Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Transformação da Raiz do Tomate Seguida de Inoculação com Ralstonia Solanacearum para Análise Genética Direta da Doença de Wilt Bacteriano

doi: 10.3791/60302 Published: March 11, 2020

Summary

Aqui, apresentamos um método versátil para transformação da raiz do tomate seguido de inoculação com Ralstonia solanacearum para realizar análise genética simples para o estudo da doença de murcha bacteriana.

Abstract

Ralstonia solanacearum é um patógeno vascular devastador que pode infectar uma grande variedade de espécies vegetais, causando uma importante ameaça à agricultura. No entanto, o modelo de Ralstonia é consideravelmente pouco explorado em comparação com outros modelos envolvendo patógenos bacterianos vegetais, como pseudomonas singae em Arabidopsis. Pesquisas voltadas para a compreensão da interação entre ralstonia e plantas agrícolas são essenciais para desenvolver soluções sustentáveis para combater a doença bacteriana, mas atualmente é dificultada pela falta de ensaios experimentais simples para caracterizar os diferentes componentes da interação em plantas hospedeiras nativas. Nesse cenário, desenvolvemos um método para realizar a análise genética da infecção por Ralstonia do tomate, um hospedeiro natural da Ralstonia. Este método baseia-se na transformação mediada do Agrobacterium rhizogenesdas raízes do tomate, seguida pela inoculação de ralstonia encharcada de solo das plantas resultantes, contendo raízes transformadas expressando a construção de interesse. A versatilidade do ensaio de transformação raiz permite realizar a superexpressão genética ou o silenciamento genético mediado pela RNAi. Como prova de conceito, utilizou-se este método para mostrar que o silenciamento mediado pela RNAI de Sisa6 nas raízes do tomate conferiu resistência à Ralstonia. Aqui, descrevemos este método em detalhes, permitindo abordagens genéticas para entender a doença de murcha bacteriana em um tempo relativamente curto e com pequenas exigências de equipamentos e espaço de crescimento vegetal.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ralstonia solanacearum, o agente causal da doença da murcha bacteriana, é um patógeno vascular devastador do solo com uma distribuição mundial que pode infectar uma grande variedade de espécies vegetais, incluindo batata, tomate, tabaco, banana, pimenta e berinjela, entre outras1,2. As perdas de rendimento causadas pela Ralstonia podem chegar a 80-90% da produção em tomate, batata ou banana, dependendo da cultivar, clima, solo e outros fatores3. No entanto, o modelo de Ralstonia é consideravelmente pouco explorado em comparação com outros modelos envolvendo patógenos de plantas bacterianas, tais como Pseudomonas singae ou Xanthomonas spp. Além disso, a maioria dos estudos em interações entre plantas e micróbios está focada na planta modelo Arabidopsis thaliana. Embora a pesquisa que utiliza esses modelos tenha contribuído em grande parte para a nossa compreensão das interações entre plantas e bactérias, elas não abordam a necessidade atual de entender essas interações nas plantas agrícolas. Pesquisas voltadas para a compreensão da interação entre ralstonia e plantas agrícolas são essenciais para desenvolver soluções sustentáveis para combater a doença bacteriana, mas atualmente é dificultada pela falta de ensaios experimentais simples para caracterizar os diferentes componentes da interação. Particularmente, o tomate, um hospedeiro natural da Ralstonia,é a segunda cultura vegetal mais importante do mundo e é afetado por uma infinidade de doenças4, incluindo a doença de murcha bacteriana. Neste trabalho, desenvolvemos um método fácil para realizar análisegenética da infecção por Ralstonia do tomate. Este método baseia-se na transformação mediada de raízes de tomate da Agrobacterium,utilizando fluorescência DsRed como marcador de seleção5,seguida pela inoculação de drenagem do solo de Ralstonia das plantas resultantes, contendo raízes transformadas expressando a construção de interesse. A versatilidade do ensaio de transformação raiz permite realizar a superexpressão genética ou o silenciamento genético mediado pela RNAi.

Uma limitação potencial deste método consiste no crescimento residual de raízes não transformadas. Isso é particularmente importante nos casos em que o plasmídeo utilizado carece de um gene de repórter que permita a seleção de raízes transformadas. Para resolver esse problema, desenvolvemos um método alternativo baseado na seleção de antibióticos, que inibe o crescimento de raízes não transformadas, permitindo ao mesmo tempo o crescimento de raízes transformadas saudáveis resistentes a antibióticos. Uma vez que A. rizógenes não induz a transformação de brotos, eles são suscetíveis ao antibiótico e, portanto, devem ser mantidos separados do meio contendo antibióticos.

Embora a resistência vegetal contra a Ralstonia não seja bem compreendida, vários relatos associaram alterações na parede celular ao aumento da resistência à murcha bacteriana6,,7,,8,9. Sugere-se que essas alterações na parede celular afetem o desenvolvimento vascular, aspecto essencial para o estilo de vida da Ralstonia dentro da planta10. Mutações nos genes que codificam os sintetizadores de celulose CESA4, CESA7 e CESA8 em Arabidopsis thaliana têm sido demonstradas para prejudicar a integridade da parede celular secundária, causando maior resistência à Ralstonia,que parece estar ligada à sinalização ABA8. Portanto, como prova de conceito para o nosso método, realizamos o silenciamento genético mediado pela RNAi de SlCESA6 (Solyc02g072240), um sintetizador secundário de celulose de parede celular, e ortolog de AtCESA8 (At4g18780). A inoculação subseqüente de drenagem do solo com ralstonia mostrou que silenciar SlCESA6 aumentou a resistência aos sintomas de murcha bacteriana, sugerindo que a resistência mediada pela parede celular à Ralstonia é provavelmente conservada no tomate, e validando nosso método para realizar análise genética da resistência bacteriana murcha nas raízes do tomate. Aqui, descrevemos este método em detalhes, permitindo abordagens genéticas para entender a doença de murcha bacteriana em um tempo relativamente curto e com pequenas exigências de equipamentos e espaço de crescimento vegetal.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

NOTA: Partes importantes deste método envolvem o manuseio de materiais vegetais in vitro e, portanto, é importante manter condições estéreis durante todos esses procedimentos, incluindo a visualização da fluorescência DsRed. Durante todo o processo de transformação, as mudas de tomate crescem a 25-28 °C e 16 h/8 h claro/escuro (130 μmol fótons m-2s-1 luz). As placas são seladas com fita microporos a fim de facilitar a troca e transpiração gasosa.

1. Preparação de plantas de tomate e rizógenes agrobacteriogenes

  1. Esterilizar sementes de tomate (Solanum lycopersicum cv. Moneymaker, LA2706, Tomato Genetics Resource Center, TGRC) com 5% (v/v) hipoclorito de sódio por 5 min. Lave 4-5 vezes com água estéril destilada e mantenha as sementes tremendo lentamente em água estéril durante a noite para facilitar a germinação.
  2. Transfira as sementes de tomate para o meio murashige e skoog de meia-força (1/2 MS) sem sacarose (2,21 g/L MS, 8% c/v ágar). Mantenha as sementes no escuro a 25-28 °C por três dias(Figura 1A).
    NOTA: Cerca de 40 sementes são geralmente necessárias para cada construção.
  3. Autoclave 8,5 cm2 papéis de filtro quadrado. Coloque os papéis do filtro quadrado dentro de 9 cm2 placas de petri quadradas contendo 1/2 ms médio (coloque o papel em cima do ágar) e coloque seis sementes de tomate germinadas em cada prato(Figura 1B). Sele a placa com fita microporos a fita e incubar as sementes germinadas a 25-28 °C por 3-4 dias.
  4. Cultivar Agrobacterium rhizogenes MSU440 em meio LB sólido (com antibióticos apropriados) a 28 °C dois dias antes da transformação da planta.
    NOTA: A. rhizogenes é fornecido pelo Dr. Juan Antonio López Ráez, EEZ-CSIC, Granada, Espanha. No experimento descrito neste artigo, a A. rizógenes contendo pK7GWIWG2_II-RedRoot::CESA6 ou um vetor vazio, como controle, foram usados. pK7GWIWG2_II-RedRoot contém um gene de repórter, DsRed, impulsionado pelo promotor arabidopsis thaliana ubiquitin(pAtUBQ10),e confere resistência à espectinomicina (50 μg/mL). É possível utilizar outros vetores para superexpressão genética, conforme relatado antesde 5. Neste trabalho, a amplificação do fragmento específico para silenciamento SlCESA6 foi obtida por transcrição reversa (RT) PCR utilizando RNA isolado do tomate (S. lycopersicum cv. Moneymaker) e ligado ao vetor p-ENTR/D-TOPO(Tabela 1). Posteriormente, o fragmento SlCESA6-RNAi foi clonado no vetor binário pK7GWIWG2_II-RedRoot.

2. Transformação e seleção de plantas

  1. Usando um bisturi estéril, corte o radicículo e o fundo do hipocotilo das mudas de tomate (Figura 1C,D).
  2. Colheita A. rizógenes biomassa da superfície do meio LB usando pontas plásticas ou uma lâmina de bisturi e mergulhe cuidadosamente as mudas de tomate cortadas na biomassa bacteriana(Figura 1E).
  3. Após a inoculação com A. rizogenes,cubra as mudas de tomate com um papel filtro semi-circular de 2 cm x 4 cm(Figura 1F),a fim de manter uma alta umidade e facilitar a sobrevivência e o desenvolvimento de novas raízes.
  4. Guarde as mudas de tomate transformadas por 6-7 dias. Em seguida, use um bisturi estéril para cortar as novas raízes peludas emergentes (Figura 1G,H; nesta etapa, as raízes ainda não são transformadas) e permitir que as mudas produzam novas raízes peludas.
  5. Uma vez que a segunda geração de novas raízes peludas apareçam (Figura 1I),remova o papel do filtro em cima das mudas e sele a placa com fita microporosa novamente.
    NOTA: Neste ponto, a presença do marcador fluorescente DsRed no vetor de transformação permite visualizar a eficiência de transformação nas novas raízes.
  6. Para visualizar a fluorescência DsRed, use um microscópio estereomicroscópio ou qualquer outro equipamento para imagem in vivo da planta (Figura 1J). Marque as raízes transformadas positivas (fluorescência vermelha) e remova as raízes negativas não transformadas (sem fluorescência vermelha) usando um bisturi estéril.
  7. Transfira as mudas que compareçam fluorescência vermelha para uma nova placa contendo 1/2 ms médio, a fim de facilitar o desenvolvimento da raiz transformada como a raiz principal (Figura 1K). Mantenha as mudas que não apresentam fluorescência vermelha na mesma placa para verificar o surgimento de raízes fluorescentes (Figura 1L) em pontos de tempo posteriores.
  8. Método alternativo baseado na seleção de antibióticos
    1. Alternativa ao passo 2.5, prepare placas quadradas de 9 cme 2 cm contendo 1/2 ms médio com o antibiótico apropriado. Incline as placas aproximadamente 5° durante o processo de preparação para gerar um espaço vazio sem meio(Figura 2A),permitindo que os brotos cresçam evitando o contato com o antibiótico.
    2. Alternativa ao passo 2.6, após cortar as primeiras raízes peludas não transformadas emergiu (etapa 2.4), transferir as mudas sem raízes para as placas semi-preenchidas utilizando papéis de filtro com o tamanho adequado(Figura 2B).
      NOTA: Como controle positivo, recomenda-se transformar várias mudas com um plasmídeo contendo a mesma resistência a antibióticos e um gene de repórter (neste protocolo, pK7GWIWG2_II-RedRoot; kanamycin 50 μg/mL).
    3. Alternativa ao passo 2.7, deixe que as mudas desenvolvam novas raízes peludas e corte aquelas raízes que não estão em contato direto com a superfície dos papéis do sanduíche do filtro, uma vez que essas raízes podem evitar a seleção de antibióticos.
      NOTA: Devido ao efeito antibiótico, o desenvolvimento da raiz pode ser mais lento do que em placas sem antibióticos. Novas raízes peludas transformadas aparecem dentro de 14-18 dias após a transferência das mudas sem raízes para as placas semi-preenchidas (etapa 2.8.2) (Figura 2C-E).
  9. Cubra as mudas com um papel filtro semicírculo de 2 cm x 4 cm, sele a placa e incuba as mudas para que elas desenvolvam novas raízes peludas.
    NOTA: Não é necessário eliminar os A. rizogenes usando antibióticos. O papel filtro em cima do meio de MS e a falta de sacarose inibem a propagação dos A. rizógenes na placa5.
  10. Cinco a sete dias após a primeira seleção de raízes, repita o processo de seleção para selecionar novas raízes transformadas e remover raízes não transformadas. Transfira as mudas contendo raízes transformadas para uma nova placa contendo 1/2 ms médio.

3. Transferência para potes de inoculação

  1. Prepare potes de inoculação onde a superfície das raízes será exposta ao inóculo bacteriano: mergulhe os potes de inoculação com água, despeje qualquer excesso de água e coloque-os em uma bandeja de plantio de plástico. Transfira as mudas selecionadas com raízes transformadas para vasos de inoculação utilizando pinças(Figura 3A).
  2. Cubra a bandeja com plástico ou uma tampa transparente e mantenha-as a 25-28 °C e 65% de umidade (16 h/8 h claro/escuro; 130 μmol fótons m-2s-1 luz), para manter um alto nível de umidade Figura 3B). Remova a tampa depois de cinco ou seis dias.
    NOTA: As plantas de tomate transformadas estão prontas para a inoculação de duas a três semanas após transferi-las para o solo(Figura 3C). Durante o crescimento no solo, as plantas de tomate podem produzir novas raízes que não são transformadas. Para determinar a extensão desse fenômeno, a fluorescência vermelha foi visualizada em raízes de plantas de tomate transformadas de 3 semanas. A maioria das raízes (80%-100%) apresentaram fluorescência vermelha, indicando que estão de fato transformados (Figura 3D,E).

4. Inoculação encharcada de solo

  1. Cultivar R. solancearum (cepa GMI1000 neste protocolo) em meio líquido phi(Tabela 211)em um agitador orbital (200 rpm) a 28 °C até a fase estacionária.
  2. Determinar números bacterianos medindo a densidade óptica da cultura bacteriana em 600 nm (OD600). Diluir a cultura bacteriana com água para um OD600 de 0,1 (em condições aqui utilizadas, isso corresponde a aproximadamente 108 unidades formadoras de colônias [UFC]/mL).
  3. Coloque 16-20 potes de inoculação contendo plantas de tomate transformadas em uma bandeja de inoculação (29 cm x 20 cm; Figura 4A).
  4. Despeje 300 mL (~15 mL por planta) de inóculo bacteriano (OD600 de 0,1) na bandeja contendo os potes de inoculação. Deixe-os de molho no inóculo por 20 min(Figura 4B).
  5. Prepare uma nova bandeja com uma camada de solo de vasos. Mova os potes inoculados para a nova bandeja(Figura 4C)e coloque as bandejas em uma câmara de crescimento com 75% de umidade, 26-28 °C e um período fotoperíodo de 12 h de luz e escuridão de 12 h (fótons de 130 μmol m-2s-1 luz).

5. Determinação de parâmetros de infecção e análise estatística

  1. Os sintomas da doença de pontuação como descrito anteriormente12,13, utilizando uma escala que varia de 0 (sem sintomas) a 4 (murcha completa) (Figura 4D-H), todos os dias após a inoculação de Ralstonia por duas semanas.
    NOTA: Os dados do índice da doença são coletados da mesma unidade experimental (cada planta) ao longo do tempo.

6. Análise de expressão gênica

NOTA: A expressão do transgene ou o silenciamento do gene alvo pode ser determinada por RT-PCR ou por RT-PCR quantitativo (qRT-PCR).

  1. Coletar amostras e extrair RNA de uma parte representativa do sistema radicular transformado (para avaliar o efeito sobre o gene alvo) e folhas (como controle interno).
  2. Sintetisque o CDNA usando 1 μg de RNA total tratado com DNase.
  3. Analisar a expressão genética dos genes-alvo por qRT-PCR. Calcular os níveis de transcrição relativos usando o método 2-ΔΔCT 14, usando SlEFα-1 como gene de limpeza15.
    NOTA: As seqüências do primer estão listadas na Tabela 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A Figura 5 mostra o desenvolvimento de sintomas da doença de plantas de tomate com raízes transformadas com um vetor vazio (EV), e plantas com raízes transformadas com um construto RNAi direcionado aoSolyc02g072240). SlCESA6 Os dados do índice da doença (Figura 5A) são coletados da mesma unidade experimental (cada planta) ao longo do tempo de acordo com uma escala arbitrária de 0 a 4, e não seguem uma distribuição gaussiana, excluindo o uso de testes padrão para dados paramétricos. Além disso, há uma variação intrínseca de planta para planta neste tipo de experimentos, devido à dinâmica de colonização e infecção. Abaixo foram considerados diferentes métodos para a representação e análise estatística dos sintomas associados à infecção por Ralstonia.

Como abordagem padrão, utilizou-se um teste não paramétrico de duas caudas da U Mann-Whitney para comparar as curvas de infecção de controle (EV) e SlCESA6-RNAi. De acordo com esta análise, a diferença entre as medianas de ambas as curvas parece não ser significativa (P = 0,16).

Também é possível quantificar a área a curva de progresso da doença (AUDPC), que permite combinar múltiplas observações do progresso da doença em um único valor. O AUDPC apresentou maior valor para as plantas de controle (EV; 28,75 ± 4,75) em comparação com as plantas SlCESA6-RNAi (21,01 ± 4,74) no final do processo de infecção, indicando que as plantas silces6-silenciadas são mais resistentes à infecção por Ralstonia do que as plantas de controle(Figura 5B).

Os intervalos de confiança (IC) oferecem uma forma de estimar, com alta probabilidade, uma faixa de valores em que se encontra o valor populacional (ou parâmetro) de uma determinada variável. Como é mostrado na Figura 5C, a área de 95% de IC para controle (EV) e curvas de infecção SlCESA6-RNAi estimam uma maior chance de resistência quando SisséSio.

Os valores do índice da doença podem ser transformados em dados binários, considerando um índice da doença inferior a "0", e um índice da doença igual ou superior a 2 correspondente a "1"12. Isso permite a representação de uma curva de sobrevivência após a inoculação de Ralstonia. Essa transformação baseia-se na observação de que, uma vez que as plantas começam a desenvolver sintomas claros (índice da doença de 2), elas são consideradas "infectadas" e morrerão como consequência dessa infecção. As diferenças na taxa de sobrevivência entre as plantas EV e SlCESA6-RNAi não foram estatisticamente significativas de acordo com um teste estatístico gehan-breslow-wilcoxon (P = 0,13) (Figura 5D).

Além de realizar análise estatística, e independentemente dos valores p obtidos, vale a pena interpretar esses dados com base na reprodutibilidade das tendências observadas dentro de diferentes réplicas(Figura Suplementar 1). De acordo com essa noção, um número crescente de cientistas tem comentado recentemente sobre os riscos de uso excessivo de limiares estatísticos rigorosos (como o padrão P ≤ 0,05)16.

A expressão de SlCESA6 foi analisada em duas raízes transformadas selecionadas aleatoriamente antes da etapa de inoculação, mostrando que a maior resistência à Ralstonia se correlaciona com a expressão reduzida de SlCESA6 (Figura 5E). Usando este método, pode-se obter uma taxa de transformação de 35 a 40% após duas rodadas de seleção (Figura 5F). Este valor pode ser aumentado realizando rodadas de seleção adicionais5.

Figure 1
Figura 1: Preparação, transformação e seleção de plantas. (A) Germinação de sementes de tomate em meio de ms de meia-força (1/2). (B) Sementes de tomate germinadas colocadas sobre o papel do filtro deitado sobre uma placa contendo 1/2 meio MS. Mudas de tomate antes(C) e depois(D)cortando o radicle e o fundo do hipocotyl. (E) Transformação de mudas de tomate mergulhando em biomassa bacteriana. (F) Mudas de tomate transformadas cobertas com papel filtro para manter a umidade. Surgimento(G) e remoção(H)de novas raízes peludas (não transformadas). (I)Raízes transformadas. (J) Seleção de raízes peludas de tomate transformadas por visualização de fluorescência DsRed. As setas vermelhas indicam raízes transformadas positivas expressando fluorescência DsRed. (K) Desenvolvimento das raízes transformadas como as principais raízes. (L) Visualização da fluorescência DsRed em raízes transformadas maduras. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: Método alternativo baseado na seleção de antibióticos. (A)Placa quadrada semi-preenchida contendo 1/2 ms médio. (B) Cortar as mudas dispostas em papel filtro deitado em meio de 1/2 MS com antibiótico, após a remoção das primeiras raízes peludas não transformadas. (C) Raízes cobertas com papel filtro adicional. (D) Raízes transformadas de tomate cultivadas em meio de 1/2 MS com antibiótico. (E) Mudas transformadas com pK7GWIWG2_II-RedRoot (kanamicina 50 μg/mL), expressando DsRed, como controle positivo. Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: Transferência de tomate transformado para potes de inoculação. (A) Tomates transformados em raízes transferidos para potes de inoculação embebidos. (B) Tomates transformados em potes de inoculação cobertos com uma tampa plástica para manter o alto nível de umidade. (C)Tomates transformados em raízes de duas a três semanas, após transferência para potes de inoculação, prontos para serem inoculados. (D)Plantas de tomate de três semanas de idade após a remoção do solo. (E) Fluorescência DsRed em raízes de plantas de tomate transformadas de 3 semanas. Clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4: Inoculação encharcada de solo da Ralstonia. (A) Materiais necessários para a inoculação R. solanacearum GMI1000. (B) Encharcado de solo de tomates transformados em potes de inoculação com R. solanacearum GMI1000 inoculum. (C) Tomates inoculados colocados sobre uma camada de solo em vasos. (D-H) Os sintomas da doença de Ralstonia variam de 0 (sem sintomas) a 4 (murcha completa). Clique aqui para ver uma versão maior desta figura.

Figure 5
Figura 5: Silenciamento SiCESA6 aumenta a resistência a R. solanacearum. (A) Sintomas da doença de plantas de tomate silupidas silérficasmediadas pela RNAI(CESA6-RNAi) e de tomate sem raízes (EV) sobre a inoculação com R. solanacearum. Os valores correspondem às médias ± SE de oito plantas. (B) Área a curva de progresso da doença das plantas mostradas no painel A. (C) 95% de confiança Intervalo de plantas mostrado no painel A. (D) Percentual das plantas sobreviventes mostradas no painel A. (E) Análise de expressão genética por qRT-PCR de SlCESA6mediado pela RNAi -silenciado (CESA6i) e plantas de tomate transformadas em raiz EV em raízes (1,2) e tiro (S). Os valores correspondem às médias ± SE de três réplicas técnicas. (F) Taxa de transformação de plantas de tomate transformadas em raízes EV e CESA6-RNAi de dois experimentos independentes. Os valores correspondem às médias ± SE, após duas rodadas de seleção. Clique aqui para ver uma versão maior desta figura.

Nome do primer Seqüência do primer (5'-3')
EFα-1-F GGTGGCGAGCATTTGA
EFα-1-R CGAGCCAACCATGGAAAACAA
qCESA6-F GATCTGGTTCTTTCTCGT
qCESA6-R TCCCTTTTTTTTTG
CESA6-RNAi-F CACCGGCGAAAAGGGGTTAG
CESA6-RNAi-R TTTGAGACTTTCACTGGGGGGA

Tabela 1: Seqüências de primer.

Ingredientes Por 1 L
Pepto bacto 10 g
Extrato de levedura 1 g
Ácidos casamino 1 g

Tabela 2: Composição média Phi (Ø).

Figura Suplementar 1: Reprodutibilidade do resultado apresentado na Figura 5A. Sintomas da doença de plantas de tomate silenciadaspor RNAi(CESA6-RNAi) e plantas de tomate transformadas por raiz EV após a inoculação com R. solanacearum. Os valores correspondem às médias ± SE de oito plantas. A análise da expressão genética foi realizada por plantas de tomate silupidas silérficasmediadas pela RNAi (CESA6i) e por vetores vazios (EV) em raízes (1,2) e por tiro (S). Os valores correspondem às médias ± SE de três réplicas técnicas. Clique aqui para baixar este número.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ralstonia solanacearum representa uma ameaça importante para a agricultura; no entanto, sua interação com hospedeiros naturais de importância agrícola ainda é pouco compreendida em comparação com outros patógenos bacterianos, especialmente em espécies de plantas agrícolas. Na maioria dos casos, a análise genética é dificultada pelo tempo e gastos necessários para modificar geneticamente plantas hospedeiras. Para enfrentar esse problema e facilitar a análise genética da infecção por R. solanacearum no tomate, desenvolvemos um método fácil baseadona transformação mediada de raízes de tomate(Figura 1),seguida de inoculação encharcada de solo(Figura 3). As raízes transformadas são selecionadas usando um repórter fluorescente (DsRed neste protocolo) (Figura 1). Além disso, também desenvolvemos um método alternativo baseado na seleção de antibióticos que não danifica a parte aérea não transformada (Figura 2).

O protocolo de transformação baseia-se no descrito por Ho-Plágaro et al.5, com várias modificações. A versatilidade deste método permite múltiplos ensaios adicionais em raízes transformadas, como aquelas para analisar a fisiologia vegetal, resposta a tratamentos químicos e/ou respostas a diferentes estresses bióticos e abióticos.

Após a transferência das plantas transformadas para o solo, consideramos a possibilidade de que as plantas possam desenvolver novas raízes que podem não ser transformadas. Exploramos essa possibilidade observando a fluorescência do DsRed no sistema radicular de plantas transformadas duas semanas após transferi-las para o solo (antes da inoculação de Ralstonia). Os resultados mostraram fluorescência vermelha na maioria das raízes (Figura 3D).

A transferência de T-DNA por Agrobacterium é integrada no genoma hospedeiro de forma aleatória e, portanto, este método gera uma população heterogênea de plantas de tomate com diferentes níveis de expressão do gene alvo. A infecção por R. solanacearo normalmente causa a morte das plantas, o que, posteriormente, dificulta a coleta de amostras de raízes após o experimento para analisar a expressão genética de cada planta. Para analisar o nível de expressão do gene alvo durante os experimentos, selecionamos duas a três plantas transformadas em raízes antes da etapa de inoculação, como amostra representativa da população que será inoculada. A Figura 5 mostra que a redução dos sintomas da doença nas plantas de tomate se correlaciona com a eficiência do silenciamento sila6 antes da etapa de inoculação. Portanto, e apesar das limitações do protocolo, nossos resultados representativos demonstram claramente que este método é uma poderosa ferramenta para estudar genes candidatos envolvidos em resistência ou suscetibilidade a R. solanacearum no tomate. O exemplo mostrado neste artigo permitiu determinar que derrubar slCESA6, uma sintase de celulose relacionada à parede celular secundária, aumenta a resistência à infecção por R. solanacearum, assemelhando-se a observações anteriores usando seu ortolog AtCESA8 (At4g18780) de Arabidopsis thaliana8.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada para revelar.

Acknowledgments

Agradecemos a todos os membros do laboratório macho por discussões úteis, Alvaro López-García por aconselhamento estatístico, e Xinyu Jian por assistência técnica e administrativa durante este trabalho. Agradecemos ao núcleo de Biologia Celular do PSC pela assistência com imagens de fluorescência Este trabalho foi apoiado pelo Programa de Pesquisa Prioritária Estratégica da Academia Chinesa de Ciências (bolsa XDB27040204), o Centro de Biologia do Estresse Vegetal de Xangai (chinês Academia de Ciências) e o programa chinês 1000 Talentos.

Materials

Name Company Catalog Number Comments
90 mm square Petri-dishes
Agar powder Sigma-Aldrich
Bacto peptone BD (Becton and Dickinson)
Casamino acids Sigma-Aldrich
Filter paper
In Vivo Plant Imaging System NightShade LB 985 Berthold Technologies
Jiffy pots Jiffy Products International A.S.
Micropore tape 3M
Murashige and Skoog medium (M519) Phytotechlab
Pindstrup substrate Pindstrup Mosebrug A/S
Scalpel and blade
Sodium hypochlorite Sigma-Aldrich
Sterile clean bench
Tweezers
Wahtman paper Wahtman International Ltd. Maldstone
Yeast extract OXOID

DOWNLOAD MATERIALS LIST

References

  1. Jiang, G., et al. Bacterial Wilt in China: History, Current Status, and Future Perspectives. Frontiers in Plant Science. 11, (8), 1549 (2017).
  2. Mansfield, J., et al. Top 10 plant pathogenic bacteria in molecular plant pathology. Molecular plant pathology. 13, (6), 614-629 (2012).
  3. Elphinstone, J. G. The current bacterial wilt situation: a global overview. In: Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. Allen, C., Prior, P., Hayward, A. C. American Phytopathological Society Press. St Paul, MN. 9-28 (2005).
  4. Jones, J. B., Jones, J. P., Stall, R. E., Zitter, T. A. Compendium of Tomato 1094 Diseases. APS Press. St Paul, MN. (1991).
  5. Ho-Plágaro, T., Huertas, R., Tamayo-Navarrete, M. I., Ocampo, J. A., García-Garrido, J. M. An improved method for Agrobacterium rhizogenes-mediated transformation of tomato suitable for the study of arbuscular mycorrhizal symbiosis. Plant Methods. 14, 34 (2018).
  6. Wydra, K., Beri, H. Structural changes of homogalacturonan, rhamnogalacturonan I and arabiogalactan protein in xylem cell walls of tomato gentoypes in reaction to Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 68, 41-50 (2006).
  7. Wydra, K., Beri, H. Immunohistochemical changes in methyl-ester distribution of homogalacturonan and side chain composition of rhamnogalacturonan I as possible components of basal resistance in tomato inoculated with Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 70, 13-24 (2007).
  8. Hernández-Blanco, C., et al. Impairment of cellulose synthases required for Arabidopsis secondary cell wall formation enhances disease resistance. Plant Cell. 19, (3), 890-903 (2007).
  9. Denancé, N., et al. Arabidopsis wat1 (walls are thin1)-mediated resistance to the bacterial vascular pathogen, Ralstonia solanacearum, is accompanied by cross-regulation of salicylic acid and tryptophan metabolism. Plant Journal. 73, (2), 225-239 (2013).
  10. Digonnet, C., et al. Deciphering the route of Ralstonia solanacearum colonization in Arabidopsis thaliana roots during a compatible interaction: focus at the plant cell wall. Planta. 236, (5), 1419-1431 (2012).
  11. Sang, Y., et al. The Ralstonia solanacearum type III effector RipAY targets plant redox regulators to suppress immune responses. Molecular Plant Pathology. 19, (1), 129-142 (2018).
  12. Remigi, P., Anisimova, M., Guidot, A., Genin, S., Peeters, N. Functional diversification of the GALA type III effector family contributes to Ralstonia solanacearum adaptation on different plant hosts. New Phytologist. 192, 976-987 (2011).
  13. Wang, K., et al. Functional assignment to positively selected sites in the core type III effector RipG7 from Ralstonia solanacearum. Molecular Plant Pathology. 17, 553-564 (2016).
  14. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 25, (4), 402-408 (2001).
  15. León-Morcillo, R. J., Martín-Rodríguez, J. A., Vierheilig, H., Ocampo, J. A., García-Garrido, J. M. Late activation of the 9-oxylipin pathway during arbuscular mycorrhiza formation in tomato and its regulation by jasmonate signalling. Journal of Experimental Botany. 63, (10), 3545-3558 (2012).
  16. Amrhein, V., Greenland, S., McShane, B. Retire statistical significance. Nature. 567, 305-307 (2019).
Transformação da Raiz do Tomate Seguida de Inoculação com <em>Ralstonia Solanacearum</em> para Análise Genética Direta da Doença de Wilt Bacteriano
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Morcillo, R. J. L., Zhao, A., Tamayo-Navarrete, M. I., García-Garrido, J. M., Macho, A. P. Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease. J. Vis. Exp. (157), e60302, doi:10.3791/60302 (2020).More

Morcillo, R. J. L., Zhao, A., Tamayo-Navarrete, M. I., García-Garrido, J. M., Macho, A. P. Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease. J. Vis. Exp. (157), e60302, doi:10.3791/60302 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter