Method Article

Laser Microdissection for Species-Agnostic Single-Tissue Applications

DOI:

10.3791/63666

March 31st, 2022

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

A protocol is described that uses laser microdissection to isolate individual nematode tissues for RNA-sequencing. The protocol does not require species-specific genetic toolkits, allowing gene expression profiles to be compared between different species at the level of single-tissue samples.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Single-cell methodologies have revolutionized the analysis of the transcriptomes of specific cell types. However, they often require species-specific genetic "toolkits," such as promoters driving tissue-specific expression of fluorescent proteins. Further, protocols that disrupt tissues to isolate individual cells remove cells from their native environment (e.g., signaling from neighbors) and may result in stress responses or other differences from native gene expression states. In the present protocol, laser microdissection (LMD) is optimized to isolate individual nematode tail tips for the study of gene expression during male tail tip morphogenesis.

LMD allows the isolation of a portion of the animal without the need for cellular disruption or species-specific toolkits and is thus applicable to any species. Subsequently, single-cell RNA-seq library preparation protocols such as CEL-Seq2 can be applied to LMD-isolated single tissues and analyzed using standard pipelines, given that a well-annotated genome or transcriptome is available for the species. Such data can be used to establish how conserved or different the transcriptomes are that underlie the development of that tissue in different species.

Limitations include the ability to cut out the tissue of interest and the sample size. A power analysis shows that as few as 70 tail tips per condition are required for 80% power. Tight synchronization of development is needed to obtain this number of animals at the same developmental stage. Thus, a method to synchronize animals at 1 h intervals is also described.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Nematodes—particularly the rhabditid nematodes related to the model system Caenorhabditis elegans—are a wonderful group of animals for evolutionary developmental biology (EDB) for many reasons1,2. Advantages include their small number of cells, defined and consistent cell lineages, transparency, and ease of culture and husbandry. There are also many resources available, including high-quality genomes for multiple species, and for C. elegans, extensive molecular genetic tools and knowledge about development, genetics, anatomy, and physiology3,4,5,6.

As with many other organisms, the ability to characterize transcriptome dynamics in single tissues or single cells has revolutionized the analysis of development in C. elegans7,8,9,10. Being able to compare single-cell transcriptomes across nematodes would similarly transform EDB using these organisms. For example, such comparisons would provide insight into how gene regulatory networks have evolved for characters (traits) that have been conserved, for characters that have diverged, or for characters that evolved independently.

However, isolating particular tissues or cells from nematodes is one of the big challenges. For many organisms, single cells can be dissociated from tissues and harvested in an unbiased way or can be labeled with tissue-specific expression of a fluorescent protein and sorted by fluorescence-activated cell sorting (FACS)11. In C. elegans, high-throughput (HTP) isolation of cells has been limited mostly to embryos because the tough outer cuticle (and hydrostatic skeleton) has hampered cell isolation from larvae and adults. To get around this challenge, some methods have employed genetic tools in whole C. elegans worms, such as tissue-specific mRNA-tagging12, and differential expression comparisons between wild-type and mutants affecting a cell type13. More recent methods have overcome the challenge by dissolving the cuticle to isolate nuclei14 or entire cells8,9,15. Cell isolation and cell culture have the obvious disadvantages, however, that cells are removed from their natural developmental or anatomical context—e.g., away from cell-cell signaling and contact with the extracellular matrix—which are expected to impact the gene expression profile15. Moreover, the genetic tools and tissue-specific markers are species-specific (i.e., they can only be used in C. elegans).

LMD provides an alternative method for isolating tissues without disrupting the natural context of cells. Significantly for EDB, LMD also allows transcriptomes from homologous tissues of different species to be compared without the need for species-specific genetic toolkits if genome or whole transcriptome sequences of these species are available. LMD involves targeting tissues by direct microscopical observation and using a laser microbeam—integrated into the microscope's optics—to cut out and harvest (capture) the tissue of interest16. Limitations of LMD are that it is not conducive to very HTP approaches (although the transcription profiles for tail tips, as described in this protocol, were robust with ~70 samples), certain samples might be difficult to dissect out, and cuts are limited to the precision of the laser and what can be visualized in the microscope.

The purpose of the present protocol is to describe how LMD, followed by single-tissue RNA-Seq, can be used to obtain stage- and tissue-specific transcriptome data from nematodes. Specifically, it demonstrates LMD for isolating tail tips from fourth-stage larvae (L4) of C. elegans. However, this method can be adapted to other tissues and, of course, different species.

In C. elegans, there are 4 cells that make the tail tip in both males and hermaphrodites. During the L4 stage in males—but not in hermaphrodites—the tail tip cells change their shape and migrate anteriorly and inwardly. This process also occurs in some but not all other rhabditid nematode species. Therefore, the tail tip is a good model for the evolution of sexual dimorphic morphogenesis. Because of its position, the tail tip is also easy to isolate by LMD.

To obtain transcriptome profiles from tail tips, the present protocol uses CEL-Seq2, an RNA-seq method developed for single cells17,18. This method has several advantages for LMD-derived tissues. CEL-Seq2 is highly sensitive and efficient, using unique molecular identifiers (UMIs) to allow straightforward quantification of mRNA reads, in vitro transcription to ensure linear amplification, and barcoding that allows multiplexing of individual tissue samples. The only limitation of CEL-Seq2 is that recovered reads are biased to the 3' end of mRNAs, and most isoforms thus cannot be distinguished.

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

1. Worm synchronization

NOTE: Two methods are described below to synchronize the development of C. elegans and other rhabditid species.

  1. Synchronize by first larval stage (L1) arrest following alkaline hypochlorite (bleach) treatment.
    NOTE: This method was described previously in detail19. This method relies on two features of C. elegans that are also true for several other rhabditid species: (1) The eggshell is resistant to bleach, whereas the cuticle surrounding adult and larval worms is not. (2) First-stage larvae arrest development when kept without food20.
    1. Treat gravid hermaphrodites (or females) with a diluted bleach solution to break up their cuticle and release embryos.
    2. Remove the embryos from the bleach and keep them without food until all L1 have hatched.
    3. Place the arrested L1 on food, where all resume development at about the same time.
      NOTE: Exit from L1 arrest can occur within one hour.
  2. Synchronization with the "hatch-off" method (used here; Figure 1 top):
    NOTE: The hatch-off method allows for tight synchronization without disruption of development (L1 arrest affects the development even of later stages21). The protocol is adapted from Pepper et al.22. The objective of this method is to collect L1 that have hatched over a specific period from a plate that only contains embryos.
    1. Pick mothers: On the evening before performing the hatch-off, pick ~30 gravid hermaphrodites onto a plate seeded with E. coli OP50.
    2. Incubate at 25 °C for egg-laying overnight.
      NOTE: Choose a plate without cracks or bubbles where worms could get stuck. Avoid plates with a very thick bacterial lawn as it will be difficult to remove all worms later. If working with a temperature-sensitive strain, adjust the egg-laying time to account for longer embryogenesis. Pick mothers at the maximum egg-laying stage.
    3. Remove mothers and larvae: the next morning, under the dissecting microscope (20x magnification), gently pipette 1-2 mL of M9 buffer against the wall of the plate without squirting; swirl the plate to dislodge the worms.
    4. Remove and discard all liquid and worms by placing the pipette tip against the wall of the plate at the edge of the agar to avoid poking holes. Check that no worms (and only eggs/embryos) are left on the plate, especially not L1s; otherwise, repeat the wash.
    5. Place the plate at 25 °C for 1 h and wait for some L1s to hatch.
    6. Collect newly hatched L1s: carefully drop 1 mL M9 buffer onto the agar. Swirl the plate to dislodge L1 but not embryos. Gently pipette buffer and worms into a 1 mL centrifuge tube.
    7. Centrifuge the tube for 1 min at ~18,000 × g. Remove the supernatant.
    8. Pipette L1 directly onto the bacterial lawn of a seeded plate. Verify under the dissection microscope that no adult worms or embryos are present.
    9. Keep worms at 25 °C until they have developed to the desired stage.
      NOTE: If conditions are optimal, two more batches of L1 can be collected from the same plate. Inspect the initial plate to make sure that no L1 are present. If necessary, wash again. Repeat steps 1.2.5-1.2.9.
    10. Check developmental timing. Before proceeding to the downstream application, inspect some worms under a compound microscope at 400x magnification to confirm they reached the desired developmental stage, here L3.
      NOTE: Migration distance of distal tip cells or linker cells can be used as a guide, in addition to vulva development. For vulva development, Mock et al.23 provide a useful guide, although timing in that study was determined at 20 °C. At 25 °C, wild-type C. elegans will undergo the L3-L4 molt 24 h after hatching.

2. Collecting L4 males and hermaphrodites and fixation

  1. Prepare RNAse-free, cold (-20 °C), 70% methanol before fixation.
  2. Under a dissection microscope at 30-50x magnification, begin picking males and hermaphrodites from the synchronization plates onto separate unseeded plates as soon as the sexes can be distinguished (~21 h after hatching, Figure 2), and continue picking for 1-2 h or until 200 animals are collected.
  3. Keep the worms at 25 °C until they reach the desired stage for the experiment.
  4. Wash the worms off the plate with 1-2 mL of M9 buffer using a pipette tip prewashed with M9 buffer containing 0.01% detergent (to prevent worms from sticking to the tip).
  5. Transfer the worms to a 1 mL centrifuge tube.
  6. Spin for 1 min at 21,000 × g to pellet the worms. Remove the supernatant.
  7. Add 1 mL of M9 buffer and mix to break up the pellet.
  8. Spin for 1 min at 21,000 × g to pellet the worms. Remove the supernatant.
  9. Repeat the wash.
  10. Add 1 mL of ice-cold 70% methanol and mix well.
  11. Spin for 1 min at 21,000 × g to pellet the worms. Remove the supernatant.
  12. Repeat steps 2.10 and 2.11.
  13. Add 500 µL of 70% methanol, mix, and store at 4 °C for 1 h to overnight.

3. Laser microdissection

NOTE: From here on, use RNase-free reagents and consumables; use filter tips.

  1. If the CEL-Seq2 method is used to process the samples, prepare a master mix for each CEL-Seq2 primer (Supplemental Table S1): pipette 2 µL of CEL-Seq2 primer, 1 µL of 10 mM dNTP, and 9 µL of 1% β-Mercaptoethanol (in RNase-free water) into a labeled 200 µL tube.
  2. Mounting on slide
    1. Under a dissection microscope, pipette 20 µL of the fixed worms (20-40 worms from step 2.13) onto the matte side of a polyethylene naphthalate (PEN)-membrane glass slide (where the membrane is).
    2. Wait for the methanol to evaporate. Use a slide warmer to speed up the evaporation.
      NOTE: Additional drops of methanol can be applied, and a pipette tip used to spread the worms out if they begin to clump as they dry. When worms are in clumps, they can be difficult to dissect.
  3. Setting up the microscope
    NOTE: The following protocol is specific to the instrument listed in the Table of Materials. It needs to be adjusted if a different LMD microscope is used.
    1. Place a desktop humidifier behind the stage on the side of the LMD microscope. Ensure that the vapor is blowing directly onto the stage.
      NOTE: The humidifier is helpful to reduce static electricity, which otherwise can prevent the small membrane section from falling into the tube cap.
    2. Turn the key for laser power.
    3. Turn stage control power on.
    4. Turn the microscope control box on.
    5. Open Laser Microdissection software.
    6. Remove the plastic shield over the stage.
    7. Click the unload button with the upward arrow for loading the membrane slides.
    8. Make sure the slide is completely dry, flip so that the membrane is facing down.
    9. Insert the slide and click continue in the change specimen window.
    10. Replace the plastic shield.
    11. On the bottom of the screen, choose which slide holder contains the slide.
    12. To load the tubes, click the unload button with the downward arrow.
    13. Pull the tray out and remove the tube block.
      NOTE: The tube block used for this experiment is for 500 µL PCR tubes.
    14. Insert the tube caps of 500 µL PCR tubes into the holder and fold the tube under.
    15. Return the block to the tray and slide the tray back into the microscope stage.
    16. In the change collector device popup window, select PCR tubes and click ok.
    17. Click on the empty tube location on the bottom left of the screen under collector device tube caps.
    18. In the Microscope control panel, select TL-BF for transmitted light brightfield illumination.
  4. Cutting
    NOTE: This protocol is specific for the instrument listed in the Table of Materials.
    1. Using the 2.5x lens, adjust the focus until the worms and the structure of the membrane are visible.
    2. Switch to the 20x lens.
    3. Move the stage to a region without worms. Adjust the focus such that the bubble-like structures in the membrane have a yellowish color (Figure 3A,B) to focus the laser on the correct focal plane.
    4. Set the laser parameters; for tail tips, start with Power 45, aperture 30, and speed 20.
    5. In the Laser Control panel, select calibrate. Follow the instructions.
      NOTE: The instrument will perform this step automatically. It will ensure that a shape drawn with the mouse on the screen is identical to the shape cut out by the laser.
    6. On the bottom of the screen at collector device tube caps, click on position A.
    7. On the right side of the screen, select single shape | Draw + Cut. On the left side of the screen, select PtoP.
    8. Draw a line.
    9. Click Start Cut so that the laser cuts through the membrane.
      NOTE: It may also etch a line into the glass.
    10. If this test-cut looks good (the membrane is cut, edges of cut look smooth), continue with the next step. Otherwise, adjust the focus and cut another line.
    11. Find a worm. Switch to Move + Cut and use the mouse to cut through the tail.
      NOTE: If the laser does not cut through the tail, adjust the focus and increase the laser power. For thicker tissues, laser power may have to be set to 60.
    12. Save the parameters: File tab | Save Application Configuration; for later retrieval, Restore Application Configuration.
    13. To collect the sample, switch to the Draw + Cut setting with the PtoP function and draw a shape to complete the cut of a membrane section (Figure 3C).
      NOTE: Larger membrane sections and sections shaped like rectangles or triangles rather than circles or ovals are easier to locate in the collector tube cap.
    14. Select the next tube at Collector Device Tube Cap on the bottom of the screen and cut the next tail tip.
    15. Once four tails are cut, unload the tube rack (click Unload with downward arrow) and find the membrane sections under a dissecting microscope (Figure 3D).
      NOTE: The sections may be located in the middle of the tube cap or stuck to the side of the cap.
    16. Continue with the downstream application. For CEL-Seq2, pipette 1.2 µL of a CEL-Seq2 primer master mix (from step 3.1) directly on top of the sample.
    17. Close the tube, label with primer number, and immediately place the tube cap directly on a piece of dry ice to flash-freeze the sample and prevent RNA degradation.
    18. Load more tubes, return the tube block to the stage, and cut more samples. Add a different CEL-Seq2 primer mix to each tail tip.
    19. Store all tubes at -70 °C.

4. Single-tail RNA sequencing with CEL-Seq2

NOTE: For full details about the CEL-Seq2 protocol, see Yanai and Hashimshony18.

  1. Clean the lab bench area with RNase decontamination solution to prevent RNA degradation.
  2. Prepare master mixes and keep them on ice.
    1. Prepare the reverse-transcription master mix: 0.4 µL of first strand buffer, 0.1 µL of 0.1M DTT, 0.1 µL of RNase inhibitor, and 0.1 µL of reverse transcriptase per sample.
    2. Prepare the second strand reaction master mix: 7 µL of water, 2.31 µL of second strand buffer, 0.23 µL of dNTP, 0.08 µL of E. coli ligase, 0.3 µL of E. coli DNA polymerase, 0.08 µL of RNaseH per sample.
  3. Breaking open cells and annealing with primers (see Supplemental Table S1 for the full list of primers):
    1. Program the thermocycler and its lid to 65 °C.
    2. Retrieve the samples from -70 °C and incubate them in the thermocycler for 2.5 min.
    3. Spin at 21,000 × g for 30-40 s.
    4. Incubate at 65 °C for 2.5 min.
    5. Move them immediately to ice.
    6. Spin at 21,000 × g for 30-40 s and return them to ice.
  4. Converting RNA to cDNA:
    1. Add 0.8 µL of the reverse transcription mix to each tail tip.
    2. Incubate at 42 °C for 1 h.
    3. Heat-inactivate at 70 °C For 10 min.
    4. Move it immediately to ice.
    5. Add 10 µL of the second strand mix to each tail tip.
    6. Flick the samples.
    7. Spin at 21,000 × g for 30-40 s.
    8. Incubate at 16 °C for 2 h.
  5. cDNA cleanup:
    1. Prewarm the DNA cleanup beads to room temperature.
    2. Pool up to 40 samples in a 1.5 mL centrifuge tube (up to 480 µL).
    3. Mix the beads until they are well dispersed and add 20 µL of beads and 100 µL of bead binding buffer for every 100 µL of the pooled sample (for 480 µL of sample add 480 µL of bead buffer and 96 µL of beads to a final volume up to 1,056 µL). Mix well by pipetting.
    4. Incubate at room temperature for 15 min.
    5. Place on a magnetic stand for at least 5 min until the liquid appears clear.
    6. Remove and discard all but 20 µL of the supernatant.
    7. Add 200 µL of freshly prepared 80% ethanol.
    8. Incubate for at least 30 s, remove the supernatant by pipetting it off without disturbing the beads. Discard the supernatant.
    9. Repeat steps 4.5.7 and 4.5.8 once.
    10. Air-dry the beads for 15 min or until they are completely dry.
    11. Resuspend the beads (~6.4 µL) with 6.4 µL of water. Mix thoroughly by pipetting the entire volume up and down ten times.
    12. Incubate at room temperature for 2 min.
    13. Go straight to in vitro transcription (IVT).
  6. In vitro transcription and fragmentation:
    1. To the tube containing 6.4 µL of sample and the beads, add the following mix (9.6 µL total): 1.6 μL of 10x T7 Buffer, 1.6 μL of ATP, 1.6 µL of UTP, 1.6 µL of CTP, and 1.6 µL of GTP (each dNTP at 75 mM concentration) 1.6 μLof T7 enzyme.
    2. Incubate for 13 h at 37 °C with a 4 °C hold.
    3. Add 6 µL of exonuclease solution (final volume should be 22 µL).
    4. Incubate for 15 min at 37 °C.
    5. Place the tube back on ice and add 5.5 µL of fragmentation buffer (0.25 × reaction volume).
    6. Incubate for 3 min at 94 °C.
    7. Immediately move the tube to ice and add 2.75 µL of fragmentation stop buffer (0.5 × volume of fragmentation buffer added).
    8. Remove the beads by placing the tube on the magnetic stand for at least 5 min until the liquid appears clear.
    9. Transfer the supernatant to a new tube.
  7. Amplified RNA (aRNA) cleanup:
    1. Prewarm the RNA cleanup beads to room temperature.
    2. Mix the beads until they are well dispersed.
    3. Pipette 55 µL of beads (1.8 × reaction volume).
    4. Incubate them at room temperature for 10 min.
    5. Place the tube on the magnetic stand for at least 5 min until the liquid appears clear.
    6. Remove and discard 80 µL of the supernatant.
    7. Add 200 µL of freshly prepared 70% ethanol.
    8. Incubate for at least 30 s, remove the supernatant by pipetting without disturbing the beads. Discard the supernatant.
    9. Repeat the ethanol wash two more times.
    10. Air-dry the beads for 15 min or until they are completely dry.
    11. Resuspend the beads with 7 µL of water. Pipette the entire volume up and down 10 times to mix thoroughly.
    12. Incubate at room temperature for 2 min.
    13. Place the tube with the beads on the magnetic stand for 5 min until the liquid appears clear.
    14. Transfer the supernatant to a new tube.
      NOTE: Stopping point: samples can be kept at -70 °C.
  8. Optional: Check the aRNA amount and quality with an automated electrophoresis system following the manufacturer’s protocol.
  9. Library preparation:
    1. To 5 µL of RNA, add 1 µL of 100 µM random hexamer RT primer (see the Table of Materials) and 0.5 µL of 10 mM dNTP.
    2. Incubate at 65 °C for 5 min.
    3. Add 4 µL of the following mix at room temperature: 2 µL of First Strand buffer, 1 µL of 0.1 M DDT, 0.5 µL of RNase inhibitor, 0.5 µL of reverse transcriptase.
    4. Incubate at 25 °C for 10 min.
    5. Incubate at 42 °C for 1 h (in a hybridization oven or a preheated thermal cycler with the lid set to 50 °C).
    6. Incubate at 70 °C for 10 min.
    7. Transfer 5 µL to a new tube (keep the rest of the reaction at -20 °C). Add 5.5 µL of ultrapure water, 1 µL of RNA PCR Primer (RP1), 1 µL of indexed RNA PCR Primer (RPIX), and 12.5 µL of PCR mix.
    8. Use the following program on the thermocycler: 30 s at 98 °C, 11 cycles of: (10 s at 98 °C, 30 s at 60 °C, 30 s at 72 °C), 10 min at 72 °C, hold at 4 °C.
      NOTE: Stopping point: samples can be kept at -20 °C.
  10. Library cleanup:
    1. Prewarm the DNA cleanup beads to room temperature.
    2.  Mix the beads until they are well dispersed.
    3. Add 25 µL of the beads to the PCR reaction. Mix well by pipetting.
    4. Incubate at room temperature for 15 min.
    5. Place the tube on the magnetic stand for at least 5 min until the liquid appears clear.
    6. Remove and discard 45 µL of the supernatant.
    7. Add 200 µL of freshly prepared 80% ethanol.
    8. Incubate for at least 30 s, remove, and discard the supernatant without disturbing the beads.
    9. Repeat the ethanol wash once.
    10. Air-dry beads for 15 min or until they are completely dry.
    11. Resuspend them with 25 µL of water. Mix well by pipetting.
    12. Incubate at room temperature for 2 min.
    13. Place the tube on the magnetic stand for 5 min until the liquid appears clear.
    14. Transfer 25 µL of supernatant to a new tube.
    15. Repeat steps 4.10.2-4.10.10 once.
    16. Resuspend with 10.5 µL of water. Mix well by pipetting.
    17. Incubate at room temperature for 2 min.
    18. Place the tube on the magnetic stand for 5 min until the liquid appears clear.
    19. Transfer 10 µL of the supernatant to a new tube and store at -20 °C.
  11. Assess the library quality and quantity according to the requirement of the sequencing facility.

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Following laser capture microdissection, individual tail tips of males and hermaphrodites at 4 time points (L3 22 h after hatch; L4 24, 26, and 28 h after hatch) were prepared for RNA sequencing using the CEL-Seq2 protocol. CEL-Seq2 primers contain unique barcodes that enable sequencing reads from a particular sample (in this case an individual tail tip) to be identified bioinformatically. Sequencing data were generated with this method for a total of 557 tail tips (266 hermaphrodites and 291 males across 4 developmental...

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Critical steps of the method
If performed correctly, the method described here will obtain robust RNA profiles with a relatively small number of laser-dissected samples (70 tail tips in this example). However, for samples from developing animals, tight synchronization is critical to reducing the variability between samples. For this reason, the protocol recommends the hatch-off method for worm-synchronization. Here, the researcher can determine and precisely control the age difference between indiv...

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

All authors declare that they have no conflicts of interest.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This work was funded by NIH (R01GM141395) and NSF (1656736) grants to DF and NIH fellowship (F32GM136170) to AW. Figure 1 was created with the help of BioRender.com.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
 0.5 µM PEN membrane glass slides RNase freeLeica11600288for LMD
500 µL PCR tubes (nuclease-free)Axygen732-0675to cut the tail tips into
Compound microscope with 40x objective and DICanyto check age of worms
Desktop humidifierany
Dissection microscope with transmitted light baseanyfor all worm work
glass pasteur pipetsanyhandle of worm pick
glass slides and coverslipsanyto check age of worms
LMD6 microdissection systemLeicamultipleto cut tail tips
LoBind tubes 0.5 mLEppendorf22431005
M9 BufferRecipe in WormBook
Methanol 99.8%Sigma322415to fix worms
NGM growth mediumUS BiologicalN1000Buffers and salts need to be added: Recipe in WormBook
P10 pipette variablle volumee.g. Gilson
P1000 pipette variable volumee.g. Gilson
P2 pipette variable volumee.g. Gilson
Pipette tips 1,000 µLany
Pipette tips 1-10 µL filteredany
platinum iridium wireTritechPT-9010to make worm pick
sterile and nuclease-free 1 mL centrfuge tubesany
Tween 20SigmaP9416Add a very small amount to M9 buffer to prevent worms from sticking to the pipet tips
vented 6 mm plastic Petri dishesany
For CEL-Seq2
4200 TapeStation System with reagents for high-sensitivity RNA and DNA detectionAligentautomated electrophoresis system
AMPure XP beadsBeckman CoulterA63880DNA cleanup beads
Bead binding buffer  20% PEG8000, 2.5 M NaCl
CEL-Seq2 primers (see Table S1)Sigma Genosys Mastercycler Nexus GX2 Eppendorf6335000020Thermal cycler with programmable lid and block for 200 µl tubes.
DNA Polymerase I (E. coli)Invitrogen18052-025
dNTP mix 10 mMany
E. coli DNA ligaseInvitrogen18052-019
Ethanol
ExoSAP-IT For PCR Product Clean-UpAffymetrix78200exonuclease solution
MEGAscript T7 Transcription KitAmbionAM1334For step 4.6.1
Nuclease-free waterany
Phusion High-Fidelity PCR Master Mix with HF BufferNEBM0531PCR mix step 4.9.7
random hexamer RT primer GCCTTGGCACCCGAGAATTCCA
NNNNNN
IDTa primer with 6 nucleotides that are random
RNA Fragmentation bufferNEBE6150S
RNA Fragmentation stop bufferNEBE6150S
RNA PCR Index Primers (RPI1–RPI48)Illumina, NEB, or IDTRPIX in protocol step 4.9.7, sequences available from Illumina
RNAClean XP beadsBeckman CoulterA63987
RNase AWAY Surface DecontaminantThermo Scientific7000TS1or any other similar product
RNaseH (E. coli)Invitrogen18021-071
RNaseOUT Recombinant Ribonuclease InhibitorInvitrogen10777-019
Second strand bufferInvitrogen10812-014
Superscripit IIInvitrogen18064-014reverse transcriptase

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Haag, E. S., Fitch, D. H. A., Delattre, M. From "the worm" to "the worms" and back again: the evolutionary developmental biology of nematodes. Genetics. 210 (2), 397-433 (2018).
  2. Sommer, R. J., Bumbarger, D. J. Nematode model systems in evolution and development. Wiley Interdisciplinary Reviews: Developmental Biology. 1 (3), 389-400 (2012).
  3. WormBase. , Available from: https://wormbase.org/#012-3-6 (2022).
  4. WormAtlas. , Available from: https://wormatlas.org (2022).
  5. WormBook. , Available from: http://wormbook.org (2022).
  6. WormBook in Genetics. , Available from: https://academic.oup.com/genetics/pages/wormbook (2022).
  7. Cao, J., et al. Comprehensive single-cell transcriptional profiling of a multicellular organism. Science. 357 (6352), 661-667 (2017).
  8. Kaletsky, R., Murphy, C. T. Transcriptional profiling of C. elegans adult cells and tissues with age. Methods in Molecular Biology. 2144, 177-186 (2020).
  9. Kaletsky, R., et al. Transcriptome analysis of adult Caenorhabditis elegans cells reveals tissue-specific gene and isoform expression. PLoS Genetics. 14 (8), 1007559(2018).
  10. Packer, J. S., et al. A lineage-resolved molecular atlas of C. elegans embryogenesis at single-cell resolution. Science. 365 (6459), 1971(2019).
  11. Kulkarni, A., Anderson, A. G., Merullo, D. P., Konopka, G. Beyond bulk: a review of single cell transcriptomics methodologies and applications. Current Opinion in Biotechnology. 58, 129-136 (2019).
  12. Von Stetina, S. E., et al. Cell-specific microarray profiling experiments reveal a comprehensive picture of gene expression in the C. elegans nervous system. Genome Biology. 8 (7), 135(2007).
  13. Baugh, L. R., et al. The homeodomain protein PAL-1 specifies a lineage-specific regulatory network in the C. elegans embryo. Development. 132 (8), 1843-1854 (2005).
  14. Haenni, S., et al. Analysis of C. elegans intestinal gene expression and polyadenylation by fluorescence-activated nuclei sorting and 3'-end-seq. Nucleic Acids Research. 40 (13), 6304-6318 (2012).
  15. Zhang, S., Banerjee, D., Kuhn, J. R. Isolation and culture of larval cells from C. elegans. PLoS One. 6 (4), 19505(2011).
  16. Emmert-Buck, M. R., et al. Laser capture microdissection. Science. 274 (5289), 998-1001 (1996).
  17. Hashimshony, T., et al. CEL-Seq2: sensitive highly-multiplexed single-cell RNA-Seq. Genome Biology. 17, 77(2016).
  18. Yanai, I., Hashimshony, T. CEL-Seq2-single-cell RNA sequencing by multiplexed linear amplification. Methods in Molecular Biology. 1979, 45-56 (2019).
  19. Porta-de-la-Riva, M., Fontrodona, L., Villanueva, A., Ceron, J. Basic Caenorhabditis elegans methods: synchronization and observation. Journal of Visualized Experiments: JoVE. (64), e4019(2012).
  20. Baugh, L. R. To grow or not to grow: nutritional control of development during Caenorhabditis elegans L1 arrest. Genetics. 194 (3), 539-555 (2013).
  21. Baugh, L. R., Hu, P. J. Starvation responses throughout the Caenorhabditis elegans life cycle. Genetics. 216 (4), 837-878 (2020).
  22. Pepper, A. S., Killian, D. J., Hubbard, E. J. Genetic analysis of Caenorhabditis elegans glp-1 mutants suggests receptor interaction or competition. Genetics. 163 (1), 115-132 (2003).
  23. Mok, D. Z., Sternberg, P. W., Inoue, T. Morphologically defined sub-stages of C. elegans vulval development in the fourth larval stage. BMC Developmental Biology. 15, 26(2015).
  24. Lytal, N., Ran, D., An, L. Normalization methods on single-cell RNA-seq data: an empirical survey. Frontiers in Genetics. 11, 41(2020).
  25. Vieth, B., Ziegenhain, C., Parekh, S., Enard, W., Hellmann, I. powsimR: power analysis for bulk and single cell RNA-seq experiments. Bioinformatics. 33 (21), 3486-3488 (2017).
  26. Bolkova, J., Lanctot, C. Quantitative gene expression analysis in Caenorhabditis elegans using single molecule RNA FISH. Methods. 98, 42-49 (2016).
  27. Ji, N., van Oudenaarden, A. Single molecule fluorescent in situ hybridization (smFISH) of C. elegans worms and embryos. WormBook. , 1-16 (2012).
  28. Lee, C., et al. Single-molecule RNA fluorescence in situ hybridization (smFISH) in Caenorhabditis elegans. Bio-Protocol. 7 (12), 2357(2017).
  29. Baird, S. E., Chamberlin, H. M. Caenorhabditis briggsae methods. WormBook. , 1-9 (2006).
  30. Felix, M. A. Oscheius tipulae. WormBook. , 1-8 (2006).
  31. Han, Z., et al. Improving transgenesis efficiency and CRISPR-associated tools through codon optimization and native intron addition in Pristionchus nematodes. Genetics. 216 (4), 947-956 (2020).
  32. Fernandes Povoa, E. E., Ebbing, A. L. P., Betist, M. C., vander Veen, C., Korswagen, H. C. An optimized dissociation protocol for FACS-based isolation of rare cell types from Caenorhabditis elegans L1 larvae. MethodsX. 7, 100922(2020).
  33. Han, M., Wei, G., McManus, C. E., Hillier, L. W., Reinke, V. Isolated C. elegans germ nuclei exhibit distinct genomic profiles of histone modification and gene expression. BMC Genomics. 20 (1), 500(2019).
  34. Steiner, F. A., Henikoff, S. Cell type-specific affinity purification of nuclei for chromatin profiling in whole animals. Methods in Molecular Biology. 1228, 3-14 (2015).
  35. Ebbing, A. Spatial transcriptomics of C. elegans males and hermaphrodites identifies sex-specific differences in gene expression patterns. Developmental Cell. 47 (6), 801-813 (2018).
  36. Rödelsperger, C., et al. Spatial transcriptomics of nematodes identifies sperm cells as a source of genomic novelty and rapid evolution. Molecular Biology and Evolution. 38 (1), 229-243 (2021).
  37. Amini, P., et al. An optimised protocol for isolation of RNA from small sections of laser-capture microdissected FFPE tissue amenable for next-generation sequencing. BMC Molecular Biology. 18 (1), 22(2017).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Single Cell RNASpecies Agnostic ProtocolTissue IsolationNematode Tail TipsCEL Seq2Gene Expression AnalysisDissection MicroscopePEN Membrane SlideSample Synchronization

Related Articles