Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Linfocitos T virales derivados de células madre suprimen la replicación del VHB en ratones

doi: 10.3791/60043 Published: September 25, 2019

Summary

Aquí se presenta un protocolo para la supresión efectiva de la replicación del virus de la hepatitis B (VHB) en ratones mediante la utilización de la transferencia de células adoptivas (ACT) de linfocitos T específicos de antígeno viral derivado de células madre (Ag). Este procedimiento puede adaptarse para una posible inmunoterapia basada en ACT de infección por VHB.

Abstract

La infección por el virus de la hepatitis B (VHB) es un problema de salud mundial. Con más de 350 millones de personas afectadas en todo el mundo, la infección por el VHB sigue siendo la principal causa de cáncer de hígado. Esta es una preocupación importante, especialmente en los países en desarrollo. La falta de montaje del sistema inmunitario contra el VHB conduce a una infección crónica. Aunque la vacuna contra el VHB está presente y se están creando nuevos medicamentos antivirales, la erradicación de las células de los reservorios de virus sigue siendo un tema de salud importante. Aquí se describe un método para la generación de antígeno viral (Ag) -cd8 específico+ linfocitos T citotóxicos (CTL) derivados de células madre pluripotentes inducidas (iPSC) (es decir, iPSC-CTL), que tienen la capacidad de suprimir la replicación del VHB. La replicación del VHB se induce eficientemente en ratones a través de la inyección hidrodinámica de un plásmido de expresión de VHB, pAAV/HBV1.2, en el hígado. A continuación, los iPSC-CTL de ratón específicos de La superficie del VHB se transfieren de forma adoptiva, lo que suprime en gran medida la replicación del VHB en el hígado y la sangre, así como previene la expresión Ag de la superficie del VHB en los hepatocitos. Este método demuestra la replicación del VHB en ratones después de la inyección hidrodinámica y que los CTL virales específicos de Ag derivados de células madre pueden suprimir la replicación del VHB. Este protocolo proporciona un método útil para la inmunoterapia con VHB.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Después de una infección aguda, el sistema inmunitario adaptativo (es decir, inmunidad humoral y celular) controla la mayor parte de la hepatitis aguda relacionada con el VHB. Sin embargo, varias personas en las regiones endémicas del VHB no pueden eliminar los virus y posteriormente convertirse como individuos crónicos. Más del 25% de los pacientes crónicos (>250 millones de personas) en todo el mundo desarrollan enfermedad hepática progresiva, lo que resulta en cirrosis hepática y/o carcinoma hepatocelular (HCC)1. Como resultado, la erradicación de las células infectadas insistentemente sigue siendo un problema general de salud, a pesar de que hay una vacuna disponible2 y numerosos medicamentos antivirales están en desarrollo. El tratamiento estándar para la infección por VHB incluye análogos de IFN, nucleósidos y nucleótidos. Estos agentes tienen actividad antiviral directa y capacidades moduladoras inmunes. Sin embargo, la seroconversión del antígeno HBe (Ag)+ portadores con anticuerpo anti-HBe (Ab) y pérdida de ácido desoxirribonucleico sérico del VHB (ADN) aparecen individualmente en aproximadamente el 20% de los pacientes tratados, y el control inmunológico completo del virus verificada por la privación del HBsAg no es más del 5%3. Además, la respuesta al tratamiento a menudo no es duradera. La vacunación profiláctica con HBs Ag recombinante es altamente eficaz en la prevención de infecciones, pero la vacunación terapéutica de HBs Ag no es eficaz. Claramente, las respuestas inmunitarias mediadas por células T desempeñan un papel crítico en el control de la infección por el VHB y la insuficiencia hepática; sin embargo, en pacientes crónicos con hepatitis, los thbv reactivos a menudo se eliminan, disfuncionales o conviertenagotado4,5,6. En consecuencia, en individuos con infección persistente por VHB, no se ha logrado el éxito de ningún intento de restablecer la inmunidad específica del VHB (es decir, la inmunidad basada en células T) mediante remedio antiviral, citoquinas inmunomoduladoras o inmunización curativa.

La transferencia celular adoptiva (ACT) de células T específicas del VHB Ag es un tratamiento eficiente dirigido a erradicar eventualmente los hepatocitos restantes con el VHB7,8. Se ha demostrado que el ACT de CTL específicos del VHB en ratones infectados por el VHB causa hepatitis leve transitoria y, y una disminución dramática de las transcripciones del ácido ribonucleico del VHB (ARN) en los hepatocitos. En estos estudios, los CTL no inhibiron la transcripción de genes del VHB, sino que mejoraron la degradación de las transcripciones del VHB9. Los CTL específicos del VHB son importantes para prevenir la infección viral y mediar en el aclaramiento del VHB10,11. Para los remedios basados en ACT, se ha sugerido que la expansión in vitro de células T específicas del VHB con una alta reactividad para el reasentamiento in vivo es un método ideal12,13,14; sin embargo, los enfoques actuales están restringidos con respecto a sus capacidades para generar, separar y crecer cantidades y cualidades apropiadas de células T específicas del VHB de los pacientes para las terapias potenciales.

Aunque los ensayos clínicos presentan seguridad, practicabilidad y actividad terapéutica prospectiva de tratamientos basados en células mediante células T de ingeniería que son específicos de los hepatocitos infectados por el virus del VHB, hay preocupaciones sobre los efectos desfavorables debido a las respuestas autoinmunes debido a la reactividad cruzada del receptor de células T de búsqueda incorrecta (TCR)15,16, reconocimiento Ag fuera del objetivo por TCR no específico17 y fuera de toxicidad en el objetivo por un receptor Ag quimérico (CAR) 18 , 19 con tejidos sanos. Actualmente, las células T modificadas genéticamente, que sólo tienen persistencia a corto plazo in vivo, son generalmente células T intermedias o posteriores. Hasta la fecha, las células madre pluripotentes (PSC) son la única fuente disponible para generar un gran número de células T nave de tipo único Ag20,21,22,23. Los PsC inducidos (iPSC) simplemente se convierten a partir de las células somáticas de un paciente mediante el uso de la transducción génica de varios factores de transcripción. Como resultado, los iPSC tienen características similares a las de las células madre embrionarias (ESC)24. Debido a la flexibilidad y la posibilidad de la capacidad infinita de auto-renovarse, además de la sustitución de tejidos, los tratamientos basados en iPSC pueden aplicarse ampliamente en la medicina regenerativa. Además, los regimientos subyacentes a las iPSC pueden mejorar sustancialmente las terapias actuales basadas en células.

El objetivo general de este método es generar una gran cantidad de CTL específicos del VHB a partir de iPSC (es decir, iPSC-CTLs) para la inmunoterapia basada en ACT. Las ventajas sobre las técnicas alternativas son que los iPSC-CTL específicos del VHB tienen un tCR de un solo tipo y un fenotipo ingenuo, lo que da como resultado un mayor desarrollo de células T de memoria después del ACT. Se ha demostrado que el ACT de iPSC-CTL específicos del VHB aumenta la migración de células CD8+ T funcionales en el hígado y reduce la replicación del VHB tanto en el hígado como en la sangre de los ratones administrados. Este método revela un uso potencial de iPSC-CTL virales específicos de Ag para la inmunoterapia con VHB y puede adaptarse para generar otras células iPSC-T virales específicas de Ag para inmunoterapia viral.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Todos los experimentos con animales son aprobados por el Comité de Cuidado animal de la Universidad de Texas A&M (IACUC; #2018-0006) y se llevan a cabo de conformidad con las directrices de la Asociación para la Evaluación y Acreditación del Cuidado de Animales de Laboratorio. Los ratones se utilizan durante 6-9 semanas de edad.

1. Generación de células virales CP8+ T específicas de ag a partir de iPSC (células iPSC-CD8+ T)

  1. Creación de las construcciones retrovirales
    NOTA: Los genes TCR y TCR están vinculados con la secuencia de autocorte 2A. El vector retroviral MSCV-IRES-DsRed (MiDR) es DsRed+ 23.
    1. Subclone HBs183-191 (FLLTRILTI) específicoS A2-murine híbrido sortino genes TCR (s183 TCR) (V-34 y V-28) en el MiDR para crear la construcción de MiDR s183(Figura 1A)25.
  2. Transducción retroviral
    NOTA: Las células Platinum-E (Plat-E) se utilizan para empaquetar retrovirus (que transportan genes TCR s183), que se utilizarán para la transducción retroviral. Las células Plat-E son una célula de envasado retrovirus eficaz subyacente a las células 293T, que se desarrollaron mediante construcciones de envases únicas a través del promotor EF1 para expresar proteína de estructura retroviral, incluyendo gag, pol y ecotrópico env.
    1. En un plato de cultivo de 100 mm, semilla3 x 106 células Plat-E en 8 ml de medio de cultivo DMEM que contiene 10% de suero de ternera fetal (FCS) en una incubadora a 37 oC con 5% co2,1 día antes de la transfección.
    2. En el día 0, transfectar la construcción s183 MiDR en las células Plat-E utilizando un reactivo de transfección de ADN25.
    3. En el día 1, semilla 1 x 106 iPSCs (GFP+) en una placa de cultivo pre-revestida de gelatina.
    4. Los días 2–3, recopile el sobrenadante que contiene retrovirus del cultivo celular Plat-E para transducir los iPSC con el TCR s183 en presencia de 1,6-dibromohexane solución25.
    5. En el día 4, pruebe los ISPC transducidos por el gen TCR s183, centrífuga a 400 x g durante 5 min y las semillas 3 x 105 iPSC en una placa de cultivo de 100 mm precubierta con 3 x 106 irradiadas SNL76/7 (irSNL76/7) células alimentadoras25.
    6. En el día 5 o 6 de la confluencia, trippsinizar las células, centrifugar a 400 x g durante 5 min y proceso para la clasificación celular. La ampliación de células vivas, ordenar las células dobles positivas GFP y DsRED (los iPSC transducidos por el gen TCR s183) utilizando un clasificador celular de alta velocidad. Similar al paso 1.2.5, co-cultivo de las células ordenadas en las células de alimentación irSNL76/7 para uso futuro25.
  3. Diferenciación de células iPSC-CD8+ T específicas del VHB
    NOTA: Las células estromales OP9-DL1/DL4 sobreexpresan tanto los ligandos de notch DL1 y DL4, como los iPSC co-cultivadores con los iPSC pueden promover la diferenciación de células T mediada por la señalización de notch26.
    1. Cultivar iPSC transducidos por genes TCR s183 (s183/iPSC) en la monocapa celular OP9-DL1-DL4 en medios de medio esencial mínimo (MEM) que contengan un 20% de suero bovino fetal (FBS)27. Incluir ligando murine Flt3 (mFlt-3L; concentración final a 5 ng/mL) en el cultivo.
    2. En el día 0, semilla 0.5–1.0 x 105 S183/iPSCs en un plato de cultivo de 10 cm previamente cultivado con células OP9-DL1-DL4. Valide que las células OP9-DL1-DL4 están en una condición de 80%–90% de confluencia.
    3. En el día 5, enjuague los isPC con 10 ml de solución salina con fosfato (PBS), aspirar fuera del PBS, añadir esto a 4 ml de 0,25% de trippsina, e incubar en una incubadora de 37 oC durante 10 minutos después, añadir un suplemento de 8 ml de medios iPSC para poner fin a la digestión de la trippsina. Acumular todas las soluciones digestivas que contienen las células y centrifugar a 400 x g durante 5 min a 15–30 oC.
    4. Aspirar las células sobrenadant asindrantes y resuspender en 10 ml de medios iPSC. Transfiera la suspensión celular a una nueva placa Petri de 10 cm e incubar en una incubadora durante 30 min a 37 oC.
    5. Después de 30 min, recoja el medio iPSC que contiene las celdas flotantes. Pasar la suspensión celular a través de un colador de células de 70 m y calcular el número de celda.
    6. Semilla5 x 105 células en el plato de cultivo previamente cultivado OP9-DL1-DL4 células con una condición de 80% –90% confluente como se describe en el paso 1.3.1.
      NOTA: Para la diferenciación de células T, cada 2-3 días, las celdas derivadas de iPSC necesitan volver a sembrar con una capa nueva de las células OP9-DL1-DL4.
  4. Evaluación
    1. Cambios morfológicos de iPSC diferenciadores
      1. Observe las células bajo un microscopio en varios días.
        NOTA: Para el día 5, las colonias tienen características similares a los mesodermos, exhibiendo una morfología clásica en forma de husillo que se asemeja a los fibroblastos dérmicos humanos y el crecimiento sostenido in vitro. Para el día 8, comienzan a aparecer pequeños grupos redondos de células.
    2. Análisis de la diferenciación de iPSC según la citometría de flujo
      1. En varios días de cocultivo, analice las celdas derivadas de iPSC como se describió anteriormente25 (Figura 1B,C).
    3. Análisis funcional de iPSC diferenciadores
      1. En el día 28 de co-cultivo, recoger células iPSC-CD8+ T de cultivos a través de la cosecha de las células flotantes, trippsinizar las células sobrante con 0.25% de trippsina, volver a suspender en 8 mL de medios iPSC, centrifugar durante 5 min a 400 x g a 15-30 oC, eliminar los medios, luego resuspender las células en 10 mL de medios.
      2. Conservar las células resuspendidas en un plato fresco de 10 cm en una incubadora de 37 oC durante 30 minutos y ensamblar las celdas flotantes. Luego enjuague las células una vez con un PBS frío.
      3. Incubar 3 x 106 t de abetocitos cargados con células (CD4-CD8-) a partir de bazos de H-2 clase I knockout, ratones HLA-A2.1-transgénicos (HHD) con péptido de 5 m s183 (FLLTRILTI) en 200 oL de medios a 4 oC durante 30 min.
      4. Producir una mezcla de células iPSC-CD8+ T con esplenocitos pulsados con péptido s183 (células T: esplenocitos a 1:4; utilizar 0,75 x 106 células T). Incubar la mezcla de células a 37oC en una incubadora deCO2 durante 40 h. Durante las últimas 7 h, añadir 4 l de brefeldina A diluida en el cultivo (concentración final de 1.000x, que se diluirá en 1x medios de cultivo) para bloquear los procesos de transporte durante la activación celular.
      5. Manchar las células y realizar el análisis citométrico de flujo de IFN intracelular como se describió anteriormente(Figura 2).

2. Inducción de la replicación del VHB a través de la entrega hidrodinámica de plásmido del VHB

NOTA: la construcción pAAV/HBV1.2 se generó como se describió anteriormente9. El ADN completo del VHB 1.2 se incorpora en el pAAV vectorial.

  1. Entregas hidrodinámicas de plásmido del VHB a través de la vena de la cola
    1. Caliente los ratones HHD usando una lámpara de calor durante 5 minutos en la jaula con el fin de dilatar la vena de la cola.
    2. Deten al animal por medio de un restrainer, y limpie las colas de ratón con 70% de pulverización de etanol.
    3. Entrega de plásmido en el hígado.
    4. Mida el peso corporal del ratón utilizando una báscula de medición.
    5. Diluir 10 g de plásmido de VHB en el 8% equivalente de pbS de masa corporal (por ejemplo, 1,6 ml para un ratón de 20 g). Cargue el plásmido diluido en una jeringa de 3 ml con una aguja hipodérmica de 26 Ga 1" (0,45 x 12 mm).
    6. Localice una de las dos venas laterales de la cola en el tercio medio de la cola y coloque la aguja en cualquiera de las venas laterales. Administrar la inyección que contiene plásmido del VHB a través de la vena de la cola dentro de 3 - 5 s.
  2. Cuantificación de la viremia a partir del suero sanguíneo de ratones infectados
    NOTA: La replicación del VHB se produce del día 3 al 35 en el suero del ratón. La replicación del ADN alcanza su punto máximo en el día 7 y se reduce gradualmente. El ADN del VHB no se elimina del suero hasta el día 35.
    1. Recolección de suero sanguíneo de ratones infectados
      1. Recoger aproximadamente 0,1 ml de sangre en un tubo de microcentrífuga de cada ratón en 3, 5, 7 y 10 días después de la infección por sangrado retroorbital en un tubo de microcentrífuga de 1,5 ml, luego incubar a temperatura ambiente (RT) durante 20 minutos.
      2. Centrifugar la muestra a 6.000 x g durante 15 min a 4oC y recoger el sobrenadante sérico después de la centrifugación.
    2. Purificar el ADN del suero sanguíneo utilizando un kit de extracción de ADN disponible comercialmente siguiendo las recomendaciones del fabricante. Brevemente, lijar las células en una columna basada en sílice, realizar los lavados, y extraer ADN mediante la adición de 100% etanol a la columna de elución y centrifugación a 6000 x g durante 1 min. Elute el ADN en 50 l de agua libre de RNase.
    3. Utilice 100 ng de ADN del VHB de la elución para el análisis de PCR en tiempo real. Utilice las siguientes imprimaciones y sondas: forward 5' TAGGAGGCTGTAGGCATAAATTGG 3'; reverso 5' GCACAGCTTGGAGGCTTGT 3'; sonda 5' TCACCTCTGCCTAATC 3'.
      1. Utilice el genoma del VHB que contiene plásmido (pAAV/HBV1.2) para la curva estándar y realice PCR en tiempo real en un volumen total de 10 ml(Figura 3).
    4. Configure la reacción de PCR en un volumen total de 10 l como se muestra en la Tabla 1.
    5. Configure el programa PCR en el termociclador como se muestra en la Tabla 2. La velocidad de transición de la temperatura programada es de 20 oC/s para la desnaturalización/recocido y de 5 oC/s para la extensión. Mida la fluorescencia al final de la fase de recocido para cada ciclo para la supervisión de PCR en tiempo real.

3. Reducción de la replicación del VHB por ACT de células virales iPSC-CD8+ T específicas de Ag

  1. Transferencia de celda adoptiva (ACT)
    1. Diferencie s183/iPSCs (1.3.7) sobre las células estromales OP9-DL1-DL4 en presencia de mFlt-3L y mIL-7 durante 8 días como se describe en la sección 1.3.
    2. En el día 22, recoger las células iPSC-CD8+ T de la placa de 10 cm con trippsina, luego lavar y resuspender cada placa de 10 cm en 10 ml de medios frescos. Agregue las células a una placa fresca de 10 cm y vuelva a la incubadora durante 30 minutos como se hace en la sección 1.3. Después de 30 min, recoja las celdas flotantes.
    3. Utilice un colador de nylon de 70 m para pasar celdas para eliminar los cúmulos de células y contar el número de celda. Adapte las células a una concentración de 1,5 x 107 células/ml en solución de PBS fría y utilice un colador de nylon de 70 m para pasar las células para eliminar los racimos celulares de nuevo si es necesario. Mantenga las células en hielo hasta el ACT.
    4. Inyectar la suspensión celular de 200 l (3 x 106 células) en ratones hEH de 4 a 6 semanas de edad a través de la vena de la cola.
  2. Inducción de la replicación del VHB
    1. El día 14 después de la transferencia celular, realice la entrega hidrodinámica de plásmido del VHB a través de la vena de la cola como se describe en la sección 2.1.
  3. Detección de proteínas de virus del hígado infectado
    1. Sacrificar ratones en los días 3, 5, 7, 14 y 21 después de la infección. Para la eutanasia, en cada jaula, utilice 1-2 L de dióxido de carbono (CO2)en la primera etapa. Cuando el animal desarrolla la pérdida de conciencia, obtener el caudal de CO2 alrededor de 4–5 L/min. Realizar la eutanasia de ratón utilizando la inhalación de CO2.
    2. Separe el hígado cortando la piel superficial del peritoneo utilizando tijeras y fórceps y arrastrando ligeramente el hígado hacia atrás para descubrir la piel interna que recubre la cavidad peritoneal. Recoger y cortar muestras de hígado (largo x ancho x alto á 0,5 cm x 0,5 cm X 0,3 cm) de los ratones infectados para caber fácilmente en el casete de incrustación y bloquear en 10% de formalina tampón neutro durante 4-24 h.
    3. Descalcificar las muestras de hígadoutilizando 2.5 M de ácido fórmico; Enjuagar en xileno durante 3 min, enjuagar 2veces en 100% etanol, enjuagar 2veces en etanol 95%, enjuagar 2veces en agua desionizada (DI) durante 2 min, luego descalcificar las muestras de hígado en 1 mM de ácido etilenodiaminetetraacético (EDTA) correspondientemente. Manipular a una temperatura de sub-ebullición (90 oC) durante 20 min.
    4. Enfriar los tejidos hepáticos fijos durante 30 min. Enjuagar los tejidos con 1x PBS durante 4 min e incrustar los tejidos en parafina. Deshidratar los tejidos en una serie de concentraciones crecientes de etanol para reemplazar el agua, y luego sumergiren en la inmersión de xileno. Incruste los tejidos infiltrados en bloques de cera. Hacer secciones uniformemente verticales y horizontales para la tinción. Preparar secciones de 4 m con un microtome deslizante.
    5. Pasar las secciones a través de la desparafinación y rehidratación utilizando xileno y etanol, luego realizar la tinción inmunofluorescente de las secciones.
    6. Manchar las secciones con 200 l de anticuerpo específico de Ag de superficie de VHB (dilución 1:100 en la solución de bloqueo). Incubar las secciones con el anticuerpo durante 2 h a RT en una cámara humidificada 75%-100%, y lavar 5 veces en 1x PBS durante 5 min.
    7. Utilice un reactivo anti-fade que contenga 4',6-diamidino-2-phenylindole (DAPI) para la tinción nuclear para contrarrestar las diapositivas. Agregue el cubreobjetos con aproximadamente 300 ml de la solución de tinción DAPI diluida (300 nM en 1x PBS) y valide toda la cubierta cubierta cubierta. Mantenga las diapositivas en la oscuridad a 4 oC hasta que las inspeccionebajo de un microscopio fluorescente.
  4. Infiltración inflamatoria celular en ratones infectados
    1. Sacrificar ratones como se describe en el paso 3.3.1. Recoja el hígado y haga secciones como se describe en el paso 3.3.4.
    2. Manchar la sección con hematoxilina y eosina (H&E) para evaluar la infiltración de células inflamatorias en el hígado.
    3. Almacene las diapositivas en la oscuridad a 4 oC hasta que se puedan realizar más análisis bajo un microscopio fluorescente.
    4. Visualizar diapositivas bajo un microscopio de fluorescencia para detectar la infiltración de células inflamatorias en el hígado(Figura 4).
  5. Detección de ADN del VHB del hígado infectado
    1. Aislamiento del ADN viral.
    2. Euthanizar ratones y recoger las muestras de hígado de acuerdo con la sección 3.3.
    3. Lise los tejidos hepáticos en Tampón de lisis No Indet P-40 (NP-40) (50 mM Tris-HCL, 1 mM EDTA, 1% NP-40) que contiene un cóctel inhibidor de la proteasa.
    4. Centrifugar brevemente a 16.000 x g para eliminar los núcleos y los restos celulares.
    5. Incubar el lisado citoplasmático con nucleasa microcócica (nucleasa S7; 150 unidades/ml) y CaCl2 (5 mM) a 37 oC durante 90 minutos para degradar el ácido nucleico fuera de los nuclerópsidos (NC).
    6. Inactivar la nucleasa S7 mediante la adición de 10 mM EDTA.
    7. Precipitar los nucleocápsidos con polietilenglicol (PEG), interrumpir en un 0,5% de sulfato de dodecilo sódico (SDS) y digerir con 0,6 mg/ml de proteína K (PK) a 37 oC durante 1 h.
    8. Recuperar los ácidos nucleicos virales mediante la extracción de cloroformo de fenol y la precipitación de etanol.
    9. Resuelva el ADN viral extraído en un gel de agarosa del 1,2% y detecte mediante un análisis estándar de la mancha sureña utilizando una sonda de ADN HBV con etiqueta P32.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Como se muestra aquí, las células virales de HBV Ag-específicas iPSC-CD8+ T son generadas por un sistema de cultivo in vitro. Después de ACT de estas células virales iPSC-CD8+ T específicas de Ag suprimen sustancialmente la replicación del VHB en un modelo murino (Archivo Suplementario 1). Los iPSC de ratón se transdulan con la construcción retroviral MIDR que codifica un gen TCR híbrido de VHH humano-ratón (HBs183-191-específico, s183), luego los iPSC transducidos por genes se co-cultivan con células OP9-DL1/DL4 que expresan ligandos de muesca (tanto DL1 como DL4) moléculas en presencia de rFlt3L y rIL-7. En el día 28 del cocultivo in vitro, las células derivadas de iPSC expresan sustancialmente CD3 y TCR específico de Ag (marcadores de células T). El análisis citométrico de flujo de la población CD3+CD8+ muestra que la transducción del TCR del VHB aumenta drásticamente la generación de células CD8+ T específicas de s183 virales(Figura 1).

En el día 28 del cocultivo in vitro, las células CD4-CD8+ monopositivo (SP) iPSC-CD8+ T son aisladas y estimuladas por los astillocitos agotados por T que se pulsan con péptido s183, y se evalúa la producción de citoquinas. Los iPSC-CTL producen grandes cantidades de IL-2 e IFN-O detectados por tinción intracelular o ELISA(Figura 2). La infección por VHB se induce en ratones transgénicos HLA-A2.1 (HHD) mediante inyección hidrodinámica de 10 g de plásmido de ADN pAAV/HBV1.2 a través de las venas de la cola de los ratones. La replicación del VHB se detecta del día 3 al 21 en el suero de los ratones con HHD. La replicación del ADN alcanza su punto máximo en el día 6 y se reduce gradualmente utilizando el análisis de PCR en tiempo real(Figura 3).

Dos semanas después del ACT, los ratones son desafiados con una inyección hidrodinámica de plásmido de ADN pAAV/HBV1.2. El titador viral se mide mediante PCR en tiempo real desde el suero en varios puntos de tiempo después de la inyección. Los resultados demuestran que la replicación viral se reduce significativamente en todos los puntos de tiempo en los ratones que reciben células T virales específicas del VHB en comparación con los ratones que reciben células de control(Figura 4A). La expresión de proteína superficial del VHB también se examina en el hígado en el entorno anterior del tratamiento. Los ratones se eutanasia a los días siguiente de la inyección de VHB y las muestras de hígado se aíslan para el examen histológico. Las muestras se tiñen para la proteína superficial del VHB y se examinan bajo un microscopio de fluorescencia. Se observa que la proteína superficial del VHB disminuyó sustancialmente en los ratones que reciben pre-iPSC-CTL virales de AG, en comparación con los ratones que reciben células de control(Figura 4B). Este experimento demuestra claramente que las células virales iPSC-CD8+ T específicas de Ag tienen la capacidad de reducir la replicación del VHB en el modelo murino.

Figure 1
Figura 1: Generación de células virales de HBV específicas de Ag iPSC-CD8+ T.
Los iPSC de ratón se transduyen con las siguientes construcciones retrovirales: HBs183-91 TCR (MiDR-s183 TCR) o OVA257–264 TCR (MiDR-OVA TCR), y los iPSC transducidos se co-cultivan con células estromas OP9-DL1/DL4 para la diferenciación de línea Tage. (A) Representación esquemática de la construcción retroviral MiDR-s183 TCR que expresa TCR específico de s183. • Señal de embalaje; 2A - secuencia 2A autoceling de picornavirus; LTR: repeticiones largas del terminal. (B) Morfología de la diferenciación de células T en los días 0, 7, 14 y 22. (C) Análisis citométrico de flujo para las celdas derivadas de iPSC en el día 28. CD3+CD8+ células (izquierda) se ensaquean según lo indicado y se analizan para la expresión de CD8 y TCRV-28 (derecha). Los datos mostrados son representativos de tres experimentos individuales. Los valores representan la media de SD (**p < 0.01; pruebas t emparejadas). Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: Análisis funcional de las células iPSC-CD8+ T virales del VHB.
El día 28 del cocultivo in vitro, se ordenan las células SP CD8+s183 TCR pentamer+ iPSC-T. Las células iPSC-T y las células CD8+ T transducidas con TCR MiDR-s183 son estimuladas por los astillocitos t agotados (APC) de ratones HHD y pulsadas con péptido s183 (FLLTRILTI). (A) Tinción intracelular de IFN-A después de 7 h (cerrado en CD8+ células) (T/APCs n.o 1:4). (B) ELISA de IFN-o después de 40 h. Los datos mostrados son representativos de tres experimentos individuales. Los valores representan la media de SD (n.s., p > 0,05; pruebas t emparejadas). Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: Inducción de la replicación del VHB en ratones con HHD mediante inyección hidrodinámica.
Los ratones HHD son administrados con plásmido de VHB mediante inyección hidrodinámica de venas de cola. Se inyecta 10 g de plásmido con un 8% de la masa corporal total pbS. En los puntos de tiempo indicados después de la inyección, el suero se aísla de la sangre y se extrae ADN para PCR en tiempo real. Los datos mostrados son representativos de tres experimentos individuales. Los valores representan la media de SD. Los datos son representativos de cinco ratones por grupo de tres experimentosindependientes. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4: Reducción de la replicación del VHB mediante ACT de células virales iPSC-CD8+ T específicas de Ag.
Los ratones HHD son transferidos adoptivamente con progenitores virales de células iPSC-CD8+ T específicos de Ag (el día 22 del cultivo in vitro) y administrados con plásmido del VHB en la semana 2 después de la transferencia celular. (A) Copias séricas del VHB. En los momentos indicados después de la inyección, el suero se aísla de la sangre y se extrae ADN para el análisis de PCR en tiempo real. Los datos mostrados son representativos de tres experimentos individuales. Los valores representan la media de SD. (B) Histología del tejido hepático. Los ratones se eutanasia en el día 8 de la infección posterior al VHB. Las muestras hepáticas están aisladas y teñidas para el examen histológico. El panel superior muestra la expresión de proteína HBsAg en ratones infectados (tinción IHC) y el panel inferior muestra la infiltración de células inflamatorias (tinción HE). Los datos son representativos de cinco ratones por grupo de tres experimentos independientes. Haga clic aquí para ver una versión más grande de esta figura.

Plantilla de ADN 2 ml
Mezcla de hibridación maestra de ADN ((Taq DNA polymerase, buffer de reacción PCR, 10 mM MgCl2 y mezcla dNTP) 1 ml
25 mM MgCl2 0,8 ml
0,3 m de la sonda 3 ml
5 M de cada imprimación 3,2 ml
Total 10 ml

Tabla 1: Volumen de reacción de PCR

Temperatura hora
Desnaturalización 95 oC 5 s
Recocido 53 oC 10 s
Extensión 72 oC 20 s
5 oC

Tabla 2: Programa PCR

Archivo Suplementario 1: Haga clic aquí para descargar este archivo.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Este protocolo presenta un método para generar los iPSC-CTL virales específicos de Ag para su uso como ACT para suprimir la replicación del VHB en un modelo murino. En la infección crónica por el VHB, el genoma viral forma un minicromo estable, el ADN circular covalentemente cerrado (CCCDNA) que puede persistir a lo largo de la vida útil del hepatocito. Dirigirse al aclaramiento del mini cromosoma viral puede dar lugar a una cura de la infección crónica por el VHB. La terapia antiviral actual se dirige al virus a la transcriptasa inversa, pero rara vez establece un control inmunológico sobre la replicación del VHB impulsada por el ADNC cccDNA. CD8+ CTL específicos del VHB pueden mediar la muerte de los hepatocitos infectados y acelerar el aclaramiento del ADNC ccc. Sin embargo, los CTL específicos del VHB se eliminan, se disfuncionales o se sucumben al agotamiento en pacientes con infección crónica por VHB. ACT con los CTL específicos del VHB es un tratamiento favorable para la infección crónica por VHB28,29. Los linfocitos T derivados de células T ingenuas o centrales (es decir, células inmunitarias altamente reactivas) son efectores ideales para las terapias basadas en ACT debido a su gran proliferación, menor tendencia a la muerte en comparación con las células diferenciadas terminalmente, y excelente capacidad de responder a las citoquinas homeostáticas. Sin embargo, este ACT a menudo no ha sido factible debido a dificultades para obtener un número suficiente de CTL de los pacientes. Se ha demostrado anteriormente que la reprogramación de los CTL específicos de Ag ode las reglas T de los iPSC se puede utilizar para las terapias basadas en células20,23,27,30. Este informe demuestra un método para generar iPSC-CTL virales específicos de Ag y utilizar estas células para la inmunoterapia basada en ACT en un modelo murino de replicación del VHB.

Aunque existen modelos de ratón transgénicos de replicación del VHB, estos modelos son desafiantes porque la tolerancia central inducida por los productos genéticos transgénicos hace que los ratones sean inmunes a los VHB Ags. Además, los ratones transgénicos no son adecuados para controlar el aclaramiento viral, ya que el genoma del VHB integrado persiste en cada celda del ratón31,32. Además, a pesar de que se han desarrollado vacunas exitosas para prevenir la infección, el tratamiento o la inmunoterapia después de la infección por el VHB no se ha desarrollado. Además, los enfoques experimentales de la patogénesis del VHB se han visto obstaculizados porque el rango de acogida de infección por VHB se limita a los hombres y los chimpancés, y el sistema de cultivo in vitro para la propagación del VHB no es suficiente. Cd8+ T células son células efector prometedoras contra varios tipos de infección viral; sin embargo, la respuesta de las células T contra el VHB no es abundante. La causa puede ser la especificidad, el funcionamiento y la falta de números suficientes para montar una respuesta inmunitaria. Este informe revela el método de inyección hidrodinámica que induce eficientemente la replicación del VHB en ratones. El método permite la entrega de una gran cantidad de plásmido del VHB directamente en el hígado. El modelo exhibe viremia continua durante más de 8 semanas con detección de ARNm de VHB, proteína y ADN en diferentes días después de la inyección. Este método para la replicación del VHB en ratones es útil para la inmunoterapia con VHB.

En resumen, la replicación del VHB se indujo con éxito en ratones a través del procedimiento de inyección hidrodinámica, y los iPSC-CTL virales específicos de Ag se utilizaron como inmunoterapia para la replicación del VHB. Sin embargo, hay dos limitaciones del método: (1) más de tres semanas de diferenciación in vitro de células T puede reducir las aplicaciones traslacionales de las células T generadas para ACT; y (2) La inyección hidrodinámica del VHB puede inducir eficientemente la replicación del VHB en el hígado; sin embargo, no forma el CCCDNA, que es la razón principal de la infección persistente por el VHB. Sin embargo, el método proporciona un enfoque alternativo para la replicación y el tratamiento del VHB. Es probable que un régimen combinado que utilice medicamentos anti-VHB y el ACT de iPSC-CTL virales específicos de Ag reduzca los reservorios de VIH, lo que resulta en un tratamiento para la infección crónica por VIH.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Los autores agradecen al Dr. Adam J Gehring del Instituto de Investigación del Hospital General de Toronto por proporcionar ADNc para HBs183-91 (s183) (FLLTRILTI)- genes TCR híbridos humano-murinos específicos restringidos en A2, y el Dr. Pei-Jer Chen de la Universidad Nacional de Taiwán para proporcionar construcción pAAV/HBV 1.2. Este trabajo es apoyado por el Instituto Nacional de Salud Grant R01AI121180, R01CA221867 y R21AI109239 a J. S.

Materials

Name Company Catalog Number Comments
HHD mice Institut Pasteur, Paris, France H-2 class I knockout, HLA-A2.1-transgenic (HHD) mice
iPS-MEF-Ng-20D-17 RIKEN Cell Bank APS0001
SNL76/7 ATCC SCRC-1049
OP9 ATCC CRL-2749
pAAV/HBV1.2 plasmid Dr. Dr. Pei-Jer Chen (National Taiwan University Hospital, Taiwan) HBV DNA construct
HBs183-91(s183) (FLLTRILTI)-specific TCR genes Dr. Adam J Gehring (Toronto General Hospital Research Institute, Toronto, Canada) FLLTRILTI-specific A2-restricted human-murine hybrid TCR genes (Vα34 and Vβ28)
OVA257–264-specific TCR genes Dr. Dario A. Vignali (University of Pittsburgh, PA) SIINFEKL-specific H-2Kb-restricted TCR genes
Anti-CD3 (17A2) antibody Biolegend 100236
Anti-CD44 (IM7) antibody BD Pharmingen 103012
Anti-CD4 (GK1.5) antibody Biolegend 100408
Anti-CD8 (53-6.7) antibody Biolegend 100732
Anti-IFN-γ (XMG1.2) antibody Biolegend 505810
Anti-TNF-a (MP6-XT22) antibody Biolegend 506306
α-MEM Invitrogen A10490-01
Anti-HBs antibody Thermo Fisher MA5-13059
ACK Lysis buffer Lonza 10-548E
Brefeldin A Sigma B7651
DMEM Invitrogen ABCD1234
FBS Hyclone SH3007.01
FACSAria Fusion cell sorter BD 656700
Gelatin MilliporeSigma G9391
GeneJammer Agilent 204130
HLA-A201-HBs183-91-PE pentamer Proimmune F027-4A - 27
HRP Anti-Mouse Secondary Antibody Invitrogen A27025
mFlt-3L Peprotech 250-31L
mIL-7 Peprotech 217-17
Nuclease S7 Roche 10107921001
Paraformaldehyde MilliporeSigma P6148-500G Caution: Allergenic, Carcenogenic, Toxic
Permeabilization buffer Biolegend 421002
Polybrene MilliporeSigma 107689
ProLong™ Gold Antifade Mountant with DAPI Invitrogen P36931
QIAamp MinElute Virus Spin Kit Qiagen 57704

DOWNLOAD MATERIALS LIST

References

  1. Scaglione, S. J., Lok, A. S. Effectiveness of hepatitis B treatment in clinical practice. Gastroenterology. 142, (6), 1360-1368 (2012).
  2. Osiowy, C. From infancy and beyond... ensuring a lifetime of hepatitis B virus (HBV) vaccine-induced immunity. Human Vaccines & Immunotherapeutics. 14, (8), 2093-2097 (2018).
  3. Gish, R. G., et al. Loss of HBsAg antigen during treatment with entecavir or lamivudine in nucleoside-naive HBeAg-positive patients with chronic hepatitis B. Journal of Viral Hepatitis. 17, (1), 16-22 (2010).
  4. Kurktschiev, P. D., et al. Dysfunctional CD8+ T cells in hepatitis B and C are characterized by a lack of antigen-specific T-bet induction. Journal of Experimental Medicine. 211, (10), 2047-2059 (2014).
  5. Fisicaro, P., et al. Antiviral intrahepatic T-cell responses can be restored by blocking programmed death-1 pathway in chronic hepatitis B. Gastroenterology. 138, (2), 682-693 (2010).
  6. Schurich, A., et al. The third signal cytokine IL-12 rescues the anti-viral function of exhausted HBV-specific CD8 T cells. PLoS Pathogens. 9, (3), 1003208 (2013).
  7. Gehring, A. J., et al. Engineering virus-specific T cells that target HBV infected hepatocytes and hepatocellular carcinoma cell lines. Journal of Hepatology. 55, (1), 103-110 (2011).
  8. Xia, Y., et al. Interferon-gamma and Tumor Necrosis Factor-alpha Produced by T Cells Reduce the HBV Persistence Form, cccDNA, Without Cytolysis. Gastroenterology. 150, (1), 194-205 (2016).
  9. Huang, L. R., Wu, H. L., Chen, P. J., Chen, D. S. An immunocompetent mouse model for the tolerance of human chronic hepatitis B virus infection. Proceedings of the National Academy of Sciences U.S.A. 103, (47), 17862-17867 (2006).
  10. Wong, P., Pamer, E. G. CD8 T cell responses to infectious pathogens. Annual Review of Immunology. 21, 29-70 (2003).
  11. Murray, J. M., Wieland, S. F., Purcell, R. H., Chisari, F. V. Dynamics of hepatitis B virus clearance in chimpanzees. Proceedings of the National Academy of Sciences USA. 102, (49), 17780-17785 (2005).
  12. Hinrichs, C. S., et al. Adoptively transferred effector cells derived from naive rather than central memory CD8+ T cells mediate superior antitumor immunity. Proceedings of the National Academy of Sciences U.S.A. 106, (41), 17469-17474 (2009).
  13. Hinrichs, C. S., et al. Human effector CD8+ T cells derived from naive rather than memory subsets possess superior traits for adoptive immunotherapy. Blood. 117, (3), 808-814 (2011).
  14. Kerkar, S. P., et al. Genetic engineering of murine CD8+ and CD4+ T cells for preclinical adoptive immunotherapy studies. Journal of Immunotherapy. 34, (4), 343-352 (2011).
  15. Kuball, J., et al. Facilitating matched pairing and expression of TCR chains introduced into human T cells. Blood. 109, (6), 2331-2338 (2007).
  16. van Loenen, M. M., et al. Mixed T cell receptor dimers harbor potentially harmful neoreactivity. Proceedings of the National Academy of Sciences USA. 107, (24), 10972-10977 (2010).
  17. Cameron, B. J., et al. Identification of a Titin-derived HLA-A1-presented peptide as a cross-reactive target for engineered MAGE A3-directed T cells. Science Translational Medicine. 5, (197), (2013).
  18. Fedorov, V. D., Themeli, M., Sadelain, M. PD-1- and CTLA-4-based inhibitory chimeric antigen receptors (iCARs) divert off-target immunotherapy responses. Science Translational Medicine. 5, (215), (2013).
  19. Maus, M. V., et al. T cells expressing chimeric antigen receptors can cause anaphylaxis in humans. Cancer Immunolology Research. 1, (1), 26-31 (2013).
  20. Haque, R., et al. Programming of regulatory T cells from pluripotent stem cells and prevention of autoimmunity. Journal of Immunology. 189, (3), 1228-1236 (2012).
  21. Vizcardo, R., et al. Regeneration of human tumor antigen-specific T cells from iPSCs derived from mature CD8(+) T cells. Cell Stem Cell. 12, (1), 31-36 (2013).
  22. Nishimura, T., et al. Generation of rejuvenated antigen-specific T cells by reprogramming to pluripotency and redifferentiation. Cell Stem Cell. 12, (1), 114-126 (2013).
  23. Lei, F., et al. In vivo programming of tumor antigen-specific T lymphocytes from pluripotent stem cells to promote cancer immunosurveillance. Cancer Research. 71, (14), 4742-4747 (2011).
  24. Kim, J. B., et al. Oct4-induced pluripotency in adult neural stem cells. Cell. 136, (3), 411-419 (2009).
  25. Lei, F., Haque, R., Xiong, X., Song, J. Directed differentiation of induced pluripotent stem cells towards T lymphocytes. Journal of Visualized Experiments. (63), e3986 (2012).
  26. Lei, F., Haque, M., Sandhu, P., Ravi, S., Ni, Y., Zheng, S., Fang, D., Jia, H., Yang, J. M., Song, J. Development and characterization of naive single-type tumor antigen-specific CD8+ T lymphocytes from murine pluripotent stem cells. OncoImmunology. 6, (2017).
  27. Haque, M., et al. Melanoma Immunotherapy in Mice Using Genetically Engineered Pluripotent Stem Cells. Cell Transplantation. 25, (5), 811-827 (2016).
  28. Tan, A. T., et al. Use of Expression Profiles of HBV DNA Integrated Into Genomes of Hepatocellular Carcinoma Cells to Select T Cells for Immunotherapy. Gastroenterology. (2019).
  29. Wu, L. L., et al. Ly6C(+) Monocytes and Kupffer Cells Orchestrate Liver Immune Responses Against Hepatitis B Virus in Mice. Hepatology. (2019).
  30. Haque, M., et al. Stem cell-derived tissue-associated regulatory T cells suppress the activity of pathogenic cells in autoimmune diabetes. Journal of Clinical Investigation Insights. (2019).
  31. Chisari, F. V., et al. Structural and pathological effects of synthesis of hepatitis B virus large envelope polypeptide in transgenic mice. Proceedings of the National Academy of Sciences USA. 84, (19), 6909-6913 (1987).
  32. Wirth, S., Guidotti, L. G., Ando, K., Schlicht, H. J., Chisari, F. V. Breaking tolerance leads to autoantibody production but not autoimmune liver disease in hepatitis B virus envelope transgenic mice. Journal of Immunology. 154, (5), 2504-2515 (1995).
Linfocitos T virales derivados de células madre suprimen la replicación del VHB en ratones
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).More

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter