Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Tomatrod Transformation Efterfulgt af podning med Ralstonia Solanacearum for ligetil genetisk analyse af bakteriel visnesygdom

doi: 10.3791/60302 Published: March 11, 2020

Summary

Her præsenterer vi en alsidig metode til tomatrodtransformation efterfulgt af podning med Ralstonia solanacearum for at udføre ligetil genetisk analyse til undersøgelse af bakteriel visnesygdom.

Abstract

Ralstonia solanacearum er en ødelæggende jordbårne vaskulære patogen, der kan inficere en lang række plantearter, der forårsager en betydelig trussel mod landbruget. Men, Ralstonia model er betydeligt underudforsket i forhold til andre modeller, der involverer bakterielle plante patogener, såsom Pseudomonas syringae i Arabidopsis. Forskning, der er målrettet mod at forstå samspillet mellem Ralstonia og afgrødeplanter, er afgørende for at udvikle bæredygtige løsninger til bekæmpelse af bakteriel leflen, men er i øjeblikket hæmmet af manglen på enkle eksperimentelle analyser for at karakterisere de forskellige komponenter i samspillet i indfødte værtsplanter. I dette scenario har vi udviklet en metode til at udføre genetisk analyse af Ralstonia infektion af tomat, en naturlig vært for Ralstonia. Denne metode er baseret på Agrobacterium rhizogenes-medieret transformation af tomat rødder, efterfulgt af Ralstonia jord-drenching podning af de resulterende planter, der indeholder transformerede rødder udtrykke konstruktion af interesse. Alsidigheden af rodtransformationsanalysen gør det muligt at udføre enten genoverekspression eller genhæmning medieret af RNAi. Som et proof of concept, vi brugte denne metode til at vise, at RNAi-medieret lyddæmpning af SlCESA6 i tomat rødder gav resistens over for Ralstonia. Her beskriver vi denne metode i detaljer, så genetiske tilgange til at forstå bakteriel visne sygdom i en relativt kort tid og med små krav til udstyr og plantevækst plads.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ralstonia solanacearum, årsagssammenhæng agent for bakteriel visne sygdom, er en ødelæggende jordbårne vaskulære patogen med en verdensomspændende fordeling, der kan inficere en lang række plantearter, herunder kartoffel, tomat, tobak, banan, peber og aubergine, blandt andre1,2. Udbyttetab forårsaget af Ralstonia kan nå 80-90% af produktionen i tomat, kartoffel eller banan, afhængigt af sort, klima, jord og andre faktorer3. Men, Ralstonia model er betydeligt underudforsket i forhold til andre modeller, der involverer bakterielle plante patogener, såsom Pseudomonas syringae eller Xanthomonas spp. Derudover er de fleste undersøgelser i plante-mikrobe interaktioner fokuseret på modellen plante Arabidopsis thaliana. Selv om forskning ved hjælp af disse modeller i høj grad har bidraget til vores forståelse af plante-bakterier interaktioner, de ikke løse den nuværende nødvendighed for at forstå disse interaktioner i afgrøder planter. Forskning, der er målrettet mod at forstå samspillet mellem Ralstonia og afgrødeplanter, er afgørende for at udvikle bæredygtige løsninger til bekæmpelse af bakteriel leflen, men er i øjeblikket hæmmet af manglen på enkle eksperimentelle analyser, der karakteriserer de forskellige komponenter i interaktionen. Især tomat, en naturlig vært for Ralstonia, er den næstvigtigste vegetabilske afgrøde på verdensplan og er ramt af en overflod af sygdomme4, herunder bakteriel visne sygdom. I dette arbejde har vi udviklet en nem metode til at udføre genetisk analyse af Ralstonia infektion af tomat. Denne metode er baseret på Agrobacterium rhizogenes-medieret transformation af tomat rødder, ved hjælp af DsRed fluorescens som udvælgelse markør5, efterfulgt af Ralstonia jord-drenching podning af de resulterende planter, der indeholder transformerede rødder udtrykke konstruktion af interesse. Alsidigheden af rodtransformationsanalysen gør det muligt at udføre enten genoverekspression eller genhæmning medieret af RNAi.

En potentiel begrænsning af denne metode består i den resterende vækst af ikke-transformerede rødder. Dette er især vigtigt i de tilfælde, hvor plasmid anvendes mangler en reporter gen, der tillader udvælgelse af omdannede rødder. For at løse dette problem har vi udviklet en alternativ metode baseret på antibiotikaudvælgelse, som hæmmer væksten af ikke-transformerede rødder, samtidig med at vi tillader vækst af sunde antibiotikaresistente transformerede rødder. Da A. rhizogenes ikke fremkalder omdannelse af skud, er de modtagelige for antibiotika, og de bør derfor holdes adskilt fra det antibiotiske medium.

Selv om plantenmodstand mod Ralstonia ikke er godt forstået, har flere rapporter forbundet cellevæg ændringer til øget resistens over for bakteriel visne6,7,8,9. Det er blevet foreslået, at disse cellevæg ændringer påvirker vaskulær udvikling, et væsentligt aspekt for livsstil Ralstonia inde i anlægget10. Mutationer i gener, der koder cellulosesynthaserne CESA4, CESA7 og CESA8 i Arabidopsis thaliana, har vist sig at forringe sekundære cellevægintegritet, hvilket medfører øget resistens over for Ralstonia, som synes at være forbundet med ABA-signalering8. Derfor, som et proof of concept for vores metode, udførte vi RNAi-medieret genhæmning af SlCESA6 (Solyc02g072240), en sekundær celle-væg cellulose syntase, og ortolog af AtCESA8 (At4g18780). Efterfølgende jord-drenching vaccination med Ralstonia viste, at lyddæmpning SlCESA6 øget resistens over for bakterielle visne symptomer, hvilket tyder på, at celle væg-medieret resistens over for Ralstonia sandsynligvis bevares i tomat, og validering af vores metode til at udføre genetisk analyse af bakteriel visneresistens i tomat rødder. Her beskriver vi denne metode i detaljer, så genetiske tilgange til at forstå bakteriel visne sygdom i en relativt kort tid og med små krav til udstyr og plantevækst plads.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

BEMÆRK: Vigtige dele af denne metode omfatter håndtering af plantematerialer in vitro, og derfor er det vigtigt at holde sterile forhold under alle disse procedurer, herunder visualisering af DsRed fluorescens. Under hele transformationsprocessen vokser tomatplanter ved 25−28 °C og 16 h/8 h lys/mørke (130 μmolfotoner m-2s-1 lys). Pladerne forsegles med mikroportape for at lette gasudveksling og -transpiration.

1. Fremstilling af tomatplanter og Agrobacterium rhizogenes

  1. Sterilisere tomatfrø(Solanum lycopersicum cv. Moneymaker, LA2706, Tomato Genetics Resource Center, TGRC) med 5% (v/v) natriumhypochlorit i 5 min. Vask 4-5 gange med destilleret sterilt vand og hold frøene langsomt ryster i sterilt vand over natten for at lette spiring.
  2. Overfør tomatfrøene til murashige- og skoog-mediet med halv styrke (1/2 MS) uden saccharose (2,21 g/L MS, 8% w/v agar). Frøene holdes i mørke ved 25−28 °C i tre dage (Figur 1A).
    BEMÆRK: Der er normalt brug for omkring 40 frø til hver konstruktion.
  3. Autoklave 8,5 cm2 firkantede filterpapir. Placer de firkantede filterpapir inde 9 cm2 firkantede petriskåle indeholdende 1/2 MS medium (placer papiret oven på agaren) og læg seks spirede tomatfrø på hver plade (Figur 1B). Pladen forsegles med mikroportape, og de spirede frø forsegles ved 25−28 °C i 3−4 dage.
  4. Grow Agrobacterium rhizogenes MSU440 i fast LB medium (med passende antibiotika) ved 28 °C to dage før plantens transformation.
    BEMÆRK: A. rhizogenes leveres af Dr. Juan Antonio López Ráez, EEZ-CSIC, Granada, Spanien. I det eksperiment, der er beskrevet i denne artikel, A. rhizogenes indeholder pK7GWIWG2_II-RedRoot::CESA6 eller en tom vektor, som kontrol, blev brugt. pK7GWIWG2_II-RedRoot indeholder en reporter gen, DsRed, drevet af Arabidopsis thaliana ubiquitin promotor (pAtUBQ10), og giver resistens over for spectinomycin (50 μg/mL). Det er muligt at bruge andre vektorer til genoverekspression, som rapporteret før5. I dette arbejde blev forstærkningen af det specifikke fragment til SlCESA6 hæmning opnås ved omvendt transskription (RT) PCR ved hjælp af RNA isoleret fra tomat (S. lycopersicum cv. Moneymaker) og ligated i p-ENTR/D-TOPO vektor (Tabel 1). Efterfølgende blev SlCESA6-RNAi fragmentet klonet ind i pK7GWIWG2_II-RedRoot binære vektor.

2. Planteomdannelse og -udvælgelse

  1. Ved hjælp af en steril skalpel, skæreradiklen og bunden af hypocotyl af tomat planter (Figur 1C,D).
  2. Høst A. rhizogenes biomasse fra overfladen af LB medium ved hjælp af plast tips eller en skalpel klinge og omhyggeligt dyppe de afskårne tomat planter i bakteriel biomasse (Figur 1E).
  3. Efter podning med A. rhizogenesdækkes tomatplanterne med et 2 cm x 4 cm halvcirkelformet filterpapir (Figur 1F) for at holde en høj luftfugtighed og lette overlevelseog ny rodudvikling.
  4. Opbevar de transformerede tomatplanter i 6-7 dage. Brug derefter en steril skalpel til at klippe de nye nye behårede rødder(Figur 1G, H; på dette trin er rødderne ikke forvandlet endnu) og lade frøplanterne producere nye behårede rødder.
  5. Når anden generation af nye behårede rødder vises (Figur 1I), skal du fjerne filterpapiret oven på planterne og forsegle pladen med mikroporetape igen.
    BEMÆRK: På dette tidspunkt gør tilstedeværelsen af DsRed fluorescerende markør i transformationsvektoren det muligt at visualisere transformationseffektiviteten i de nye rødder.
  6. Hvis du vil visualisere Fluorescens fra DsRed, skal du bruge et stereomikroskop eller andet udstyr til anlæg in vivo-billeddannelse (figur 1J). Marker de positive (rød fluorescens) transformerede rødder og fjern de negative ikke-transformerede rødder (ingen rød fluorescens) ved hjælp af en steril skalpel.
  7. Frøplanterne, der viser rød fluorescens, overføres til en ny plade, der indeholder 1/2 MS-medium, for at lette udviklingen af den transformerede rod som hovedrod (figur 1K). Hold de frøplanter, der ikke viser rød fluorescens i samme plade for at kontrollere fremkomsten af fluorescerende rødder (Figur 1L) på et senere tidspunkt.
  8. Alternativ metode baseret på valg af antibiotika
    1. Alternativ til trin 2.5 fremstilles halvfyldte 9 cm2 kvadratplader indeholdende 1/2 MS-medium med det relevante antibiotikum. Hæld pladerne ca. 5° under klargøringsprocessen for at generere et tomt rum uden medium (Figur 2A), så skuddene kan vokse, så de undgår kontakt med antibiotikummet.
    2. Alternativ til trin 2.6, efter at skære de første ikke-transformerede behårede rødder opstod (trin 2.4), overføre frøplanter uden rødder til den halvfyldte plader ved hjælp af filterpapir med passende størrelse (Figur 2B).
      BEMÆRK: Som positiv kontrol anbefales det at omdanne flere kimplanter med en plasmid, der indeholder samme antibiotikaresistens og et reporter-gen (i denne protokol, pK7GWIWG2_II-RedRoot; kanamycin 50 μg/ml).
    3. Alternativ til trin 2.7, lad frøplanterne udvikle nye behårede rødder og skære de rødder, der ikke er i direkte kontakt med overfladen af filteret sandwich papirer, da disse rødder kan undgå antibiotika udvælgelse.
      BEMÆRK: På grund af den antibiotiske virkning kan rodudviklingen være langsommere end i plader uden antibiotika. Nye transformerede behårede rødder vises inden for 14-18 dage efter overførsel af frøplanter uden rødder til de halvfyldte plader (trin 2.8.2) (Figur 2C-E).
  9. Dæk planterne med et 2 cm x 4 cm halvcirkelfilterpapir, forsegle pladen og inkuber egerne plantagerne for at lade dem udvikle nye behårede rødder.
    BEMÆRK: Det er ikke nødvendigt at fjerne A. rhizomer ved hjælp af antibiotika. Filterpapiret oven på MS-mediet og manglen på saccharose hæmmer spredningen af A. rhizogenes på pladen5.
  10. Fem til syv dage efter den første rodudvælgelse skal du gentage udvælgelsesprocessen for at vælge nye transformerede rødder og fjerne ikke-transformerede rødder. Frøplanterne med transformerede rødder overføres til en ny plade, der indeholder 1/2 MS-medium.

3. Overførsel til podning gryder

  1. Forbered podning gryder, hvor overfladen af rødderne vil blive udsat for bakteriel inoculum: suge podning gryder med vand, hæld overskydende vand, og læg dem i en plast plantning bakke. De valgte planter overføres med transformerede rødder til podningsgryder ved hjælp af en pincet (figur 3A).
  2. Dæk bakken med plastfolie eller et gennemsigtigt låg og hold den ved 25−28 °C og 65 % luftfugtighed (16 h/8 h lys/mørke; 130 μmolfotoner m-2s-1 lys), for at opretholde en høj luftfugtighed Figur 3B). Fjern dækslet efter fem eller seks dage.
    BEMÆRK: De transformerede tomatplanter er klar til podning to til tre uger efter, at de er overført til jord (figur 3C). Under væksten på jorden, kan tomatplanter producere nye rødder, der ikke er omdannet. For at bestemme omfanget af dette fænomen, rød fluorescens blev visualiseret i rødder af 3-ugers gamle forvandlet tomatplanter. De fleste rødder (80%-100%) viste rød fluorescens, hvilket indikerer, at de rent faktisk er omdannet (figur 3D,E).

4. Jord-drenching vaccination

  1. Grow R. solancearum (stamme GMI1000 i denne protokol) i phi flydende medium (tabel 211) i en orbital shaker (200 rpm) ved 28 °C indtil den stationære fase.
  2. Anskaf bakterietal ved måling af bakteriekulturens optiske massefylde ved 600 nm (OD600). Bakteriekulturen fortyndes med vand til en OD600 på 0,1 (under forhold, der anvendes her, svarer dette til ca. 108 kolonidannende enheder [CFU]/ml).
  3. Anbring 16−20 inokuleringskrukker indeholdende transformerede tomatplanter i en podningsbakke (29 cm x 20 cm; Figur 4A).
  4. Hæld 300 ml (~15 ml pr. plante) bakteriel inoculum (OD600 af 0,1) i bakken, der indeholder de inokuleringsgryder. Lad dem suge i inoculum i 20 min (Figur 4B).
  5. Forbered en ny bakke med et lag pottemuld. Flyt de podede gryder ind i den nye bakke (figur 4C), og anbring bakkerne i et vækstkammer med 75 % fugtighed, 26−28 °C og en fotoperiode på 12 timers lys og 12 timers mørke (130 μmolfotoner m-2s-1 lys).

5. Bestemmelse af infektionsparametre og statistisk analyse

  1. Score sygdomssymptomer som tidligere beskrevet12,13, ved hjælp af en skala fra 0 (ingen symptomer) til 4 (komplet visnen) (Figur 4D-H), hver dag efter Ralstonia inokulering i to uger.
    BEMÆRK: Sygdomsindeksdataene indsamles fra den samme forsøgsenhed (hvert anlæg) over tid.

6. Analyse af genekspression

BEMÆRK: Udtrykket af transgene eller dæmpningen af målgenet kan bestemmes ved RT-PCR eller ved kvantitativ RT-PCR (qRT-PCR).

  1. Prøverne indsamles, og RNA udtages fra en repræsentativ del af det transformerede rodsystem (for at vurdere effekten på målgenet) og bladene (som intern kontrol).
  2. SyntetisercDNA ved hjælp af 1 μg total DNase-behandlet RNA.
  3. Analysér genekspression af målgenerne ved qRT-PCR. De relative transskriptionsniveauer beregnes ved hjælp af 2-ΔΔCT-metoden 14ved hjælp af SlEFα-1 som rengøringsgen15.
    BEMÆRK: Primersekvenser er angivet i tabel 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Figur 5 viser udviklingen af sygdomssymptomer på tomatplanter med rødder omdannet med en tom vektor (EV), og planter med rødder omdannet med en RNAi konstruktion rettet mod SlCESA6 (Solyc02g072240). Sygdomsindeksdataene (figur 5A) indsamles fra den samme forsøgsenhed (hvert anlæg) over tid i henhold til en vilkårlig skala fra 0 til 4 og følger ikke en gaussisk fordeling, idet de udelukker anvendelse af standardtest for parametriske data. Desuden er der en iboende plante-til-plante variation i denne form for eksperimenter, på grund af kolonisering og infektion dynamik. Nedenfor overvejede vi forskellige metoder til repræsentation og statistisk analyse af symptomer forbundet med Ralstonia infektion.

Som en standard tilgang, en U Mann-Whitney to-tailed ikke-parametrisk test for at sammenligne både kontrol (EV) og SlCESA6-RNAi infektion kurver blev brugt. Ifølge denne analyse synes forskellen mellem medianerne af begge kurver at være ikke-signifikant (P = 0,16).

Det er også muligt at kvantificere området under sygdomsfremskridtskurven (AUDPC), som gør det muligt at kombinere flere observationer af sygdomsfremskridt i en enkelt værdi. AUDPC viste en højere værdi for kontrolanlæg (EV; 28,75 ± 4,75) sammenlignet med SlCESA6-RNAi (21,01 ± 4,74) planter ved afslutningen af infektionsprocessen, hvilket indikerer, at SlCES6-lyddæmpedeplanter er mere modstandsdygtige over for Ralstonia-infektion end kontrolanlæg (figur 5B).

Konfidensintervaller (CI) giver mulighed for med stor sandsynlighed at anslå et interval af værdier, hvor populationens værdi (eller parameter) for en given variabel findes. Som det fremgår af figur 5C, anslår arealet på 95 % CI for kontrol (EV) og SlCESA6-RNAi-infektionskurver en højere risiko for modstand, når SlCESA6 lukkes til.

Sygdomsindeksværdier kan omdannes til binære data i betragtning af et sygdomsindeks, der er lavere end 2 svarende til "0", og et sygdomsindeks, der er lig med eller højere end 2 svarende til "1"12. Dette gør det muligt at repræsentere en overlevelseskurve efter Ralstonia-podning. Denne transformation er baseret på den iagttagelse, at når planterne begynder at udvikle klare symptomer (sygdomsindeks på 2), betragtes de som "inficerede" og vil dø som følge af denne infektion. Forskellene i overlevelsesraten mellem EV- og SlCESA6-RNAi-plantervar ikke statistisk signifikante ifølge en statistisk test for Gehan-Breslow-Wilcoxon (P = 0,13) (figur 5D).

Ud over at udføre statistisk analyse og uanset de opnåede P-værdier er det værd at fortolke disse data på grundlag af reproducerbarheden af de observerede tendenser inden for forskellige replikater (supplerende figur 1). I overensstemmelse med dette begreb har et stigende antal forskere for nylig kommenteret risikoen for at overskride strenge statistiske tærskler (såsom standard P ≤ 0,05)16.

Udtrykket af SlCESA6 blev analyseret i to tilfældigt udvalgte transformerede rødder før podning trin, der viser, at den øgede modstand mod Ralstonia korrelerer med den reducerede udtryk for SlCESA6 (Figur 5E). Ved hjælp af denne metode kan der opnås en omdannelseshastighed på 35−40 % efter to udvælgelsesrunder (figur 5F). Denne værdi kan øges ved at udføre yderligere udvælgelsesrunder5.

Figure 1
Figur 1: Planteforberedelse, omdannelse og udvælgelse. aA) Spiring af tomatfrø i middel med halv styrke ms (1/2). (B) Spirede tomatfrø, der er anbragt på filterpapir, og som ligger på en plade, der indeholder 1/2 MS-medium. Tomatplanter før (C) og efter (D) skære radikel og bunden af hypocotyl. (E) Omdannelse af tomatsætteplante ved at dyppe i bakteriebiomasse. (F) Transformerede tomatplanter dækket med filterpapir for at opretholde luftfugtigheden. Fremkomst (G) og fjernelse (H) af nye (ikke-transformerede) behårede rødder. (I) Transformerede rødder. (J) Udvælgelse af transformerede tomat behårede rødder ved visualisering af DsRed fluorescens. Røde pile indikerer positive transformerede rødder, der udtrykker DsRed fluorescens. (K) Udvikling af de transformerede rødder som de vigtigste rødder. (L) Visualisering af DsRed fluorescens i modne transformerede rødder. Klik her for at se en større version af dette tal.

Figure 2
Figur 2: Alternativ metode baseret på valg af antibiotika. (A) Halvudfyldt kvadratplade indeholdende 1/2 MS-medium. (B) Skær planter bortskaffes på filterpapir liggende på 1/2 MS medium med antibiotika, efter fjernelse af første ikke-transformerede behårede rødder. (C) Rødder dækket med ekstra filterpapir. (D) Tomattransformerede rødder dyrket på 1/2 MS medium med antibiotikum. (E) Kimplanter omdannet med pK7GWIWG2_II-RedRoot (kanamycin 50 μg/ml), der udtrykker DsRed, som positiv kontrol. Klik her for at se en større version af dette tal.

Figure 3
Figur 3: Overførsel af transformeret tomat til podning gryder. (A) Rodtransformerede tomater overført til fuld-gennemblødt podning potter. (B) Transformerede tomater i podning gryder dækket med en plast låg til at opretholde en høj luftfugtighed. (C) To-til-tre uger gamle rod-transformerede tomater, efter overføring til podning potter, klar til at blive podet. (D) Tre uger gamle tomatplanter efter fjernelse af jorden. (E) DsRed fluorescens i rødder af 3 uger gamle transformerede tomatplanter. Klik her for at se en større version af dette tal.

Figure 4
Figur 4: Ralstonia jord-drenching podning. aA) Materialer, der er nødvendige for r. solanacearum GMI1000-podning. (B) Jorddrenching af transformerede tomater i podningsgryder med R. solanacearum GMI1000 inoculum. cC) Inokulerede tomater, der er anbragt på et lag pottemuld. (D-H) Ralstonia sygdom symptomer skala spænder fra 0 (ingen symptomer) til 4 (komplet visnen). Klik her for at se en større version af dette tal.

Figure 5
Figur 5: SlCESA6-hæmning øger modstanden mod R. solanacearum. (A) Sygdomssymptomer på RNAi-medieret SlCESA6-tavshed (CESA6-RNAi) og tomme vektor (EV) rod-transformerede tomatplanter ved podning med R. solanacearum. Værdierne svarer til middelværdien ± SE for otte planter. (B) Areal under sygdomsfremskridtskurven for planter vist i panel A. (C) 95% konfidensInterval for planter vist i panel A. (D) Procent af overlevende planter vist i panel A. (E) Genekspressionsanalyse ved qRT-PCR af RNAi-medieret SlCESA6-tavshed (CESA6i) og EV rodtransformerede tomatplanter i rødder (1,2) og skyde (S). Værdierne svarer til middelværdien ± SE af tre tekniske replikater. FF) Transformationshastighed for EV og CESA6-RNAi rodtransformerede tomatplanter af to uafhængige forsøg. Værdierne svarer til midlet ± SE efter to udvælgelsesrunder. Klik her for at se en større version af dette tal.

Primernavn Primer sekvens (5'-3')
EFα-1-F GGTGGCGAGCATGATTTTGA
EFα-1-R CGAGCCAACCATGGAAAACAA
qCESA6-F GATCTGGTTCTCTCTCTT
qCESA6-R TCCCTCCCTTTCATACCTTG
CESA6-RNAi-F CACCGGCGAACAAGTGGTTAG
CESA6-RNAi-R TTTGAGACTTTGGCACTGGA

Tabel 1: Primersekvenser.

Ingredienser For 1 L
Bacto peptone 10 g
Gær ekstrakt 1 g g
Casaminosyrer 1 g g

Tabel 2: Sammensætning af Phi (Ø).

Supplerende figur 1: Reproducerbarhed af det resultat, der er vist i figur 5A. Sygdomssymptomer på RNAi-medieret SlCESA6-tavshed (CESA6-RNAi) og EV rod-transformerede tomatplanter ved podning med R. solanacearum. Værdierne svarer til middelværdien ± SE for otte planter. Genekspressionsanalyse blev udført af qRT-PCR af RNAi-medieret SlCESA6-tavshed (CESA6i) og Empty Vector (EV) rodtransformerede tomatplanter i rødder (1,2) og skyde (S). Værdierne svarer til middelværdien ± SE af tre tekniske replikater. Klik her for at downloade dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ralstonia solanacearum udgør en stor trussel mod landbruget. men dens interaktion med naturlige værter af landbrugsbetydning er stadig dårligt forstået sammenlignet med andre bakterielle patogener, især i plantearter. I de fleste tilfælde hæmmes genetisk analyse af den tid og de udgifter, der er nødvendige for at genetisk modificere værtsplanter. For at løse dette problem og lette genetisk analyse af R. solanacearum infektion i tomat, har vi udviklet en nem metode baseret på Agrobacterium rhizogenes-medieret transformation af tomatrødder (Figur 1), efterfulgt af jord-drenching podning (Figur 3). De transformerede rødder vælges ved hjælp af en fluorescerende reporter (DsRed i denne protokol) (Figur 1). Derudover har vi også udviklet en alternativ metode baseret på valg af antibiotika, der ikke skader den ikke-transformerede antennedel (figur 2).

Transformationsprotokollen er baseret på den, der er beskrevet af Ho-Plágaro et al.5, med flere ændringer. Alsidigheden af denne metode giver mulighed for flere yderligere analyser i transformerede rødder, såsom dem til at analysere plantefysiologi, reaktion på kemiske behandlinger, og / eller reaktioner på forskellige biotiske og abiotiske belastninger.

Efter at have overført de transformerede planter til jord overvejede vi muligheden for, at planter kan udvikle nye rødder, der ikke kan omdannes. Vi undersøgte denne mulighed ved at observere fluorescens fra DsRed i rodsystemet af transformerede planter to uger efter at overføre dem til jord (før Ralstonia vaccination). Resultaterne viste rød fluorescens i størstedelen af rødderne (Figur 3D).

Agrobacteriums T-DNA-overførsel er integreret i værtsgenomet på en tilfældig måde, og derfor genererer denne metode en heterogenpopulation af tomatplanter med forskelligt udtryksniveau af målgenet. R. solanacearum-infektion forårsager normalt planternes død, hvilket efterfølgende hindrer indsamlingen af rodprøver efter forsøget for at analysere genekspressionen af hver plante. For at analysere ekspressionsniveauet for målgenet under forsøgene vælger vi to til tre rodtransformerede planter før podningstrinnet som repræsentativprøve af den population, der vil blive vaccineret. Figur 5 viser, at reduktionen af sygdomssymptomer hos tomatplanter korrelerer med effektiviteten af SlCESA6-dæmpning før vaccinationstrinnet. Derfor, og på trods af protokollens begrænsninger, viser vores repræsentative resultater klart, at denne metode er et effektivt redskab til at studere kandidatgener, der er involveret i resistens eller modtagelighed for R. solanacearum i tomat. Eksemplet vist i denne artikel tillod os at fastslå, at banke-down SlCESA6, en sekundær celle væg-relaterede cellulose syntase, øger resistens over for infektion med R. solanacearum, der ligner tidligere observationer ved hjælp af sin ortholog AtCESA8 (At4g18780) fra Arabidopsis thaliana8.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Vi takker alle lab medlemmer af Macho laboratorium for nyttige diskussioner, Alvaro López-García for statistisk rådgivning, og Xinyu Jian for teknisk og administrativ bistand under dette arbejde. Vi takker PSC Cell Biology kernefacilitet for bistand med fluorescens imaging Dette arbejde blev støttet af den strategiske prioritet Forskningsprogram af den kinesiske Academy of Sciences (tilskud XDB27040204), Shanghai Center for Plant Stress Biology (kinesisk Academy of Sciences) og det kinesiske 1000 Talents program.

Materials

Name Company Catalog Number Comments
90 mm square Petri-dishes
Agar powder Sigma-Aldrich
Bacto peptone BD (Becton and Dickinson)
Casamino acids Sigma-Aldrich
Filter paper
In Vivo Plant Imaging System NightShade LB 985 Berthold Technologies
Jiffy pots Jiffy Products International A.S.
Micropore tape 3M
Murashige and Skoog medium (M519) Phytotechlab
Pindstrup substrate Pindstrup Mosebrug A/S
Scalpel and blade
Sodium hypochlorite Sigma-Aldrich
Sterile clean bench
Tweezers
Wahtman paper Wahtman International Ltd. Maldstone
Yeast extract OXOID

DOWNLOAD MATERIALS LIST

References

  1. Jiang, G., et al. Bacterial Wilt in China: History, Current Status, and Future Perspectives. Frontiers in Plant Science. 11, (8), 1549 (2017).
  2. Mansfield, J., et al. Top 10 plant pathogenic bacteria in molecular plant pathology. Molecular plant pathology. 13, (6), 614-629 (2012).
  3. Elphinstone, J. G. The current bacterial wilt situation: a global overview. In: Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. Allen, C., Prior, P., Hayward, A. C. American Phytopathological Society Press. St Paul, MN. 9-28 (2005).
  4. Jones, J. B., Jones, J. P., Stall, R. E., Zitter, T. A. Compendium of Tomato 1094 Diseases. APS Press. St Paul, MN. (1991).
  5. Ho-Plágaro, T., Huertas, R., Tamayo-Navarrete, M. I., Ocampo, J. A., García-Garrido, J. M. An improved method for Agrobacterium rhizogenes-mediated transformation of tomato suitable for the study of arbuscular mycorrhizal symbiosis. Plant Methods. 14, 34 (2018).
  6. Wydra, K., Beri, H. Structural changes of homogalacturonan, rhamnogalacturonan I and arabiogalactan protein in xylem cell walls of tomato gentoypes in reaction to Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 68, 41-50 (2006).
  7. Wydra, K., Beri, H. Immunohistochemical changes in methyl-ester distribution of homogalacturonan and side chain composition of rhamnogalacturonan I as possible components of basal resistance in tomato inoculated with Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 70, 13-24 (2007).
  8. Hernández-Blanco, C., et al. Impairment of cellulose synthases required for Arabidopsis secondary cell wall formation enhances disease resistance. Plant Cell. 19, (3), 890-903 (2007).
  9. Denancé, N., et al. Arabidopsis wat1 (walls are thin1)-mediated resistance to the bacterial vascular pathogen, Ralstonia solanacearum, is accompanied by cross-regulation of salicylic acid and tryptophan metabolism. Plant Journal. 73, (2), 225-239 (2013).
  10. Digonnet, C., et al. Deciphering the route of Ralstonia solanacearum colonization in Arabidopsis thaliana roots during a compatible interaction: focus at the plant cell wall. Planta. 236, (5), 1419-1431 (2012).
  11. Sang, Y., et al. The Ralstonia solanacearum type III effector RipAY targets plant redox regulators to suppress immune responses. Molecular Plant Pathology. 19, (1), 129-142 (2018).
  12. Remigi, P., Anisimova, M., Guidot, A., Genin, S., Peeters, N. Functional diversification of the GALA type III effector family contributes to Ralstonia solanacearum adaptation on different plant hosts. New Phytologist. 192, 976-987 (2011).
  13. Wang, K., et al. Functional assignment to positively selected sites in the core type III effector RipG7 from Ralstonia solanacearum. Molecular Plant Pathology. 17, 553-564 (2016).
  14. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 25, (4), 402-408 (2001).
  15. León-Morcillo, R. J., Martín-Rodríguez, J. A., Vierheilig, H., Ocampo, J. A., García-Garrido, J. M. Late activation of the 9-oxylipin pathway during arbuscular mycorrhiza formation in tomato and its regulation by jasmonate signalling. Journal of Experimental Botany. 63, (10), 3545-3558 (2012).
  16. Amrhein, V., Greenland, S., McShane, B. Retire statistical significance. Nature. 567, 305-307 (2019).
Tomatrod Transformation Efterfulgt af podning med <em>Ralstonia Solanacearum</em> for ligetil genetisk analyse af bakteriel visnesygdom
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Morcillo, R. J. L., Zhao, A., Tamayo-Navarrete, M. I., García-Garrido, J. M., Macho, A. P. Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease. J. Vis. Exp. (157), e60302, doi:10.3791/60302 (2020).More

Morcillo, R. J. L., Zhao, A., Tamayo-Navarrete, M. I., García-Garrido, J. M., Macho, A. P. Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease. J. Vis. Exp. (157), e60302, doi:10.3791/60302 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter