Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Stem Cell-avledet viral AG-spesifikke T-lymfocytter Undertrykk HBV-replikering i mus

doi: 10.3791/60043 Published: September 25, 2019

Summary

Presentert her er en protokoll for effektiv undertrykkelse av hepatitt B-viruset (HBV) replikering i mus ved å utnytte adoptiv celle overføring (ACT) av stilk cellen-avledet viral antigen (AG)-spesifikke T-lymfocytter. Denne prosedyren kan tilpasses for potensielle ACT-baserte immunterapi av HBV-smitte.

Abstract

Hepatitt B-viruset (HBV) er et globalt helseproblem. Med over 350 000 000 mennesker rammet over hele verden, HBV infeksjon fortsatt den ledende årsak til leverkreft. Dette er en stor bekymring, spesielt i utviklingsland. Svikt i immunsystemet å montere en effektiv reaksjon mot HBV fører til kronisk infeksjon. Selv om HBV-vaksine er til stede og romanen antivirale legemidler blir opprettet, er fjerning av virus reservoar celler fortsatt et viktig helse tema. Beskrevet her er en metode for generering av viral antigen (AG)-spesifikke CD8+ cytotoksisk T-lymfocytter (CTLer) avledet fra indusert Pluripotent stamceller (iPSCs) (dvs. IPSC-CTLer), som har evnen til å undertrykke HBV replikering. HBV-replikering er effektivt indusert i mus gjennom hydrodynamisk injeksjon av et HBV-uttrykk plasmider, pAAV/HBV 1.2, i leveren. Deretter, HBV overflate AG-spesifikk mus iPSC-CTLer er adoptively overføres, som i stor grad undertrykker HBV-replikering i lever og blod, samt hindrer HBV overflate AG uttrykk i hepatocytter. Denne metoden demonstrerer HBV-replikering i mus etter hydrodynamisk injeksjon og at Stamcelle-avledet viral AG-spesifikke CTLer kan undertrykke HBV-replikering. Denne protokollen gir en nyttig metode for HBV-immunterapi.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Etter akutt infeksjon kontrollerer det adaptive immunsystemet (dvs. humoral og cellulær immunitet) hoveddelen av akutt HBV-relatert hepatitt. Likevel kan en rekke mennesker i HBV-endemiske regioner ikke eliminere virusene og deretter konvertere som kroniske individer. Mer enn 25% av kroniske pasienter (> 250 millioner mennesker) verden over utvikler progressiv leversykdom, noe som resulterer i skrumplever og/eller leverkreft (HCC)1. Som et resultat, er utryddelsen av bevisst infiserte celler fortsatt et generelt healthiness problem, selv om det er en tilgjengelig vaksine2 og mange antivirale legemidler er under utvikling. Standard behandling for HBV-infeksjon inkluderer IFN-α, nukleosid og nukleotid analoger. Disse agentene har direkte antiviral aktivitet og immun modulatory kapasiteter. Likevel, serokonversjon av HBe antigen (AG)+ bærere med anti-HBe antistoff (AB) og tap av serum HBV deoksyribonukleinsyre acid (DNA) vises individuelt i ca 20% av behandlede pasienter, og hele immunologiske kontroll av viruset verifisert av deprivasjon av HBsAg er ikke mer enn 5%3. Videre er responsen på behandlingen ofte ikke holdbar. Forebyggende vaksinasjon med rekombinant HBs AG er svært effektiv i å forebygge smitte, men terapeutisk HBs AG vaksinasjon er ikke effektiv. Åpenbart T celle-mediert immunresponser spille en avgjørende rolle i å kontrollere HBV infeksjon og nedsatt leverfunksjon; men i kroniske hepatitt pasienter, HBV-reaktive T celler er ofte slettet, dysfunksjonelle, eller konvertere oppbrukt4,5,6. Følgelig, hos personer med vedvarende HBV-infeksjon, ingen forsøk på å gjeninnsette HBV-spesifikk immunitet (dvs. T celle-basert immunitet) ved hjelp av anti-viral middel, Immuno-modulatory cytokiner, eller helbredende immunisering har oppnådd suksess.

Adopsjon celle overføring (Act) av HBV AG-spesifikke T-celler er en effektiv behandling rettet til slutt utrydde resterende hepatocytter wih HBV7,8. ACT av HBV-spesifikk CTLer i HBV-infiserte mus har vist seg å forårsake forbigående, mild hepatitt, og et dramatisk fall i ribonukleinsyre av HBV-syre (RNA) i hepatocytter. I disse studiene hemmer CTLer ikke transkripsjon av HBV gener, men forbedret nedbrytning av HBV transkripsjoner9. HBV-spesifikke CTLer er viktige for å forebygge virus infeksjon og megle i clearance av HBV10,11. For Act-baserte løsninger har in vitro-utvidelse av HBV-spesifikke T-celler med høy reaktivitet for in vivo-omplassering blitt foreslått å være en ideell metode12,13,14; Likevel er nåtidens tilnærminger begrenset med hensyn til deres evne til å generere, skille og dyrke passende mengder og kvaliteter av HBV-spesifikke T-celler fra pasienter for potensielle terapier.

Selv om kliniske studier presenterer sikkerhet, gjennomførbarhet, og potensiell terapeutisk aktivitet av celle-baserte behandlinger ved hjelp av konstruert T-celler som er spesifikke for HBV virus-infiserte hepatocytter, det er bekymringer om ugunstige virkninger oppstår fra autoimmune responser på grunn av kryss-reaktivitet fra mispairing T celle reseptor (TCR)15,16, off-Target AG anerkjennelse av ikke-spesifikk TCR17 og på-målet off-toksisitet av en chimeric AG reseptor (bil) 18 av år , 19 med sunt vev. Foreløpig er genmodifiserte T-celler, som bare har kortsiktig utholdenhet i Vivo, vanligvis middels eller senere effektor T-celler. Hittil Pluripotent stamceller (PSCer) er den eneste kilden tilgjengelig for å generere høye antall naive enkelt-type AG-spesifikke T celler20,21,22,23. Indusert PSCer (iPSCs) er ganske enkelt konverteres fra pasientens somatiske celler gjennom bruk av genet Transduction av flere transkripsjon faktorer. Som et resultat, iPSCs har lignende egenskaper som de av embryonale stamceller (ESCs)24. På grunn av fleksibiliteten og muligheten for uendelig evne til å fornye seg selv, i tillegg til vev erstatning, iPSC-baserte behandlinger kan bli mye brukt i regenererende medisin. Videre kan regimenter underliggende iPSCs betydelig forbedre dagens celle-baserte terapier.

Det overordnede målet med denne metoden er å generere en stor mengde HBV-spesifikke CTLer fra iPSCs (dvs. iPSC-CTLer) for ACT-based immunterapi. Fordelene fremfor alternative teknikker er at HBV-spesifikke iPSC-CTLer har en enkelt type TCR og naiv fenotype, noe som resulterer i mer minne T celle utvikling etter ACT. Det er demonstrert at ACT av HBV-spesifikke iPSC-CTLer øker migrasjon av funksjonelle CD8+ T celler i leveren og reduserer HBV replikering i både lever og blod administrert mus. Denne metoden avslører en potensiell bruk av viral AG-spesifikke iPSC-CTLer for HBV-immunterapi og kan tilpasses til å generere andre viral AG-spesifikke iPSC-T-celler for viral immunterapi.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle dyr eksperimenter er godkjent av The Texas A & M University Animal Care Committee (IACUC; #2018-0006) og er gjennomført i samsvar med retningslinjene i foreningen for vurdering og akkreditering av Laboratoriedyr Care. Mus brukes i løpet av 6 – 9 ukers alder.

1. generering av viral AG-spesifikke CD8+ t celler fra IPSCs (IPSC-CD8+ t celler)

  1. Opprettelse av retroviral konstruksjoner
    Merk: TCR α-og β-gener er koblet sammen med 2A selv spalte sekvens. Den retroviral vektoren MSCV-IRES-DsRed (MiDR) er DsRed+ 23.
    1. Sub-Klon HBs183-191 (FLLTRILTI)-spesifikke a2-begrenset Human-MURINE hybrid TCR (s183 TCR) gener (vα 34 og Vβ28) inn i MiDR å opprette s183 MiDR konstruere (figur 1A)25.
  2. Retroviral Transduction
    Merk: Platinum-E (Plat-E) cellene brukes til å emballere retroviruses (bærer s183 TCR gener), som vil bli brukt for retroviral Transduction. Den Plat-E celler er en effektiv retrovirus emballasje celler underliggende 293T cellene, som ble utviklet ved hjelp av unike emballasje konstruksjoner via EF1α promoter å uttrykke retroviral struktur protein, inkludert gag, Pol, og ecotropic env.
    1. På en 100 mm kultur parabol, frø 3 x 106 Plat-E celler i 8 ml DMEM kultur medium som inneholder 10% fosterets kalv serum (FCS) i en inkubator ved 37 ° c med 5% co2, 1 dag før transfeksjoner.
    2. På dag 0, transfect den s183 MiDR konstruere i Plat-E celler ved hjelp av en DNA transfeksjoner reagens25.
    3. På dag 1, frø 1 x 106 IPSCS (GFP+) til en gelatin pre-belagt kultur plate.
    4. På dag 2 – 3, samle retroviruses-inneholdende supernatanten fra Plat-E cellekultur for å overfører iPSCs med s183 TCR i nærvær av 1, 6-dibromohexane løsning25.
    5. På dag 4, trypsinize den s183 TCR genet-transduced iPSCs, sentrifuger på 400 x g for 5 min og frø 3 × 105 iPSCs i en 100 mm kultur parabolen pre-belagt med 3 x 106 bestrålt SNL76/7 (irSNL76/7) mater celler25.
    6. På dag 5 eller 6 av samløpet, trypsinize cellene, sentrifuger på 400 x g for 5 min og prosess for celle sortering. Gating på levende celler, sortere GFP og DsRED dobbelt positive celler (den s183 TCR genet-transduced iPSCs) ved hjelp av en høyhastighets celle Sorter. Ligner på trinn 1.2.5, co-kultur de sorterte cellene på irSNL76/7 mater celler for fremtidig bruk25.
  3. Differensiering av HBV-spesifikke iPSC-CD8+ T-celler
    Merk: den OP9-DL1/DL4 stromal celler overekspresjon både notch ligander DL1 og DL4, og co-dyrking iPSCs med iPSCs kan fremme notch signalering-mediert T celle differensiering26.
    1. Grow s183 TCR genet-transduced iPSCs (s183/iPSCs) i OP9-DL1-DL4 celle monolag i α-minimum essensielle medium (MEM) medier som inneholder 20% fosterets storfe serum (FBS)27. Inkluder murine Flt3 ligand (mFlt-3L; siste konsentrasjon = 5 ng/mL) i kulturen.
    2. På dag 0, frø 0,5-1,0 x 105 S183/iPSCs i en 10 cm kultur parabolen tidligere VOKST med OP9-DL1-DL4 celler. Valider at OP9-DL1-DL4-cellene er i en tilstand på 80% – 90% confluency.
    3. På dag 5, skyll iPSCs med 10 mL fosfat-bufret saltvann (PBS), aspirer av PBS, tilsett denne til 4 mL 0,25% Trypsin, og ruge i en 37 ° c inkubator i 10 min. etterpå, Legg til en supplerende 8 mL av iPSC Media for å avslutte Trypsin fordøyelsen. Samle alle fordøyelses løsninger som inneholder cellene og sentrifuger ved 400 x g i 5 min ved 15 – 30 ° c.
    4. Aspirer de supernatanten og resuspend cellene i 10 mL iPSC medier. Overfør celle fjæringen til en ny 10 cm Petri plate og ruge i en inkubator i 30 min ved 37 ° c.
    5. Etter 30 min, samle iPSC medier som inneholder flytende celler. Pass cellen suspensjon gjennom en 70 μm celle sil og beregne celle nummer.
    6. Seed 5 x 105 celler i kulturen parabolen tidligere vokst OP9-DL1-DL4 celler med en tilstand på 80%-90% confluent som beskrevet i trinn 1.3.1.
      Merk: for T celle differensiering, hver 2 – 3 dager, iPSC-avledede celler trenger å re-frø med et friskt lag av OP9-DL1-DL4 celler.
  4. Evaluering
    1. Morfologiske endringer av differensiering iPSCs
      1. Observer celler under et mikroskop på ulike dager.
        Merk: etter dag 5, kolonier har mesoderm egenskaper, viser en klassisk spindel-form morfologi som ligner menneskelig dermal fibroblaster og vedvarende vekst in vitro. Etter dag 8, små runde klynger av celler begynner å vises.
    2. Analyse av å skille iPSCs ved flyt flowcytometri
      1. På ulike dager med co-kultur, analysere iPSC-avledede celler som beskrevet tidligere25 (figur 1B, C).
    3. Funksjonell analyse av differensiering iPSCs
      1. På dag 28 av co-kulturen, samle iPSC-CD8+ T celler fra kulturer gjennom høsting av flytende celler, trypsinize de leftover cellene med 0,25% Trypsin, re-suspendere i 8 ml av IPSC Media, sentrifuge i 5 min ved 400 x g ved 15-30 ° c, fjerne Media, deretter resuspend cellene i 10 mL av Media.
      2. Oppbevar re-suspenderte celler i en frisk 10 cm parabolen i en 37 ° c inkubator for 30 min og montere flytende celler. Skyll deretter cellene en gang med en kald PBS.
      3. Ruge 3 x 106 T celle-utarmet SPLENOCYTES (CD4-CD8-) fra spleens av H-2 klasse i knockout, HLA-en 2.1-transgene (HHD) mus med 5 μM s183 peptid (FLLTRILTI) i 200 ΜL av Media ved 4 ° c i 30 min.
      4. Produser en blanding av iPSC-CD8+ T-celler med splenocytes pulserende med s183 peptid (T celler: splenocytes = 1:4; Bruk 0,75 x 106 T celler). Ruge blandingen av celler ved 37 ° c i en CO2 inkubator for 40 h. I løpet av de siste 7 h, tilsett 4 μL av fortynnet brefeldin A i kulturen (siste konsentrasjon på 1, 000x, som vil bli fortynnet i 1x kultur Media) for å blokkere transportprosesser under celle aktivering.
      5. Stain cellene og utføre Flow analytiske analyse av intracellulære IFN-γ som beskrevet tidligere (figur 2).

2. induksjon av HBV-replikering gjennom hydrodynamisk levering av HBV-plasmider

Merk: pAAV/HBV 1.2-konstruksjonen ble generert som beskrevet tidligere9. HBV 1,2 komplett DNA er innarbeidet i vektoren pAAV.

  1. Hydrodynamisk leveranser av HBV-plasmider gjennom hale venen
    1. Heat HHD mus ved hjelp av en varmelampe i 5 min i buret for å dilate halen blodåre.
    2. Anholde dyret ved hjelp av en restrainer, og ren mus haler med 70% etanol spray.
    3. Levering av plasmider i leveren.
    4. Mål musen kroppsvekt ved hjelp av en målestokk.
    5. Fortynne 10 μg av HBV-plasmider i 8% ekvivalent for Body Mass PBS (for eksempel 1,6 mL for en 20 g mus). Legg fortynnet plasmider i en 3 mL sprøyte med en 26 G × 12"(0,45 × 12 mm) sprøyte nål.
    6. Finn en av de to laterale halen årer i midten tredjedel av halen og plassere nålen i enten lateral vene. Administrer injeksjonen som inneholder HBV-plasmider gjennom hale venen innen 3-5 s.
  2. Kvantifisering av viremia fra blod serum av infiserte mus
    Merk: HBV-replikering oppstår fra dag 3 – 35 i mus serum. DNA replikering topper på dag 7 og reduserer gradvis. HBV-DNA fjernes ikke fra serum til dag 35.
    1. Innsamling av blod serum fra infiserte mus
      1. Samle ca 0,1 mL blod i et mikrosentrifugen rør fra hver mus på 3, 5, 7 og 10 dager etter infeksjon av retro-orbital blødning i en 1,5 mL mikrosentrifugen rør, deretter ruge ved romtemperatur (RT) i 20 min.
      2. Sentrifuger prøven ved 6 000 x g i 15 min ved 4 ° c og samle serum supernatanten etter sentrifugering.
    2. Rens DNA fra blod serum ved hjelp av et kommersielt tilgjengelig DNA-ekstraksjon Kit følge produsentens anbefalinger. Kort, lyse cellene i en silica-basert kolonne, utføre vasker, og trekke ut DNA ved å legge 100% etanol til eluering kolonnen og sentrifugering ved 6000 x g i 1 min. eluere DNA i 50 ΜL av RNase vann.
    3. Bruk 100 ng av HBV-DNA fra eluering for sanntids PCR-analyse. Bruk følgende primere og sonder: Forward 5 ' TAGGAGGCTGTAGGCATAAATTGG 3 '; Reverse 5 ' GCACAGCTTGGAGGCTTGT 3 '; sonde 5 ' TCACCTCTGCCTAATC 3 '.
      1. Bruk HBV-Genova som inneholder plasmider (pAAV/HBV 1.2) for standard kurve, og utfør PCR i sanntid i et total volum på 10 μL (Figur 3).
    4. Sett opp PCR-reaksjonen i et total volum på 10 μL som vist i tabell 1.
    5. Sett opp PCR-programmet i thermocycler som vist i tabell 2. Den programmerte temperatur overgangs raten er 20 ° c/s for denaturering/annealing og 5 ° c/s for forlengelse. Mål fluorescens ved slutten av annealing fasen for hver syklus for PCR-overvåking i sanntid.

3. reduksjon av HBV-replikering ved ACT av viral AG-spesifikke iPSC-CD8+ T-celler

  1. Adopsjon celle overføring (ACT)
    1. Skill s183/iPSCs (1.3.7) på OP9-DL1-DL4 stromal cellene i nærvær av mFlt-3L og mIL-7 i 8 dager som beskrevet i avsnitt 1,3.
    2. På dag 22, samle iPSC-CD8+ T celler fra 10 cm plate med Trypsin, deretter vaske og resuspend hver 10 cm plate i 10 ml av friske medier. Legg til cellene til en frisk 10 cm plate og gå tilbake til inkubator i 30 min som gjort i § 1,3. Etter 30 min, samle flytende celler.
    3. Bruk en 70 μm nylon sil å passere celler for å eliminere celle klynger og telle celle nummer. Tilpasse cellene til en konsentrasjon av 1,5 x 107 celler/ml i kald PBS løsning og bruke en 70 μm nylon sil å passere celler for å eliminere celle klynger igjen hvis nødvendig. Hold cellene på isen til ACT.
    4. Injiser 200 μL celle oppheng (3 x 106 celler) i 4 – 6 UKER gamle HHD-mus gjennom hale venen.
  2. Induksjon av HBV-replikering
    1. På dag 14 etter celle overføring utfører du hydrodynamisk levering av HBV-plasmider gjennom hale venen som beskrevet i avsnitt 2,1.
  3. Virus protein deteksjon fra infiserte leveren
    1. Offer mus på dag 3, 5, 7, 14 og 21 etter infeksjon. For dødshjelp, i hvert bur, bruk 1-2 L av karbondioksid (CO2) i den første fasen. Når Dyret utvikler tap av bevissthet, få CO2 flow rate rundt 4-5 L/min. Utfør mus dødshjelp med co2 inhalasjon.
    2. Skill leveren ved å kutte overflaten huden av peritoneum utnytte saks og tang og litt dra leveren tilbake for å avdekke den interne huden lining bukhulen. Samle og kutte leverprøver (lengde x bredde x høyde = 0,5 cm x 0,5 cm X 0,3 cm) av de infiserte musene for å passe lett inn i innebygging kassett og blokk i 10% nøytral buffer formalin for 4-24 h.
    3. Avkalke leveren samplesusing 2,5 M maursyre syre; skyll i xylen i 3 min, skyll 2x i 100% etanol, skyll 2x i 95% etanol, skyll 2x i deionisert (DI) vann i 2 min, deretter avkalke leveren prøvene i 1 mM ethylenediaminetetraacetic acid (EDTA) tilsvarende. Ved en under koketemperatur (90 ° c) i 20 min.
    4. Cool den faste leveren vev i 30 min. skyll vevet med 1x PBS for 4 min og bygg inn vevet i parafin. Tørke vevet i en serie av økende konsentrasjoner av etanol for å erstatte vannet, og deretter dyppe i xylen nedsenking. Embed det infiltrere vev i voks blokker. Gjør jevnt vertikal og horisontal snitting for farging. Forbered 4 μm-seksjoner med en glidende mikrotomen.
    5. Passere seksjonene gjennom deparaffinization og rehydrering ved hjelp av xylen og etanol, og deretter utføre immunofluorescent farging av delene.
    6. Beis avsnittene med 200 μL av HBV overflate AG-spesifikke antistoff (1:100 fortynning i blokkerings løsningen). Ruge delene med antistoff for 2 timer ved RT i 75% – 100% fuktet kammer, og vask 5x i 1x PBS i 5 minutter.
    7. Bruk en anti-fade-reagens som inneholder 4 ', 6-diamidino-2-phenylindole (DAPI) for kjernefysisk farging for å counterstain lysbildene. Tilsett dekkglass med ca. 300 μL av den fortynnede DAPI farge løsningen (300 nM i 1x PBS) og Valider hele dekkglass dekket. Hold lysbildene i mørket ved 4 ° c til inspeksjon under et fluorescerende mikroskop.
  4. Inflammatorisk celle infiltrasjon hos infiserte mus
    1. Ofre mus som beskrevet i trinn 3.3.1. Samle leveren og gjøre seksjoner som beskrevet i trinn 3.3.4.
    2. Stain delen med hematoksylin og eosin (H & E) for å evaluere infiltrasjon av inflammatoriske celler i leveren.
    3. Oppbevar lysbildene i mørket ved 4 ° c inntil videre analyse under et fluorescerende mikroskop.
    4. Visualiser lysbilder under et fluorescens mikroskop for å oppdage infiltrasjon av inflammatoriske celler i leveren (Figur 4).
  5. HBV DNA deteksjon av infiserte lever
    1. Isolering av viral DNA.
    2. Euthanize mus og samle leveren prøvene i henhold til § 3,3.
    3. Lyse leveren vev i Nonindet P-40 (NP-40) lyseringsbuffer (50 mM Tris-HCL, 1 mM EDTA, 1% NP-40) som inneholder en protease inhibitor cocktail.
    4. Kort sentrifuge ved 16 000 x g for å fjerne kjerner og celle rusk.
    5. Ruge den cytoplasmatiske lysat med micrococcal nuklease (nuklease S7; 150 enheter/mL) og CaCl2 (5 mm) ved 37 ° c i 90 min for å redusere nukleinsyre syre utenfor Nucleocapsids (NCS).
    6. Deaktiver nuklease S7 ved tilsetning av 10 mM EDTA.
    7. Utløse nucleocapsids med polyetylen glykol (PEG), forstyrre med 0,5% natrium natriumdodecylsulfat sulfat (SDS), og fordøye med 0,6 mg/mL proteinase K (PK) ved 37 ° c for 1 time.
    8. Gjenopprette viral nukleinsyre syrer ved fenol kloroform ekstraksjon og etanol nedbør.
    9. Løse den utpakkede viral DNA på en 1,2% agarose gel og oppdage ved standard Southern blot analyse ved hjelp av en32 P-merket HBV DNA-sonde.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Som vist her, er HBV viral AG-spesifikke iPSC-CD8+ T celler generert av et in vitro kultur system. Etter ACT av disse viral AG-spesifikke iPSC-CD8+ T celler vesentlig undertrykke HBV-replikering i en murine-modell (tilleggsfil 1). Mouse iPSC er transduced med MIDR retroviral konstruere koding en menneskelig mus hybrid HBV TCR genet (HBs183-191-spesifikk, s183), så genet-transduced iPSCs er co-KULTIVERT med OP9-DL1/DL4 celler uttrykker hakk ligander (både DL1 og DL4) molekyler i nærvær av rFlt3L og rIL-7. På dag 28 av in vitro co-kultur, de iPSC-avledede celler vesentlig uttrykker CD3 og AG-spesifikke TCR (T celle markører). Flow analytiske analyse av CD3+CD8+ BEFOLKNINGEN viser at HBV TCR Transduction dramatisk øker genereringen av viral s183-spesifikke CD8+ T celler (figur 1).

På dag 28 av in vitro co-kultur, den CD4-CD8+ single-positive (SP) IPSC-CD8+ T celler er isolert og stimulert av T-utarmet splenocytes pulserende med s183 peptid, og cytokin produksjonen er vurdert. IPSC-CTLer produserer store mengder IL-2 og IFN-Υ som oppdages av intracellulære farging eller ELISA (figur 2). HBV-smitte er indusert i HLA-A 2.1 transgene (HHD) mus ved hydrodynamisk injeksjon av 10 mikrogram pAAV/HBV 1.2 DNA plasmider gjennom halen årer av mus. Replikering av HBV oppdages fra dag 3 – 21 i serum fra HHD-mus. DNA-replikering topper på dag 6 og reduserer gradvis ved hjelp av sanntids PCR-analyse (Figur 3).

To uker etter ACT, mus er utfordret med en hydrodynamisk injeksjon av pAAV/HBV 1.2 DNA plasmider. Viral titer måles av PCR i sanntid fra serum ved ulike tidspunkter etter injeksjonen. Resultatene viser at viral replikering er betydelig redusert i det hele tatt tidspunkter i musene mottar HBV viral AG-spesifikke T-celler i forhold til musene mottar kontroll celler (Figur 4A). HBV overflate protein uttrykk er også undersøkt i leveren i ovennevnte innstilling av behandling. Mus er euthanized på ulike dager etter HBV-injeksjon og lever prøvene er isolert for histologic undersøkelse. Prøvene er flekkete for HBV overflate protein og undersøkt under et fluorescens mikroskop. Overflate protein HBV observeres som vesentlig redusert i musene som mottar HBV viral AG-spesifikk pre-iPSC-CTLer, sammenlignet med musene mottar kontroll celler (Figur 4B). Dette eksperimentet viser tydelig at viral AG-spesifikke iPSC-CD8+ T celler har muligheten til å redusere HBV replikering i murine modellen.

Figure 1
Figur 1: generering av HBV viral AG-spesifikke iPSC-CD8+ T celler.
Mouse iPSCs er transduced med følgende retroviral konstruksjoner: HBs183-91 TCR (MiDR-s183 TCR) eller OVA257-264 TCR (MiDR-OVA TCR), og transduced iPSCs er co-KULTIVERT med OP9-DL1/DL4 stromal celler for T avstamning differensiering. (A) skjematisk fremstilling av retroviral konstruere MiDR-s183 TCR som uttrykker s183-spesifikk TCR. Ψ = emballasje signal; 2A = picornavirus selv spalte 2A sekvens; LTR = lang Terminal gjentar. (B) morfologi av T celle differensiering på dager 0, 7, 14 og 22. (C) Flow analytiske analyse for IPSC-avledede celler på dag 28. CD3+CD8+ celler (til venstre) er gated som indikert og ANALYSERT for uttrykket av CD8 og TCRVβ28 (til høyre). Data som vises er representative for tre individuelle eksperimenter. Verdiene representerer gjennomsnittlig ± SD (* * p < 0,01; sammenkoblede t-tester). Vennligst klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: funksjonell analyse av HBV viral AG-spesifikke iPSC-CD8+ T-celler.
På dag 28 av in vitro co-kultur sorteres SP CD8+s183 TCR pentamer+ IPSC-T-celler. Den iPSC-T celler og CD8+ T celler Transduced med MiDR-s183 TCR stimuleres av T-utarmet Splenocytes (APCs) fra HHD mus og pulserende med s183 PEPTID (FLLTRILTI). (A) intracellulære FARGING av IFN-Υ etter 7 h (INNGJERDET på CD8+ celler) (T/APCs = 1:4). (B) Elisa av IFN-γ etter 40 h. viste data er representative for tre individuelle eksperimenter. Verdiene representerer gjennomsnittlig ± SD (n.s., p > 0,05; sammenkoblede t-tester). Vennligst klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: induksjon av HBV-replikering i HHD-mus ved hydrodynamisk injeksjon.
HHD mus er IV ADMINISTRERES med HBV plasmider via hydrodynamisk hale blodåre injeksjon. 10 μg av plasmider injiseres med 8% av total Body Mass PBS. På angitte tidspunkt etter injeksjon, er serum isolert fra blodet og DNA trekkes ut for sanntids PCR. Data som vises er representative for tre individuelle eksperimenter. Verdiene representerer Mean ± SD. data er representative for fem mus per gruppe av tre uavhengige eksperimenter. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: reduksjon av HBV-replikering ved ACT av viral AG-spesifikke iPSC-CD8+ T-celler.
HHD mus er IV adoptively overføres med viral AG-spesifikke iPSC-CD8+ T Cell forfedre (på dag 22 av in vitro kultur) og ADMINISTRERES med HBV plasmider på uke 2 etter at cellen overføringen. (A) serum HBV eksemplarer. Ved angitt tidspunkter etter injeksjon, serum er isolert fra blod, og DNA er ekstrahert for sanntids PCR analyse. Data som vises er representative for tre individuelle eksperimenter. Verdiene representerer gjennomsnittlig ± SD. (B) histologi av lever vevet. Mus er euthanized ved dag 8 infeksjon etter HBV. Leverprøver er isolert og beiset for histologic undersøkelse. Øvre panel viser HBsAg protein uttrykk i infiserte mus (IHC farging) og nedre panel viser inflammatorisk celle infiltrasjon (HE-farging). Data er representative for fem mus per gruppe av tre uavhengige eksperimenter. Vennligst klikk her for å se en større versjon av dette tallet.

DNA-mal 2 ml
DNA Master hybridisering blanding ((Taq DNA polymerase, PCR reaksjonsbuffer, 10 mM MgCl2, og dNTP blanding) 1 ml
25 mM MgCl2 0,8 ml
0,3 μM sonden 3 ml
5 μM av hver primer 3,2 ml
Totalt 10 ml

Tabell 1: PCR-reaksjons volum

Temperatur Tid
Denaturering 95 ° c 5-s
Annealing 53 ° c 10 s
Forlengelsen 72 ° c 20 s
5 ° c

Tabell 2: PCR-programmet

Tilleggsfil 1: Vennligst klikk her for å laste ned denne filen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Denne protokollen presenterer en metode for å generere viral AG-spesifikke iPSC-CTLer for bruk som ACT for å undertrykke HBV-replikering i en murine-modell. I kronisk HBV-infeksjon danner viral-Genova et stabilt mini-kromosom, covalently lukkede, sirkulære DNA (cccDNA) som kan vedvare gjennom hele levetiden til hepatocytter. Rettet mot clearance av viral mini kromosom kan resultere i en kur av kronisk HBV infeksjon. Nåværende antiviral behandling mål viruset reversere transkriptase men sjelden etablerer immunologiske kontroll over HBV replikering drevet av cccDNA. HBV-spesifikke CD8+ CTLer kan megle drapet på de infiserte hepatocytter og akselerere clearance av cccDNA. Ikke desto mindre blir de HBV-spesifikke CTLer slettet, dysfunksjonelle eller bukke under for utmattelse hos pasienter med kronisk HBV-infeksjon. Opptre med HBV-spesifikke CTLer er en gunstig behandling for kronisk HBV infeksjon28,29. Naive eller sentral minne T celle-avledet T-lymfocytter (dvs. svært reaktive immunceller) er ideelle effekt Orer for ACT-baserte terapier på grunn av deres store spredning, lavere tendens til døden i forhold til døds-differensiert celler, og utmerket evne til å svare på homøostatisk cytokiner. Imidlertid har slike ACT vært ofte ikke mulig på grunn av vanskeligheter med å skaffe tilstrekkelig antall CTLer fra pasienter. Det har tidligere vært vist at omprogrammering av AG-spesifikke CTLer eller Tregs fra iPSCs kan brukes til celle-baserte terapier20,23,27,30. Denne rapporten demonstrerer en metode for å generere viral AG-spesifikke iPSC-CTLer og bruke disse cellene for ACT-baserte immunterapi i en murine modell av HBV-replikering.

Selv om det er transgene Mouse modeller av HBV-replikering, er disse modellene utfordrende fordi den sentrale toleransen indusert av de transgene genet produktene forårsaker mus for å være immune tolerant til HBV AGS. Transgene mus egner seg heller ikke for overvåking av virus klarering ettersom de integrerte HBV-Genova vedvarer i hver muse celle31,32. Også, til tross for at vellykkede vaksiner er utviklet for å forebygge infeksjonen, behandling eller immunterapi etter HBV-infeksjon ikke er utviklet. Videre har de eksperimentelle tilnærminger til HBV-patogenesen blitt hemmet fordi verts utvalget av HBV-smitte er begrenset til menn og sjimpanser, og in vitro kultur system for utbredelsen av HBV er ikke tilstrekkelig. CD8+ T celler er lovende Effektor celler mot ulike typer viral infeksjon; men T celle respons mot HBV er ikke rikelig. Spesifisitet, funksjon, og mangel på tilstrekkelige tall for å montere en immunrespons kan være årsaken. Denne rapporten avslører metoden for hydrodynamisk injeksjon som effektivt induserer HBV-replikering i mus. Metoden tillater levering av en stor mengde HBV-plasmider direkte inn i leveren. Modellen viser kontinuerlig viremia i mer enn 8 uker med påvisning av HBV mRNA, proteiner og DNA på forskjellige dager etter injeksjon. Denne metoden for replikering av HBV i mus er nyttig for HBV-immunterapi.

Oppsummert ble HBV-replikering vellykket indusert i mus gjennom hydrodynamisk injeksjon prosedyre, og viral AG-spesifikke iPSC-CTLer ble brukt som immunterapi for HBV-replikering. Det er imidlertid to begrensninger av metoden: (1) mer enn tre uker med in vitro T celle differensiering kan redusere translational anvendelser av de genererte T-cellene for ACT; og (2) HBV hydrodynamisk injeksjon kan effektivt indusere HBV-replikering i leveren; den danner imidlertid ikke cccDNA, som er hovedårsaken til den vedvarende HBV-infeksjonen. Metoden gir likevel en alternativ metode for replikering og behandling av HBV. En kombinasjon diett bruker anti-HBV narkotika og ACT av viral AG-spesifikke iPSC-CTLer er sannsynlig å redusere HIV-reservoarer, og dermed resulterer i en terapi for kronisk HIV-smitte.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Forfatterne takker Dr. Adam J Gehring fra Toronto General Hospital Research Institute for å gi cDNA for HBs183-91 (s183) (FLLTRILTI)-spesifikke a2-begrenset Human-murine hybrid TCR gener, og Dr. Pei-Jer Chen fra National Taiwan University for å gi pAAV/HBV 1,2 konstruere. Dette arbeidet er støttet av National Institute of Health Grant R01AI121180, R01CA221867 og R21AI109239 til J. S.

Materials

Name Company Catalog Number Comments
HHD mice Institut Pasteur, Paris, France H-2 class I knockout, HLA-A2.1-transgenic (HHD) mice
iPS-MEF-Ng-20D-17 RIKEN Cell Bank APS0001
SNL76/7 ATCC SCRC-1049
OP9 ATCC CRL-2749
pAAV/HBV1.2 plasmid Dr. Dr. Pei-Jer Chen (National Taiwan University Hospital, Taiwan) HBV DNA construct
HBs183-91(s183) (FLLTRILTI)-specific TCR genes Dr. Adam J Gehring (Toronto General Hospital Research Institute, Toronto, Canada) FLLTRILTI-specific A2-restricted human-murine hybrid TCR genes (Vα34 and Vβ28)
OVA257–264-specific TCR genes Dr. Dario A. Vignali (University of Pittsburgh, PA) SIINFEKL-specific H-2Kb-restricted TCR genes
Anti-CD3 (17A2) antibody Biolegend 100236
Anti-CD44 (IM7) antibody BD Pharmingen 103012
Anti-CD4 (GK1.5) antibody Biolegend 100408
Anti-CD8 (53-6.7) antibody Biolegend 100732
Anti-IFN-γ (XMG1.2) antibody Biolegend 505810
Anti-TNF-a (MP6-XT22) antibody Biolegend 506306
α-MEM Invitrogen A10490-01
Anti-HBs antibody Thermo Fisher MA5-13059
ACK Lysis buffer Lonza 10-548E
Brefeldin A Sigma B7651
DMEM Invitrogen ABCD1234
FBS Hyclone SH3007.01
FACSAria Fusion cell sorter BD 656700
Gelatin MilliporeSigma G9391
GeneJammer Agilent 204130
HLA-A201-HBs183-91-PE pentamer Proimmune F027-4A - 27
HRP Anti-Mouse Secondary Antibody Invitrogen A27025
mFlt-3L Peprotech 250-31L
mIL-7 Peprotech 217-17
Nuclease S7 Roche 10107921001
Paraformaldehyde MilliporeSigma P6148-500G Caution: Allergenic, Carcenogenic, Toxic
Permeabilization buffer Biolegend 421002
Polybrene MilliporeSigma 107689
ProLong™ Gold Antifade Mountant with DAPI Invitrogen P36931
QIAamp MinElute Virus Spin Kit Qiagen 57704

DOWNLOAD MATERIALS LIST

References

  1. Scaglione, S. J., Lok, A. S. Effectiveness of hepatitis B treatment in clinical practice. Gastroenterology. 142, (6), 1360-1368 (2012).
  2. Osiowy, C. From infancy and beyond... ensuring a lifetime of hepatitis B virus (HBV) vaccine-induced immunity. Human Vaccines & Immunotherapeutics. 14, (8), 2093-2097 (2018).
  3. Gish, R. G., et al. Loss of HBsAg antigen during treatment with entecavir or lamivudine in nucleoside-naive HBeAg-positive patients with chronic hepatitis B. Journal of Viral Hepatitis. 17, (1), 16-22 (2010).
  4. Kurktschiev, P. D., et al. Dysfunctional CD8+ T cells in hepatitis B and C are characterized by a lack of antigen-specific T-bet induction. Journal of Experimental Medicine. 211, (10), 2047-2059 (2014).
  5. Fisicaro, P., et al. Antiviral intrahepatic T-cell responses can be restored by blocking programmed death-1 pathway in chronic hepatitis B. Gastroenterology. 138, (2), 682-693 (2010).
  6. Schurich, A., et al. The third signal cytokine IL-12 rescues the anti-viral function of exhausted HBV-specific CD8 T cells. PLoS Pathogens. 9, (3), 1003208 (2013).
  7. Gehring, A. J., et al. Engineering virus-specific T cells that target HBV infected hepatocytes and hepatocellular carcinoma cell lines. Journal of Hepatology. 55, (1), 103-110 (2011).
  8. Xia, Y., et al. Interferon-gamma and Tumor Necrosis Factor-alpha Produced by T Cells Reduce the HBV Persistence Form, cccDNA, Without Cytolysis. Gastroenterology. 150, (1), 194-205 (2016).
  9. Huang, L. R., Wu, H. L., Chen, P. J., Chen, D. S. An immunocompetent mouse model for the tolerance of human chronic hepatitis B virus infection. Proceedings of the National Academy of Sciences U.S.A. 103, (47), 17862-17867 (2006).
  10. Wong, P., Pamer, E. G. CD8 T cell responses to infectious pathogens. Annual Review of Immunology. 21, 29-70 (2003).
  11. Murray, J. M., Wieland, S. F., Purcell, R. H., Chisari, F. V. Dynamics of hepatitis B virus clearance in chimpanzees. Proceedings of the National Academy of Sciences USA. 102, (49), 17780-17785 (2005).
  12. Hinrichs, C. S., et al. Adoptively transferred effector cells derived from naive rather than central memory CD8+ T cells mediate superior antitumor immunity. Proceedings of the National Academy of Sciences U.S.A. 106, (41), 17469-17474 (2009).
  13. Hinrichs, C. S., et al. Human effector CD8+ T cells derived from naive rather than memory subsets possess superior traits for adoptive immunotherapy. Blood. 117, (3), 808-814 (2011).
  14. Kerkar, S. P., et al. Genetic engineering of murine CD8+ and CD4+ T cells for preclinical adoptive immunotherapy studies. Journal of Immunotherapy. 34, (4), 343-352 (2011).
  15. Kuball, J., et al. Facilitating matched pairing and expression of TCR chains introduced into human T cells. Blood. 109, (6), 2331-2338 (2007).
  16. van Loenen, M. M., et al. Mixed T cell receptor dimers harbor potentially harmful neoreactivity. Proceedings of the National Academy of Sciences USA. 107, (24), 10972-10977 (2010).
  17. Cameron, B. J., et al. Identification of a Titin-derived HLA-A1-presented peptide as a cross-reactive target for engineered MAGE A3-directed T cells. Science Translational Medicine. 5, (197), (2013).
  18. Fedorov, V. D., Themeli, M., Sadelain, M. PD-1- and CTLA-4-based inhibitory chimeric antigen receptors (iCARs) divert off-target immunotherapy responses. Science Translational Medicine. 5, (215), (2013).
  19. Maus, M. V., et al. T cells expressing chimeric antigen receptors can cause anaphylaxis in humans. Cancer Immunolology Research. 1, (1), 26-31 (2013).
  20. Haque, R., et al. Programming of regulatory T cells from pluripotent stem cells and prevention of autoimmunity. Journal of Immunology. 189, (3), 1228-1236 (2012).
  21. Vizcardo, R., et al. Regeneration of human tumor antigen-specific T cells from iPSCs derived from mature CD8(+) T cells. Cell Stem Cell. 12, (1), 31-36 (2013).
  22. Nishimura, T., et al. Generation of rejuvenated antigen-specific T cells by reprogramming to pluripotency and redifferentiation. Cell Stem Cell. 12, (1), 114-126 (2013).
  23. Lei, F., et al. In vivo programming of tumor antigen-specific T lymphocytes from pluripotent stem cells to promote cancer immunosurveillance. Cancer Research. 71, (14), 4742-4747 (2011).
  24. Kim, J. B., et al. Oct4-induced pluripotency in adult neural stem cells. Cell. 136, (3), 411-419 (2009).
  25. Lei, F., Haque, R., Xiong, X., Song, J. Directed differentiation of induced pluripotent stem cells towards T lymphocytes. Journal of Visualized Experiments. (63), e3986 (2012).
  26. Lei, F., Haque, M., Sandhu, P., Ravi, S., Ni, Y., Zheng, S., Fang, D., Jia, H., Yang, J. M., Song, J. Development and characterization of naive single-type tumor antigen-specific CD8+ T lymphocytes from murine pluripotent stem cells. OncoImmunology. 6, (2017).
  27. Haque, M., et al. Melanoma Immunotherapy in Mice Using Genetically Engineered Pluripotent Stem Cells. Cell Transplantation. 25, (5), 811-827 (2016).
  28. Tan, A. T., et al. Use of Expression Profiles of HBV DNA Integrated Into Genomes of Hepatocellular Carcinoma Cells to Select T Cells for Immunotherapy. Gastroenterology. (2019).
  29. Wu, L. L., et al. Ly6C(+) Monocytes and Kupffer Cells Orchestrate Liver Immune Responses Against Hepatitis B Virus in Mice. Hepatology. (2019).
  30. Haque, M., et al. Stem cell-derived tissue-associated regulatory T cells suppress the activity of pathogenic cells in autoimmune diabetes. Journal of Clinical Investigation Insights. (2019).
  31. Chisari, F. V., et al. Structural and pathological effects of synthesis of hepatitis B virus large envelope polypeptide in transgenic mice. Proceedings of the National Academy of Sciences USA. 84, (19), 6909-6913 (1987).
  32. Wirth, S., Guidotti, L. G., Ando, K., Schlicht, H. J., Chisari, F. V. Breaking tolerance leads to autoantibody production but not autoimmune liver disease in hepatitis B virus envelope transgenic mice. Journal of Immunology. 154, (5), 2504-2515 (1995).
Stem Cell-avledet viral AG-spesifikke T-lymfocytter Undertrykk HBV-replikering i mus
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).More

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter