서 10% 태아 송아지 혈청(FCS)을 37°C에서 인큐베이터에서 5%CO2,1일 전에 형질감염 전에 함유한다.
    2. 0일째에, s183 MiDR 생성물을 DNA 형질감염 시약25를사용하여 Plat-E 세포내로 트랜스펙트한다.
    3. 1일째, 종자 1 x 106 iPSCs(GFP+)를젤라틴 사전 코팅 배양 플레이트에 넣는다.
    4. 2-3일, 1,6-디브로모펙산용액(25)의 존재 하에서 s183 TCR을 사용하여 iPSCs를 트랜스듀싱하기 위해 Plat-E 세포 배양으로부터 레트로바이러스 함유 상상을 수집한다.
    5. 4일째에, s183 TCR 유전자 변환 iPSCs, 원심분리기 400 x g에서 5분 동안 및 종자 3× 105 iPSCs를 3 x 106 조사된 SNL76/7(irSNL76/7) 피더셀25로미리 코팅하였다.
    6. 합류의 5 또는 6 일째에, 세포를 트립시니화하고, 400 x g에서 5 분 동안 원심 분리기를 하고 세포 선별을 처리합니다. 고속 세포 선별기를 사용하여 살아있는 세포에 게이팅, 정렬 GFP 및 DsRED 이중 양성 세포 (s183 TCR 유전자 변환 iPSCs). 단계 1.2.5와 유사하게, 향후 사용을 위해 irSNL76/7 피더 셀에 정렬된 세포를 공동배양25.
  3. HBV 특이적 iPSC-CD8+ T 세포의 분화
    참고: OP9-DL1/DL4 기질 세포는 노치 리간드 DL1 및 DL4를 모두 과발현하고, iPSCs와 함께 iPSC를 공동 배양하여 노치 시그널링 매개 T 셀 분화를 촉진할 수있다(26).
    1. 20% 태아 소 혈청(FBS)을 함유하는 α-최소 필수 배지(MEM) 배지에서 OP9-DL1-DL4 세포 단층에서 s183 TCR 유전자-트랜스듀싱 된 iPSCs(s183/iPSCs)를성장시27. 배양물에서 뮤린 Flt3 리간드(mFlt-3L; 최종 농도 =5 ng/mL)를 포함한다.
    2. 0일째에, 종자 0.5-1.0 x 105 S183/iPSCs를 OP9-DL1-DL4 세포로 이전에 재배한 10cm 배양 접시에. OP9-DL1-DL4 셀이 80%-90% 동률 상태인지 확인합니다.
    3. 5일째에, 10 mL의 인산완충식염수(PBS)로 iPSC를 헹구고, PBS를 흡인하고, 이를 0.25% 트립신의 4 mL에 첨가하고, 37°C 인큐베이터에서 10분 동안 인큐베이터에 인큐베이터를 추가한 후, iPSC 매체의 보충 8 mL을 추가하여 트리피통을 종료한다. 15-30 °C에서 5 분 동안 400 x g에서 세포및 원심 분리기를 포함하는 모든 소화 용액을 축적합니다.
    4. iPSC 매체의 10 mL에서 상부 및 재중단 세포를 흡인한다. 세포 현탁액을 새로운 10 cm 페트리 플레이트로 옮기고 37°C에서 30분 동안 인큐베이터에 인큐베이터로 인큐베이터한다.
    5. 30분 후, 부동 세포를 포함하는 iPSC 미디어를 수집한다. 70 μm 셀 스트레이너를 통해 세포 현탁액을 통과시키고 세포 번호를 계산합니다.
    6. 종자 5 x 105 배양 접시에서 이전에 성장한 OP9-DL1-DL4 세포는 단계 1.3.1에 기재된 바와 같이 80%-90% 동시성의 상태를 갖는다.
      참고: T 세포 분화를 위해, 각 2-3일, iPSC 유래 세포는 OP9-DL1-DL4 세포의 신선한 층으로 다시 시드할 필요가 있다.
  4. 평가
    1. 차별화iPSCs의 형태학적 변화
      1. 다양한 날에 현미경으로 세포를 관찰하십시오.
        참고: 5일째까지, 콜로니는 중추와 같은 특성을 가지며, 인간의 진피 섬유아세포와 체외에서 지속적인 성장을 닮은 고전적인 스핀들 모양의 형태를 나타낸다. 8일째가 되면 작은 둥근 세포 클러스터가 나타나기 시작합니다.
    2. 유세포측정에 의한 iPSCs 차별화 분석
      1. 상술한 바와 같이, iPSC 유래 세포를 분석하는 다양한 날에25일(도 1B,C).
    3. 차별화된 iPSCs의 기능 분석
      1. 공동 배양의 28 일째에, 부동 세포를 수확을 통해 배양에서 iPSC-CD8+ T 세포를 수집하고, 0.25 % 트립신으로 남은 세포를 트립시노이즈하고, iPSC 배지의 8 mL에서 다시 중단하고, 15-30 °C에서 400 x g에서 5 분 동안 원심 분리, 미디어를 제거하고, 10 mL의 미디어에서 셀을 다시 일시 중단합니다.
      2. 다시 부유 세포를 37°C 인큐베이터에 신선한 10 cm 접시에 30분 동안 보관하고 부동 세포를 조립한다. 그런 다음 차가운 PBS로 세포를 한 번 헹구고 있습니다.
      3. H-2 클래스I 녹아웃의 비장으로부터 3 x 106 T 세포 고갈 비장(CD4-CD8-)을 배양하고, HLA-A2.1-형질전환(HHD) 마우스를 5 μM s183 펩티드(FLLTRILTI)를 4°C에서 200 μL에서 30분 동안 300°C로 배양하였다.
      4. s183 펩티드로 펄스 된 비장 세포와 iPSC-CD8+ T 세포의 혼합물을 생산 (T 세포 : 비장 세포 = 1:4; 0.75 x 106 T 세포를 사용). CO2 인큐베이터에서 37°C에서 세포의 혼합물을 40시간 동안 배양한다. 마지막 7 시간 동안, 희석 된 brefeldin A 의 4 μL을 배양 (1x 배양 배지에서 희석 될 1,000x의 최종 농도)을 추가하여 세포 활성화 중에 수송 과정을 차단합니다.
      5. 앞서 설명한 바와 같이 세포를 염색하고 세포내 IFN-γ의 유동 세포분석 분석을 수행한다(도2).

2. HBV 플라스미드의 유체 역학 전달을 통한 HBV 복제 유도

참고: pAAV/HBV1.2 구문은 앞서9. HBV 1.2 완전한 DNA는 벡터 pAAV에 통합된다.

  1. 꼬리 정맥을 통해 HBV 플라스미드의 유체 역학 전달
    1. 꼬리 정맥을 팽창시키기 위해 케이지에서 5 분 동안 열 램프를 사용하여 HHD 마우스를 가열합니다.
    2. 동물을 제지하여 억류하고 70 % 에탄올 스프레이로 마우스 꼬리를 청소하십시오.
    3. 간으로 플라스미드의 전달.
    4. 측정 척도를 사용하여 마우스 체중을 측정합니다.
    5. HBV 플라스미드의 10 μg를 체질량 PBS의 8% 상당으로 희석한다(예를 들어, 20 g 마우스의 경우 1.6 mL). 희석된 플라스미드를 26 G × 1°12 "(0.45 × 12 mm) 피하 주사바늘로 3 mL 주사기에 적재하였다.
    6. 꼬리의 중간 3 분의 1에 있는 두 개의 측면 꼬리 정맥 중 하나를 찾아 바늘을 양쪽 정맥에 놓습니다. 3- 5s 내의 꼬리 정맥을 통해 HBV 플라스미드를 함유하는 주사를 투여한다.
  2. 감염된 마우스의 혈액 혈청에서 혈혈의 정량화
    참고: HBV 복제는 마우스 세럼에서 3-35일째부터 발생합니다. DNA 복제는 7일째에 정점에 이르고 점차적으로 감소합니다. HBV DNA는 35일까지 혈청에서 삭제되지 않습니다.
    1. 감염된 마우스에서 혈액 혈청의 수집
      1. 각 마우스로부터 3, 5, 7 및 10일 후 감염 후 1.5 mL 의 미세원심지 튜브에서 약 0.1 mL의 혈액을 수집한 다음, 실온(RT)에서 20분 동안 배양한다.
      2. 샘플을 4°C에서 15분 동안 6,000 x g에서 원심분리하고 원심분리 후 혈청 상류를 수집한다.
    2. 제조업체의 권고에 따라 시판되는 DNA 추출 키트를 사용하여 혈액 혈청에서 DNA를 정화합니다. 간략하게, 실리카 계 열에서 세포를 용해시키고, 용출 컬럼에 100% 에탄올을 첨가하고, 6000 x g에서 원심분리하여 DNA를 추출하여 1분 동안 RNase-free 물 50 μL에서 DNA를 엘루트한다.
    3. 실시간 PCR 분석을 위해 용출에서 100 ng의 HBV DNA를 사용하십시오. 다음 프라이머 및 프로브를 사용: 앞으로 5' TAGGAGGCTGTAGGATAATGG 3'; 리버스 5' GCACAGCTTGGAGGTGT 3'; 프로브 5' TCACCTCTGCCTAATC 3'.
      1. 표준 곡선에 플라스미드(pAAV/HBV1.2)를 함유하는 HBV 게놈을 사용하고 총 부피 10 μL(그림3)에서실시간 PCR을 수행합니다.
    4. 표 1에나타낸 바와 같이 총 부피 10 μL로 PCR 반응을 설정한다.
    5. 표 2에표시된 대로 열전자전거에서 PCR 프로그램을 설정합니다. 프로그래밍된 온도 전이 속도는 변성/어닐링을 위한 20°C/s, 확장의 경우 5°C/s입니다. 실시간 PCR 모니터링을 위해 각 주기에 대한 어닐링 단계의 끝에서 형광을 측정합니다.

3. 바이러스 성 Ag 특이적 iPSC-CD8+ T 세포의 ACT에 의한 HBV 복제 감소

  1. 입양 세포 전달 (ACT)
    1. 섹션 1.3에 기재된 바와 같이 8일 동안 mFlt-3L 및 mIL-7의 존재 시 OP9-DL1-DL4 기질 세포상에서 s183/iPSCs(1.3.7)를 분화한다.
    2. 22일째에 트립신을 가진 10cm 플레이트에서 iPSC-CD8+ T 세포를 수집한 다음, 신선한 매체 10 mL에서 각 10cm 플레이트를 세척하고 다시 놓습니다. 세포를 신선한 10cm 플레이트에 넣고 섹션 1.3에서와 같이 30 분 동안 인큐베이터로 돌아갑니다. 30 분 후, 부동 세포를 수집합니다.
    3. 70 μm 나일론 여과기를 사용하여 세포를 통과하여 세포 클러스터를 제거하고 셀 수를 계산합니다. 차가운 PBS 용액에서 세포를 1.5 x 107 셀 /mL의 농도로 조정하고 70 μm 나일론 스트레이너를 사용하여 필요한 경우 세포 클러스터를 다시 제거하기 위해 세포를 통과시십시오. ACT가 될 때까지 얼음에 세포를 보관하십시오.
    4. 꼬리 정맥을 통해 4-6 주 된 HHD 마우스에 200 μL 세포 현탁액 (3 x 106 세포)을 주입합니다.
  2. HBV 복제 유도
    1. 세포 전달 후 14일째에, 섹션 2.1에 기재된 바와 같이 꼬리 정맥을 통해 HBV 플라스미드의 유체역학적 전달을 수행한다.
  3. 감염된 간에서 바이러스 단백질 검출
    1. 3일, 5일, 7일, 14일, 및 21일 감염 후 마우스를 희생한다. 안락사의 경우 각 케이지에서 첫 번째 단계에서 1-2 L의 이산화탄소(CO2)를사용하십시오. 동물이 의식 상실을 일으키면CO2 유량을 약 4-5 L/min.CO2 흡입을 사용하여 마우스 안락사를 수행합니다.
    2. 가위와 집게를 사용하여 복막의 표면 피부를 절단하고 약간 복강을 안감 내부 피부를 밝히기 위해 다시 간을 드래그하여 간을 분리. 감염된 마우스의 간 샘플(길이 x 너비 x 높이 = 0.5 cm x 0.5 cm X 0.3 cm)을 수집하고 절단하여 삽입 카세트에 쉽게 맞고 4-24시간 동안 10% 중성 완충포민으로 차단한다.
    3. 간 샘플을 decalcify2.5 M 포름산을 사용; 자일렌을 3분 간 헹구고, 100% 에탄올로 2x 헹구고, 95% 에탄올로 2x 헹구고, 탈이온화(DI) 물로 2분 간을 헹구고, 1mm 에틸렌디아미네테트라아세트산(EDTA)에서 간 시료를 분해합니다. 20 분 동안 하위 끓는 온도 (90 °C)에서 처리합니다.
    4. 고정 된 간 조직을 30 분 동안 식히고 4 분 동안 1 x PBS로 조직을 헹구고 파라핀에 조직을 포함시면됩니다. 물을 대체하기 위해 에탄올의 농도가 증가하는 일련의 조직을 탈수한 다음 자일렌 침지물에 담급합니다. 침투 된 조직을 왁스 블록에 포함시킴. 얼룩을 위해 수직 및 수평 단면을 고르게 만드십시오. 슬라이딩 마이크로토메로 4 μm 섹션을 준비합니다.
    5. 자일렌과 에탄올을 사용하여 탈파화 및 재수화를 통해 섹션을 통과한 다음 섹션의 면역 형광 염색을 수행합니다.
    6. HBV 표면 Ag 특이적 항체의 200 μL로 단면을 염색합니다(차단 용액에서 1:100 희석). 75% -100 % 가습 챔버에서 RT에서 2 시간 동안 항체로 섹션을 배양하고 5 분 동안 1 x PBS에서 5 x를 씻습니다.
    7. 4',6-디아미디노-2-페닐린들올레(DAPI)를 함유한 안티 페이드 시약을 사용하여 핵 염색을 하여 슬라이드에 대항하십시오. 희석된 DAPI 염색 용액(1x PBS에 300 nM)의 약 300 μL로 커버슬립을 추가하고 커버슬립 전체를 확인합니다. 형광 현미경으로 검사 할 때까지 4 °C에서 어둠 속에서 슬라이드를 유지합니다.
  4. 감염된 마우스의 염증성 세포 침투
    1. 3.3.1단계에서 기재된 바와 같이 마우스를 희생한다. 간을 수집하고 단계 3.3.4에 설명 된 대로 섹션을 합니다.
    2. 헤마톡실린과 에오신(H&E)으로 섹션을 염색하여 염증세포가 간으로 침투하는 것을 평가합니다.
    3. 형광 현미경하에서 추가 분석이 될 때까지 4 °C에서 어둠 속에서 슬라이드를 저장합니다.
    4. 형광 현미경으로 슬라이드를 시각화하여 염증 세포가 간으로 침투하는 것을 감지합니다(그림4).
  5. 감염된 간에서 HBV DNA 검출
    1. 바이러스 DNA의 격리.
    2. 마우스를 안락사시키고 섹션 3.3에 따라 간 샘플을 수집한다.
    3. 프로테아제 억제제 칵테일을 함유하는 노닌데트 P-40(NP-40) 용해 완충제(50 mM Tris-HCL, 1 mM EDTA, 1% NP-40)에서 간 조직을 리세.
    4. 16,000 x g에서 잠시 원심분리기를 사용하여 핵 및 세포 파편을 제거합니다.
    5. 세포질 용해액을 마이크로코칼 뉴클레아제(nuclease S7; 150 단위/mL)로 배양하고 37°C에서 CaCl2(5 mM)를 90분 동안 배양하여 핵산을 외부뉴클레오캡시드(NIC)로 분해합니다.
    6. 10 mM EDTA를 첨가하여 뉴클레아제 S7을 비활성화한다.
    7. 폴리에틸렌 글리콜 (PEG)으로 뉴클레오캡시드를 침전시키고, 0.5 % 나트륨 도데실 황산염 (SDS)을 방해하고, 37 °C에서 0.6 mg / mL 단백질 분해제 K (PK)로 소화합니다.
    8. 페놀 클로로폼 추출 및 에탄올 침전으로 바이러스 성 핵산을 회수한다.
    9. 추출된 바이러스 DNA를 1.2% 아가로즈 겔에서 해결하고32개의 P 표지된 HBV DNA 프로브를 사용하여 표준 남부 얼룩 분석을 통해 검출합니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

여기에 도시된 바와 같이, HBV 바이러스 성 Ag 특이적 iPSC-CD8+ T 세포는 시험관 내 배양 시스템에 의해 생성된다. 이러한 바이러스 성 Ag 특이적 iPSC-CD8+ T 세포의 ACT 후 실질적으로 뮤린 모델에서 HBV 복제를 억제한다(보충파일 1). 마우스 iPSC는 인간 마우스 하이브리드 HBV TCR 유전자를 코딩하는 MIDR 레트로바이러스 구조체(HBs183-191-specific,s183)로 변환된 다음, 유전자 변환된 iPSC는 노치 리간드를 발현하는 OP9-DL1/DL4 세포와 공동 배양된다(DL1 및 DL4 모두). rFlt3L 및 rIL-7이 있는 분자. 시험관내 공동 배양의 28일째에, iPSC 유래 세포는 실질적으로 CD3 및 Ag 특이적 TCR(T 세포 마커)을 발현한다. CD3+CD8+ 집단의 유세포 분석에서는 HBV TCR 전치가 바이러스 성 s183 특이적CD8+ T 세포의 생성을 극적으로 증가시킨다는 것을 보여준다(도1).

체외 공동 배양의 28일째에,CD4-CD8+ 단일 양성(SP) iPSC-CD8+ T 세포는 s183 펩티드로 펄스된 T 고갈된 비장세포에 의해 분리되고 자극되고, 사이토카인 생산이 평가된다. iPSC-CTL은 세포내 염색 또는 ELISA에 의해 검출된 바와 같이 많은 양의 IL-2 및 IFN-????를 생성한다(그림2). HBV 감염은 HLA-A2.1 형질전환(HHD) 마우스에서 pAAV/HBV1.2 DNA 플라스미드의 10 μg의 유체역학적 주입에 의해 마우스의 꼬리 정맥을 통해 유도된다. HBV 복제는 HHD 마우스의 혈청에서 3-21일째부터 검출된다. DNA 복제는 6일째에 정점에 이르고 실시간 PCR 분석을 사용하여 점차적으로 감소합니다(그림3).

ACT 다음 2 주, 마우스는 pAAV/HBV1.2 DNA 플라스미드의 유체 역학 주입으로 도전. 바이러스 성 이터는 주사 후 다양한 시점에서 혈청으로부터 실시간 PCR로 측정됩니다. 결과는 대조군 세포를 수신하는 마우스에 비해 HBV 바이러스 Ag 특이적 T 세포를 수신하는 마우스의 모든 시점에서 바이러스 복제가 현저하게 감소된다는 것을 입증한다(도4A). HBV 표면 단백질 발현은 또한 위의 치료 설정에서 간에서 검사된다. 마우스는 HBV 주입 후에 각종 일에 안락사되고 간 견본은 역학 검사를 위해 격리됩니다. 견본은 HBV 표면 단백질을 위해 염색되고 형광 현미경의 밑에 검토됩니다. HBV 표면 단백질은 HBV 바이러스 성 Ag 특이적 프리-iPSC-CTL을 수신하는 마우스에서 실질적으로 감소된 것으로 관찰되며, 대조군 세포를 수신하는 마우스와비교하여(도 4B). 본 실험은 바이러스 성 Ag 특이적 iPSC-CD8+ T 세포가 뮤린 모델에서 HBV 복제를 감소시키는 능력을 가지고 있음을 명확하게 입증한다.

Figure 1
도 1: HBV 바이러스 성 Ag 특이적 iPSC-CD8+ T 세포의 생성.
마우스 iPSCs는 다음과 같은 레트로바이러스 구조로 변환됩니다: HBs183-91 TCR (MiDR-s183 TCR) 또는 OVA257-264 TCR (MiDR-OVA TCR), 및 트랜스듀시된 iPSCs는 T 계보 분화를 위한 OP9-DL1/DL4 기질 세포와 공동 배양된다. (a)레트로바이러스 구조의 회로도 표현 MiDR-s183 TCR 표현 s183 특이적 TCR. Θ = 포장 신호; 2A = 피코나바이러스 자가-2A 서열; LTR = 긴 단자 반복. (B)0, 7, 14, 및 22일에 T 세포 분화의 형태. (C)28일째에 iPSC 유래 세포에 대한 유동 세포 분석. CD3+CD8+ 셀(왼쪽)은 CD8 및 TCRVβ28(오른쪽)의 발현을 위해 지시및 분석된 바와 같이 게이트된다. 표시된 데이터는 세 가지 개별 실험을 대표합니다. 값은 평균 ± SD(**p< 0.01; 쌍을 이루는 t-검정)를 나타냅니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 2
도 2: HBV 바이러스 Ag 특이적 iPSC-CD8+ T 세포의 기능적 분석.
체외 공동 배양의 28일째에, SPCD8+s183 TCR 펜타머+ iPSC-T 세포가 분류된다. MiDR-s183 TCR로 변환된 iPSC-T 세포 및CD8+ T 세포는 HHD 마우스로부터 T 고갈된 비장세포(APC)에 의해 자극되고 s183 펩티드(FLLTRILTI)로 펄스된다. (A)7시간 후 IFN-Θ의 세포내 염색(CD8+ 셀에 게이트) (T/APC = 1:4). (B)IFN-γ의 ELISA는 40시간 후에 나타난 데이터는 3개의 개별 실험을 대표한다. 값은 평균 ± SD(n.s., p > 0.05; 쌍을 이루는 t-검정)를 나타냅니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 3
도 3: 유체역학적 주입에 의한 HHD 마우스에서의 HBV 복제유도.
HHD 마우스는 유체역학적 꼬리 정맥 주사를 통해 HBV 플라스미드로 관리된다. 플라스미드의 10 μg는 총 체질량 PBS의 8%를 주입한다. 주사 후 표시된 시점에서 혈청은 혈액으로부터 분리되고 DNA는 실시간 PCR을 위해 추출됩니다. 표시된 데이터는 세 가지 개별 실험을 대표합니다. 값은 평균 ± SD. 데이터를 나타내며 3개의 독립적인 실험군당 5마리의 마우스를나타낸다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 4
도 4: 바이러스 성 Ag 특이적 iPSC-CD8+ T 세포의 ACT에 의한 HBV 복제의 감소.
HHD 마우스는 즉 바이러스 Ag 특이적 iPSC-CD8+ T 세포 전구(체외 배양의 22일째)로 채택적으로 전사하고 세포 전사 후 2주차에 HBV 플라스미드로 관리한다. (A)혈청 HBV 사본. 주사 후 표시된 시점에서 혈청은 혈액으로부터 분리되고 DNA는 실시간 PCR 분석을 위해 추출됩니다. 표시된 데이터는 세 가지 개별 실험을 대표합니다. 값은 평균 ± SD를 나타낸다.(B)간 조직 조직학. 마우스는 8일째 에 안락사된 후 HBV 감염. 간 견본은 당해 검사를 위해 고립되고 염색됩니다. 상부 패널은 감염된 마우스에서 HBsAg 단백질 발현을 나타내고(IHC 염색) 및 하부 패널은 염증세포 침투(HE-염색)를 나타낸다. 데이터는 3개의 독립적인 실험의 그룹 당 5마리의 마우스를 대표한다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

DNA 템플릿 2 ml
DNA 마스터 혼성화 혼합물((Taq DNA 폴리머라제, PCR 반응 완충제, 10 mM MgCl2 및 dNTP 혼합물) 1 ml
25 mM MgCl2 0.8 ml
0.3 μM 프로브 3 ml
각 프라이머의 5 μM 3.2 ml
10 ml

표 1: PCR 반응 량

온도 시간
변성 95 °C 5s
어 닐 링 53 °C 10s
확장 72 °C 20s
5 °C

표 2: PCR 프로그램

추가 파일 1: 이 파일을 다운로드하려면 여기를 클릭하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

이 프로토콜은 뮤린 모델에서 HBV 복제를 억제하기 위해 ACT로서 사용하기 위한 바이러스 성 Ag 특이적 iPSC-CTL을 생성하는 방법을 제시한다. 만성 HBV 감염에서, 바이러스 게놈은 간세포의 수명 내내 지속될 수 있는 안정적인 미니 염색체, 공유 폐쇄된 원형 DNA(cccDNA)를 형성한다. 바이러스성 미니 염색체의 정리를 표적으로 하는 것은 만성 HBV 감염의 치료 귀착될 수 있습니다. 현재 항바이러스 요법은 바이러스 역전사를 표적으로 하지만 cccDNA에 의해 구동되는 HBV 복제에 대한 면역학적 제어를 거의 확립하지 않습니다. HBV 특이적 CD8+ CTL은 감염된 간세포의 살해를 중재하고 cccDNA의 클리어런스를 가속화할 수 있다. 그럼에도 불구하고, HBV 특이적 CTL은 만성 HBV 감염을 가진 환자에서 삭제, 기능 장애, 또는 고갈에 굴복한다. HBV 특이적 CTL을 가진 ACT는 만성 HBV 감염28,29에대한 유리한 치료법이다. 순진하거나 중앙 기억 T 세포 유래 T 림프구 (즉, 반응성이 높은 면역 세포)는 큰 증식, 말기 분화 세포에 비해 사망 경향, 우수하기 때문에 ACT 기반 치료에 이상적인 이펙터입니다. 동종 시토 카인에 반응하는 능력. 그러나, 이러한 ACT는 환자에게서 CTL의 충분한 수를 얻기에 있는 어려움 때문에 수시로 실현 가능하지 않았습니다. 이전에는 iPSCs로부터 Ag 특이적 CTL 또는 Tregs의 재프로그래밍이 세포 기반 치료법20,23,27,30에사용될 수 있음을 보여주었다. 이 보고는 HBV 복제의 뮤린 모델에서 바이러스 Ag 특이적 iPSC-CTL을 생성하고 ACT 기반 면역 요법을 위해 이들 세포를 사용하는 방법을 보여준다.

HBV 복제의 형질전환 마우스 모형이 있더라도, 이 모형은 형질전환 유전자 제품에 의해 유도된 중앙 공차가 HBV Ags에 면역성이 있는 마우스를 일으키는 원인이 되기 때문에 도전적입니다. 부가적으로, 형질전환 마우스는 통합된 HBV 게놈이 각 마우스세포(31,32)에서지속됨에 따라 바이러스 클리어런스를 모니터링하는데 적합하지 않다. 또한, 성공적인 백신이 감염 예방을 위해 개발되었음에도 불구하고, HBV 감염 후 치료 또는 면역 요법은 개발되지 않았다. 더욱이, HBV 감염의 숙주 범위가 남성과 침팬지에 한정되기 때문에 HBV 병인에 대한 실험적 접근법은 방해를 받고 있으며, HBV의 전파를 위한 시험관 내 배양 시스템은 충분하지 않다. CD8+ T 세포는 다양한 유형의 바이러스 감염에 대한 유망한 이펙터 세포입니다. 그러나, HBV에 대하여 T 세포 반응은 풍부하지 않다. 특이성, 기능, 및 면역 반응을 탑재하기에 충분한 수의 부족이 원인일 수 있다. 이 보고는 마우스에 있는 HBV 복제를 능등하게 유도하는 유체 역학 주입의 방법을 제시합니다. 이 방법은 많은 양의 HBV 플라스미드를 간으로 직접 전달할 수 있게 합니다. 이 모델은 주사 후 상이한 날에 HBV mRNA, 단백질 및 DNA를 검출하여 8주 이상 연속 적인 바이러스혈을 나타낸다. 마우스에서 HBV 복제에 대한 이 방법은 HBV 면역 요법에 유용하다.

요약하면, HBV 복제는 유체역학적 주입 절차를 통해 마우스에서 성공적으로 유도되었고, 바이러스 성 Ag 특이적 iPSC-CTL은 HBV 복제를 위한 면역 요법으로서 사용되었다. 그러나, 상기 방법의 두 가지 제한사항이 있다: (1) 3주 이상의 시험관내 T 세포 분화는 ACT에 대한 생성된 T 세포의 번역 적용을 감소시킬 수 있다; 및 (2) HBV 유체역학적 주사는 간에서 HBV 복제를 효율적으로 유도할 수 있다; 그러나, 그것은 cccDNA를 형성 하지 않습니다., 지속적인 HBV 감염에 대 한 주된 이유. 그럼에도 불구하고, 이 방법은 HBV 복제 및 치료에 대한 대체 접근법을 제공한다. 항 HBV 약물및 바이러스 성 Ag 특이적 iPSC-CTL의 ACT를 사용하는 병용 요법은 HIV 저장소를 감소시켜 만성 HIV 감염에 대한 치료를 초래할 가능성이 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 할 것이 없다.

Acknowledgments

저자는 HBs183-91 (s183)에 대한 cDNA를 제공하는 토론토 종합 병원 연구소에서 박사 아담 J Gehring 감사 (FLLTRILTI)- 특정 A2 제한 인간 - 뮤린 하이브리드 TCR 유전자, 및 제공에 대한 국립 대만 대학에서 박사 페이 - 저 첸 pAAV/HBV 1.2 구문. 이 작품은 J. S에 건강 보조금 R01AI12180, R01CA221867 및 R21AI109239의 국립 연구소에 의해 지원됩니다.

Materials

Name Company Catalog Number Comments
HHD mice Institut Pasteur, Paris, France H-2 class I knockout, HLA-A2.1-transgenic (HHD) mice
iPS-MEF-Ng-20D-17 RIKEN Cell Bank APS0001
SNL76/7 ATCC SCRC-1049
OP9 ATCC CRL-2749
pAAV/HBV1.2 plasmid Dr. Dr. Pei-Jer Chen (National Taiwan University Hospital, Taiwan) HBV DNA construct
HBs183-91(s183) (FLLTRILTI)-specific TCR genes Dr. Adam J Gehring (Toronto General Hospital Research Institute, Toronto, Canada) FLLTRILTI-specific A2-restricted human-murine hybrid TCR genes (Vα34 and Vβ28)
OVA257–264-specific TCR genes Dr. Dario A. Vignali (University of Pittsburgh, PA) SIINFEKL-specific H-2Kb-restricted TCR genes
Anti-CD3 (17A2) antibody Biolegend 100236
Anti-CD44 (IM7) antibody BD Pharmingen 103012
Anti-CD4 (GK1.5) antibody Biolegend 100408
Anti-CD8 (53-6.7) antibody Biolegend 100732
Anti-IFN-γ (XMG1.2) antibody Biolegend 505810
Anti-TNF-a (MP6-XT22) antibody Biolegend 506306
α-MEM Invitrogen A10490-01
Anti-HBs antibody Thermo Fisher MA5-13059
ACK Lysis buffer Lonza 10-548E
Brefeldin A Sigma B7651
DMEM Invitrogen ABCD1234
FBS Hyclone SH3007.01
FACSAria Fusion cell sorter BD 656700
Gelatin MilliporeSigma G9391
GeneJammer Agilent 204130
HLA-A201-HBs183-91-PE pentamer Proimmune F027-4A - 27
HRP Anti-Mouse Secondary Antibody Invitrogen A27025
mFlt-3L Peprotech 250-31L
mIL-7 Peprotech 217-17
Nuclease S7 Roche 10107921001
Paraformaldehyde MilliporeSigma P6148-500G Caution: Allergenic, Carcenogenic, Toxic
Permeabilization buffer Biolegend 421002
Polybrene MilliporeSigma 107689
ProLong™ Gold Antifade Mountant with DAPI Invitrogen P36931
QIAamp MinElute Virus Spin Kit Qiagen 57704

DOWNLOAD MATERIALS LIST

References

  1. Scaglione, S. J., Lok, A. S. Effectiveness of hepatitis B treatment in clinical practice. Gastroenterology. 142, (6), 1360-1368 (2012).
  2. Osiowy, C. From infancy and beyond... ensuring a lifetime of hepatitis B virus (HBV) vaccine-induced immunity. Human Vaccines & Immunotherapeutics. 14, (8), 2093-2097 (2018).
  3. Gish, R. G., et al. Loss of HBsAg antigen during treatment with entecavir or lamivudine in nucleoside-naive HBeAg-positive patients with chronic hepatitis B. Journal of Viral Hepatitis. 17, (1), 16-22 (2010).
  4. Kurktschiev, P. D., et al. Dysfunctional CD8+ T cells in hepatitis B and C are characterized by a lack of antigen-specific T-bet induction. Journal of Experimental Medicine. 211, (10), 2047-2059 (2014).
  5. Fisicaro, P., et al. Antiviral intrahepatic T-cell responses can be restored by blocking programmed death-1 pathway in chronic hepatitis B. Gastroenterology. 138, (2), 682-693 (2010).
  6. Schurich, A., et al. The third signal cytokine IL-12 rescues the anti-viral function of exhausted HBV-specific CD8 T cells. PLoS Pathogens. 9, (3), 1003208 (2013).
  7. Gehring, A. J., et al. Engineering virus-specific T cells that target HBV infected hepatocytes and hepatocellular carcinoma cell lines. Journal of Hepatology. 55, (1), 103-110 (2011).
  8. Xia, Y., et al. Interferon-gamma and Tumor Necrosis Factor-alpha Produced by T Cells Reduce the HBV Persistence Form, cccDNA, Without Cytolysis. Gastroenterology. 150, (1), 194-205 (2016).
  9. Huang, L. R., Wu, H. L., Chen, P. J., Chen, D. S. An immunocompetent mouse model for the tolerance of human chronic hepatitis B virus infection. Proceedings of the National Academy of Sciences U.S.A. 103, (47), 17862-17867 (2006).
  10. Wong, P., Pamer, E. G. CD8 T cell responses to infectious pathogens. Annual Review of Immunology. 21, 29-70 (2003).
  11. Murray, J. M., Wieland, S. F., Purcell, R. H., Chisari, F. V. Dynamics of hepatitis B virus clearance in chimpanzees. Proceedings of the National Academy of Sciences USA. 102, (49), 17780-17785 (2005).
  12. Hinrichs, C. S., et al. Adoptively transferred effector cells derived from naive rather than central memory CD8+ T cells mediate superior antitumor immunity. Proceedings of the National Academy of Sciences U.S.A. 106, (41), 17469-17474 (2009).
  13. Hinrichs, C. S., et al. Human effector CD8+ T cells derived from naive rather than memory subsets possess superior traits for adoptive immunotherapy. Blood. 117, (3), 808-814 (2011).
  14. Kerkar, S. P., et al. Genetic engineering of murine CD8+ and CD4+ T cells for preclinical adoptive immunotherapy studies. Journal of Immunotherapy. 34, (4), 343-352 (2011).
  15. Kuball, J., et al. Facilitating matched pairing and expression of TCR chains introduced into human T cells. Blood. 109, (6), 2331-2338 (2007).
  16. van Loenen, M. M., et al. Mixed T cell receptor dimers harbor potentially harmful neoreactivity. Proceedings of the National Academy of Sciences USA. 107, (24), 10972-10977 (2010).
  17. Cameron, B. J., et al. Identification of a Titin-derived HLA-A1-presented peptide as a cross-reactive target for engineered MAGE A3-directed T cells. Science Translational Medicine. 5, (197), (2013).
  18. Fedorov, V. D., Themeli, M., Sadelain, M. PD-1- and CTLA-4-based inhibitory chimeric antigen receptors (iCARs) divert off-target immunotherapy responses. Science Translational Medicine. 5, (215), (2013).
  19. Maus, M. V., et al. T cells expressing chimeric antigen receptors can cause anaphylaxis in humans. Cancer Immunolology Research. 1, (1), 26-31 (2013).
  20. Haque, R., et al. Programming of regulatory T cells from pluripotent stem cells and prevention of autoimmunity. Journal of Immunology. 189, (3), 1228-1236 (2012).
  21. Vizcardo, R., et al. Regeneration of human tumor antigen-specific T cells from iPSCs derived from mature CD8(+) T cells. Cell Stem Cell. 12, (1), 31-36 (2013).
  22. Nishimura, T., et al. Generation of rejuvenated antigen-specific T cells by reprogramming to pluripotency and redifferentiation. Cell Stem Cell. 12, (1), 114-126 (2013).
  23. Lei, F., et al. In vivo programming of tumor antigen-specific T lymphocytes from pluripotent stem cells to promote cancer immunosurveillance. Cancer Research. 71, (14), 4742-4747 (2011).
  24. Kim, J. B., et al. Oct4-induced pluripotency in adult neural stem cells. Cell. 136, (3), 411-419 (2009).
  25. Lei, F., Haque, R., Xiong, X., Song, J. Directed differentiation of induced pluripotent stem cells towards T lymphocytes. Journal of Visualized Experiments. (63), e3986 (2012).
  26. Lei, F., Haque, M., Sandhu, P., Ravi, S., Ni, Y., Zheng, S., Fang, D., Jia, H., Yang, J. M., Song, J. Development and characterization of naive single-type tumor antigen-specific CD8+ T lymphocytes from murine pluripotent stem cells. OncoImmunology. 6, (2017).
  27. Haque, M., et al. Melanoma Immunotherapy in Mice Using Genetically Engineered Pluripotent Stem Cells. Cell Transplantation. 25, (5), 811-827 (2016).
  28. Tan, A. T., et al. Use of Expression Profiles of HBV DNA Integrated Into Genomes of Hepatocellular Carcinoma Cells to Select T Cells for Immunotherapy. Gastroenterology. (2019).
  29. Wu, L. L., et al. Ly6C(+) Monocytes and Kupffer Cells Orchestrate Liver Immune Responses Against Hepatitis B Virus in Mice. Hepatology. (2019).
  30. Haque, M., et al. Stem cell-derived tissue-associated regulatory T cells suppress the activity of pathogenic cells in autoimmune diabetes. Journal of Clinical Investigation Insights. (2019).
  31. Chisari, F. V., et al. Structural and pathological effects of synthesis of hepatitis B virus large envelope polypeptide in transgenic mice. Proceedings of the National Academy of Sciences USA. 84, (19), 6909-6913 (1987).
  32. Wirth, S., Guidotti, L. G., Ando, K., Schlicht, H. J., Chisari, F. V. Breaking tolerance leads to autoantibody production but not autoimmune liver disease in hepatitis B virus envelope transgenic mice. Journal of Immunology. 154, (5), 2504-2515 (1995).
줄기 세포 유래 바이러스 Ag 특이적 T 림프구는 마우스에서 HBV 복제를 억제
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).More

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter