Reverse Genetics to Engineer Positive-Sense RNA Virus Variants

Summary

The protocol describes a method for introducing controllable genetic diversity in the hepatitis C virus genome by combining full-length mutant RNA synthesis using error-prone PCR and reverse genetics. The method provides a model for phenotype selection and can be used for 10 kb long positive-sense RNA virus genomes.

Abstract

The lack of a convenient method for the iterative generation of diverse full-length viral variants has impeded the study of directed evolution in RNA viruses. By integrating a full RNA genome error-prone PCR and reverse genetics, random genome-wide substitution mutagenesis can be induced. We have developed a method using this technique to synthesize diverse libraries to identify viral mutants with phenotypes of interest. This method, called full-length mutant RNA synthesis (FL-MRS), offers the following advantages: (i) the ability to create a large library via a highly efficient one-step error-prone PCR; (ii) the ability to create groups of libraries with varying levels of genetic diversity by manipulating the fidelity of DNA polymerase; (iii) the creation of a full-length PCR product that can directly serve as a template for mutant RNA synthesis; and (iv) the ability to create RNA that can be delivered into host cells as a non-selected input pool to screen for viral mutants of the desired phenotype. We have found, using a reverse genetics approach, that FL-MRS is a reliable tool to study viral-directed evolution at all stages in the life cycle of the hepatitis C virus, JFH1 isolate. This technique appears to be an invaluable tool to employ directed evolution to understand adaptation, replication, and the role of viral genes in pathogenesis and antiviral resistance in positive-sense RNA viruses.

Introduction

Forward genetic screening begins with a viral phenotype of interest and then, through sequencing its genome and comparing it to that of the original strain, attempts to identify the mutation(s) causing that phenotype. In contrast, in reverse genetic screens, random mutations are introduced in a target gene, followed by an examination of the resultant phenotype(s)¹. For the reverse genetics approach, in vitro mutagenesis is the most widely used technique to create a pool of variants that are subsequently screened for phenotypes of interest. Various genetic tools have been reported for achieving genome-wide random mutagenesis of RNA viruses, including error-prone PCR (ep-PCR)^2,3, circular polymerase extension⁴, and Mu-transposon insertion mutagenesis ^5,6,7. The latter two methods yield libraries harboring limited sequence diversity and are prone to the introduction of large insertions and deletions, which are highly lethal for viruses and severely limit the recovery of infectious viral variants.

ep-PCR is a well-known powerful mutagenesis technique widely used in protein engineering to generate mutant enzymes for the selection of phenotypes with desired properties, such as enhanced thermal stability, substrate specificity, and catalytic activity^8,9,10. This technique is easy to perform because it requires simple equipment, does not involve tedious manipulations, uses commercially available reagents, and is quick; moreover, it generates high-quality libraries.

Here, we developed a novel method for full-length mutant RNA synthesis (FL-MRS) to generate complete genomes of hepatitis C virus (HCV) by integrating ep-PCR, which induces random genome-wide substitution mutagenesis and reverse genetics. Even a single nucleotide insertion or deletion is highly deleterious for positive-sense RNA viruses ([+]ssRNA); hence, PCR-based substitution mutagenesis is the preferred method for the iterative generation of large, diverse libraries of full (+)ss RNA virus genomes with good viability.

FL-MRS is a straightforward approach that can be applied to any positive-sense RNA virus with a ~10 kb genome length through the meticulous design of a primer set that binds to the viral cDNA clone. pJFH1 is an infectious cDNA clone that encodes the HCV genotype 2a and can recapitulate all steps of the virus life cycle. By using the FL-MRS approach, we demonstrated the synthesis of randomly mutagenized full-genome libraries (mutant libraries [MLs]) to produce replication-competent JFH1 variants for which there was no prior knowledge of the properties associated with mutations. Upon exposure to an antiviral, some of the viral variants quickly overcame the drug pressure with the desired phenotypic change. Using the protocol described here, a plethora of viral variants can be generated, creating opportunities to study the evolution of (+)ssRNA viruses.

Protocol

NOTE: The JFH1 strain (WT) used here was a kind gift from Takaji Wakita, National Institute of Infectious Diseases. The human hepatoma cell line, Huh7.5, was a kind gift from Charles Rice, The Rockefeller University. A schematic of the method is shown in Figure 1.

1. Genome-wide substitution mutagenesis of JFH1 using error-prone PCR

1. To perform ep-PCR, prepare the master mix for four sets of experiments with primers J-For 5'-GTTTTCCCAGTCAGCACGTTGTAAAACGACGGC-3' and J-Rev 5'-CATGATCTGCAGAGAGACCAGTTACGGCACTCTC -3' (Figure 1A), along with the reaction components described in Table 1 without the pJFH1 template (plasmid isolated from JFH1 strain).
2. Aliquot the master mix into four tubes, add 100 ng, 50 ng, 25 ng, and 10 ng of template into the individual tubes, and adjust the total volume of the reaction to 50 µL. Apply the cycling conditions described in Table 2 to amplify a 9736 base pair (bp) fragment comprising the T7 promoter and full-length HCV genome (Figure 2).
   NOTE: The ep-PCR product must contain the T7 promoter sequence to facilitate in vitro transcription of the viral genome. Therefore, the forward primer must be located upstream of the T7 promoter of the viral cDNA clone, and the reverse primer sequence should end at the 3'-end of the virus genome to facilitate transcription run-off. Optimize each component of the ep-PCR reaction within the range recommended by the manufacturer of Taq DNA polymerase to achieve high-yield amplification. In addition to varied template amounts, unbalanced dNTPs (especially low dATP and/or dGTP concentration) can also be used to increase diversity in the length of viral genomes from 6-8 kb long³.
3. Estimate the ep-PCR product amplified by loading equal volumes of the PCR products (5 µL) and comparing to known amounts of 1 kilobase (kb) DNA ladder by running a 0.8% Tris-acetate-EDTA (TAE)-based agarose gel electrophoresis¹¹. Purify the product using a column purification kit as directed by the manufacturer.
4. Estimate the concentration of the purified product by measuring the absorbance at 260 nm using a microvolume spectrophotometer¹². Vacuum concentrate the ep-PCR product if needed to obtain a product concentration ≥100 ng/µL.
   ​NOTE: More accurate estimation can be made by loading two-fold serial dilutions of ep-PCR product and comparing their intensities to the known amounts of 1 kb DNA ladder.

2. Viral RNA synthesis

1. Set up a 40 µL reaction to digest 5 µg of clonal-pJFH1 with 4 U of XbaI enzyme at 37 °C for 2 h, followed by column purification and measuring the absorbance at 260 nm in a microvolume spectrophotometer¹². Set up a 20 µL in vitro transcription reaction of the column-purified ep-PCR product or clonal-pJFH1 (WT) using a commercially available large-scale RNA production system according to the manufacturer's instructions.
2. In a 200 µL microcentrifuge tube, mix approximately 1 µg of the purified ep-PCR product (mutant libraries) or XbaI digested clonal-pJFH1, 10 µL of 2x buffer containing ribonucleotides, and 2 µL of T7 enzyme mix. Mix all the components and briefly spin down the components. Incubate the reaction mixture at 37 °C for 45 min, followed by the addition of 1 U RNase-free DNase enzyme and incubation at 37 °C for 30 min (Figure 1C).
3. Purify in vitro synthesized RNA using an RNA cleanup kit as per the manufacturer's instructions, elute in 40 µL of RNase- and DNase-free water, and estimate the concentration of the purified RNA by measuring the absorbance at 260 nm using a microvolume spectrophotometer¹². Make aliquots as needed (5 µg or 2 µg) to avoid freeze-thaw and store them at −80 °C. Verify the integrity and size of the viral transcripts by using 2 µg of RNA for a MOPS formaldehyde 0.8% agarose gel electrophoresis¹³ (Figure 3).

3. Estimation of the proportion of mutations in ep-PCR products (mutant libraries)

NOTE: In this step, the proportion of nucleotides mutated by subcloning the product obtained in step 2. was estimated to demonstrate the advantage of employing ep-PCR to create genetic heterogeneity using two full genome mutant libraries (ML50 and ML25) and clonal pJFH1-derived viral RNAs. The proportion of mutations was estimated in the HCV NS5A gene, which was also the phenotypic readout gene (drug resistance) in this study.

1. Set up a 20 µL cDNA synthesis reaction by adding approximately 1 µg of the viral RNA synthesized in step 2., 5 µM reverse primer 5'-GTGTACCTAGTGTGTGCCGCTCTA-3', and 200 U reverse transcriptase as per the manufacturer's recommendations.
2. Using the cDNA, amplify a 2571 bp fragment that comprises the complete NS5A gene. To do this, prepare a reaction mixture containing 0.5 µM for 5272F and 7848R primers (final concentration; Table 3), 1.5 mM MgCl₂, 1x PCR buffer, and 1 U high-fidelity Taq polymerase in a total volume of 50 µL and run an amplification cycle using the conditions described in Table 4.
3. Run the product on a 0.8% TAE-based agarose gel to confirm the product size of 2571 bp and then purify the product using a column purification kit as directed by the manufacturer. Elute the column-purified product in 40 µL of sterile water.
4. To add a 3' A overhang to the product, add 0.5 µM dATP and 1 U of low-fidelity Taq DNA polymerase and incubate the entire PCR product at 70 °C for 30 min along with 1x PCR buffer and 1.5 mM MgCl₂ (final concentration). Purify the mixture using a column purification kit as directed by the manufacturer
   NOTE: Alternatively, excise the ~9.7 kb long product from the gel from step 1.4. and perform cloning using a commercially available kit for cloning of long-PCR product according to the manufacturer's instructions or perform NGS of the ep-PCR product using an Illumina platform².
5. Set up a ligation reaction by adding 5 µL of 2x ligation buffer, 50 ng of the T-vector DNA, approximately 3-fold molar excess of the insert DNA synthesized in step 3.4., 3 Weiss units of T4 DNA ligase, and nuclease-free water to a total volume of 10 µL. Incubate this reaction at room temperature for 3 h and then add 100 µL of Escherichia coli DH5α with the ligated DNA; heat shock the cells at 42 °C for 35 s (Figure 1B).
6. Add 1 mL of Luria-Bertani (LB) medium (without antibiotic) and incubate with gentle shaking for 1 h at 37 °C for recovery. Centrifuge the cell suspension at 13,800 x g, discard the supernatant, and resuspend in 200 µL of fresh LB medium.
7. Plate 100 µL of the transformed E. coli DH5α cells on an LB plate containing 50 µg/mL ampicillin and incubate at 37 °C for 16 h. Set up minipreps of 25-30 colonies in 5 mL of LB medium + 50 µg/mL ampicillin and grow overnight at 37 °C.
8. The next day, extract the plasmids with a plasmid purification kit according to the manufacturer's instructions and perform restriction enzyme digestion in 10 µL volume with 200 ng of the isolated plasmids, 2 U of EcoR1, and 1x restriction buffer for all the colonies.
9. After incubating the digestion mixtures at 37 °C for 3 h, resolve the products on 0.8% TAE-based agarose gel to confirm plasmid DNA insertion.
10. Perform Sanger sequencing of the plasmids of 25 positive clones using M13 Forward, M13 reverse, 6208-SPF, and 6748-SPF primers (Table 3) to determine the proportion of mutations (expressed as the proportion of nucleotides mutated) in the viral RNAs derived from the libraries and clonal pJFH1 (Figure 1B and Figure 4).

4. Viral RNA transfection of the Huh7.5 cell line

NOTE: Use RNase/DNase-free tissue culture materials and work in a sterile class II biosafety cabinet. Work in the recommended containment facility as per the biosafety guidelines of the organization.

1. Maintain Huh7.5 cells by incubating in a 5% CO₂ incubator at 37 °C in a T75 cm² tissue culture flask containing 15 mL of complete Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% (vol/vol) fetal bovine serum, penicillin (100 U/mL), and streptomycin (100 µg/mL; Figure 1D).
2. Split the cells in a 1:3 ratio when confluency reaches 90%. Wash the cells with 1x prewarmed phosphate-buffered saline (PBS; pH 7.4). Add 5 mL of 1x trypsin-EDTA solution to completely cover the cell layer, gently swirl the flask, and then incubate the flask at 37 °C for 5 min.
   NOTE: Incubation time may vary; incubate the cells until the cell layer is completely detached from the cell culture flask surface.
3. Add 10 mL of 1x prewarmed complete DMEM, disperse the cells by repeat pipetting, and collect the cell suspension in a 15 mL or 50 mL sterile centrifuge tube. Centrifuge the cell suspension at 252 x g for 5 min at room temperature. Discard the supernatant, resuspend the cell pellet in 6 mL of complete DMEM, and incubate the cells at 37 °C in a humidified incubator with 5% CO₂.
4. For continuous maintenance of naïve, transfected, or virus-infected Huh7.5 cells, repeat step 4.2. and step 4.3.
5. 1 day prior to transfection, split the cells as described in steps 4.1.-4.3., count the number of viable cells using a hemocytometer, seed the Huh7.5 cells at a density of 0.6 x 10⁶ in 35 mm dishes in 2 mL of complete DMEM, and incubate the cells at 37 °C in a humidified incubator with 5% CO₂.
6. On the following day, prepare the transcript-lipid complex. To do this, dilute 10 µL of transfection reagent in 50 µL of minimal essential medium, and separately dilute 5 µg of viral transcripts in 50 µL of minimal essential medium.
7. Incubate both mixtures at room temperature for 10 min, and then mix them in a single sterile microcentrifuge tube and further incubate the mixture at room temperature for 30 min to form the transcript-lipid complex.
8. After 16 h of cell incubation, remove the culture medium from the culture dish, wash the cells 2x with prewarmed 1x PBS, and add 1.5 mL of minimal essential medium. Slowly add the transcript-lipid complex to the dish and gently swirl with hands to ensure uniform distribution of the complexes.
9. Incubate the cells in a 5% CO₂ incubator at 37 °C for 10 h. Then, remove the medium, wash the transfected cells 2x with 1 mL of prewarmed 1x PBS, and add 2 mL of complete DMEM.

5. Virus production

1. Split the transfected Huh7.5 cells every 2 days or 3 days when they reach 90% confluency. Collect virus supernatants at every split and store them at −80 °C for further analysis.
2. At every split, monitor the spread of the virus using a focus forming assay (FFA) as described in step 6.2. Harvest the virus until the virus spread reaches >80% of transfected cells (Figure 1D).
   NOTE: Split the transfected cells at 1:1 ratio for the first few passages to rescue the maximum number of viral variants. Virus spread slows and viability decreases with increasing proportions of mutations in the full-genome MLs².

6. Quantification of virus titers

1. Quantification of viral RNA
   1. Isolate viral RNA from 140 µL of culture supernatants using a viral RNA isolation kit according to the manufacturer's instructions.
   2. Set up a 10 µL qRT-PCR reaction using a commercial qRT-PCR kit according to the manufacturer's instructions. Use the forward primer R6-130-S17, reverse primer R6-290-R19 (final concentration 0.2 µM each), and probe R9-148-S21FT (final concentration 0.3 µM) for HCV RNA quantification (Table 3). Set the run conditions as 48 °C for 20 min, 95 °C for 10 min, and then 45 cycles of 95 °C for 15 s and 60 °C for 1 min.
      NOTE: The probe should contain the fluorescent reporter dye 6-carboxyfluorescein (FAM) and the quencher dye 6-carboxy-tetramethyl-rhodamine (TAMRA) at the 5' and 3' ends, respectively.
   3. Run reactions in a real-time PCR machine. Setup negative controls, i.e., RNA extracted from the supernatants of mock-infected cells and nuclease-free water simultaneously to ensure the absence of cross-contamination.
   4. In parallel, generate a standard curve using a 10-fold serially diluted known copy number of HCV transcripts (1 x 10⁸ to 0) for the quantification of viral RNA. Perform the quantification in triplicate (Figure 1D).
2. Infectious virus titer quantification using 50% tissue culture infectious dose (TCID₅₀)
   1. Approximately 16 h prior to adding the virus, plate 6.5 x 10³ Huh7.5 cells/well in a 96-well plate and incubate the cells at 37 °C in a 5% CO₂ incubator.
   2. In a biosafety class II cabinet, perform 10-fold serial dilutions (1 mL each) covering 1 x 10⁻¹ to 1 x 10⁻⁶ dilutions (eight dilutions) of the harvested virus (obtained when the virus spread reaches >80% of cells as described in step 5.). Add 100 µL/well (with eight replicates) of the diluted virus to infect the Huh7.5 cells and keep the plate in an incubator at 37 °C with 5% CO₂ for 3 days.
   3. After 3 days, wash the infected cells 3x with 0.1 mL of PBS each time, and fix and permeabilize the cells with 0.1 mL of ice-cold methanol at −20 °C for 20 min. Wash the wells with 1x PBS 3x and then 1x with PBS-T (1x PBS/0.1% [v/v] Tween-20).
   4. After removing the PBS-T, block the cells for 30 min at room temperature with 0.1 mL of 1% bovine serum albumin (BSA) containing 0.2% skimmed milk in PBST. Remove the blocking solution and treat the cells for 5 min with 0.1 mL of 3% H₂O₂ prepared in 1x PBS.
   5. Again, wash the cells 2x with 1x PBS and 1x with PBS-T, then add 50 µL/well of anti-NS5A 9E10 mAb (1:10000, stock 1 mg/mL; a kind gift from Charles Rice, The Rockefeller University), and incubate at room temperature for 1 h. Wash the wells again 3x with 1x PBS and 1x with PBS-T.
   6. Add 50 µL/well of HRP-conjugated goat anti-mouse secondary IgG (1:4000), incubate for 30 min at room temperature, and then remove the unbound antibody by washing the wells with 0.1 mL of 1x PBS.
   7. Add 30 µL of DAB (diaminobenzidine tetrahydrochloride) color substrate and incubate the plate with gentle rocking for 10 min at room temperature. The substrate develops a brown precipitate on the well surface that indicates HCV NS5A antigen.Remove the DAB solution and wash the wells 2x with 1x PBS and 1x with distilled water. Add 100 µL of PBS containing 0.03% sodium azide.
   8. Examine each well under an inverted light microscope using a 10x objective. Count the number of positive wells. If the well contains one or more NS5A-positive cells, then it is positive; if the well shows an absence of NS5A-positive cells, then it is negative. Use a Reed and Muench calculator to estimate the endpoint dilution that infects 50% of the wells (TCID₅₀)^14,15. A reciprocal of the dilution required to yield the TCID₅₀ is the virus infectivity titer (foci forming units) per unit volume.
      ​NOTE: Virus infectivity titers vary for different mutant libraries.

7. Drug-resistant viral variant selection

1. Dissolve pibrentasvir (PIB), an NS5A inhibitor, in 100% DMSO to a concentration of 1 mM and further dilute it in complete DMEM to a concentration of 10 nM.
2. To determine the 50% effective concentration of PIB, seed Huh7.5 cells at a density of 0.6 x 10⁶/well in a 6-well plate and incubate the cells at 37 °C in a 5% CO₂ incubator. After 16 h of cell incubation, add a virus dose of either ML50 or clonal JFH1 virus to infect 50% of cells, and then, at 12 h post-infection (h p.i.), treat the cells with a two-fold dilution series of PIB ranging from 0.5-100 pM. Measure the FFA and quantify FFU as in step 6.2. after 3 days of incubation.
3. Plot the dose-response curves using FFU-reduction assay values in statistical analysis software. From the sigmoidal curve, obtain the 50% effective concentration (EC₅₀; Figure 5).
   NOTE: The effective concentration range may vary depending on the class, between HCV antivirals of the same class, and depending on the mutant library.
4. For the experiment, infect naïve Huh7.5 cells at 70% confluence with an ML50 virus (variants derived from ML50 RNA) dose to infect 50% of the cells for 12 h, and then transfer the infected cells onto 6-well plates 24 h post-infection.
5. Add 1x EC₅₀ PIB (47.3 pM) to the infected cells after 16 h of cell split. Do this after every cell split for six consecutive passages (18 days), followed by three drug-free passage cycles, and monitor virus spread using FFAs as described in step 6.2. Scale-up FFA reagents as per the growth area. Harvest viral supernatants at each passage and store them at −80 °C until use.
   NOTE: Viral spread to greater than 50% of cells during treatment follow-up may be defined as a breakthrough, and viral spread during the drug withdrawal period may be defined as viral relapse¹⁶.
6. Extract viral RNA from the supernatant on day 18, as described in step 6.1.1., and then synthesize cDNA, as shown in step 3.1. Amplify the NS5A gene using 5 µL of 1:5 diluted cDNA and the PCR components described in step 3.2. Then, follow steps 3.3.-3.5. to determine NS5A drug resistance mutations in 6-8 positive bacterial plasmids using the NS5A sequencing primers 6186F, 6862F, and 6460R (Table 3 and Table 4).
   NOTE: Here in this study, we reported substitutions in NS5A of variants selected during PIB treatment at 1x EC₅₀. This will rule out the contribution of substitutions other than NS5A in reduced susceptibility to PIB.

Representative Results

A plethora of full-length HCV variants can be generated and screened for drug-resistant phenotypes of interest following the procedures described in Figure 1. Full genome mutant libraries were synthesized using clonal-pJFH1 in decreasing amounts (100-10 ng), as shown in Figure 2. Average yields of ep-PCR products (mutant libraries) ranged from 3.8-12.5 ng/µL. Figure 3 shows the viral transcripts synthesized from the clonal-pJFH1 and the representative mutant library (ML50 synthesized using 50 ng of clonal-pJFH1). The clonal-pJFH1 was linearized via XbaI digestion, while ML50 was used directly in the in vitro transcription reaction. The proportion of mutations in mutant libraries (mutant viral RNAs) increased with decreasing input pJFH1 in the ep-PCR reaction, as shown in Figure 4. ML50 synthesized using 50 ng of the template (clonal-pJFH1) had 4 substitutions per 10,000 bp copied, whereas ML25 synthesized using 25 ng of template harbored 9 substitutions.No substitutions within the number of nucleotides sequenced were found in clonal-pJFH1. ML50 viral variants were less susceptible (12.7-fold) to pibrentasvir, an NS5A inhibitor, compared to clonal-JFH1 virus, as shown in Figure 5. Table 5 has NS5A substitutions identified in ML50 viral variants selected against 1x EC₅₀ of pibrentasvir treatment. Of the eight NS5A clones, four had a combination of D7V+F28C, whereas V8A+F28C and F36L occurred in one clone each. These mutations were at the N-terminus region of NS5A, which is known to harbor clinically relevant NS5A-resistance mutations¹⁷.

Figure 1: Schematic of the FL-MRS strategy and drug-resistant phenotype selection. (A) The pJFH1 cDNA (wild-type) clone carries a full-length genotype 2a virus genome and T7 promoter. The primer J-For is upstream of the T7 promoter, and the primer J-Rev is located at the 3' end of the HCV genome. (B) Clonal-pJFH1 is randomly mutagenized using error-prone PCR to engineer genetic variations and to create full genome mutant libraries. Clonal-pJFH1 is linearized by XbaI digestion. (C) Full-genome ep-PCR products and linearized clonal-pJFH1 are the templates for in vitro transcription. The proportion of mutations in the viral RNAs of MLs and clonal-JFH1 was determined by TA subcloning of NS5A and Sanger sequencing of positive TA clones. (D) Replication-competent variants generated after mutant viral RNA transfection of Huh7.5 cells were treated with pibrentasvir (an NS5A inhibitor) for the selection of NS5A-resistant phenotypes. Please click here to view a larger version of this figure.

Figure 2: Agarose gel electrophoresis of ep-PCR products. HCV full-genome ep-PCR products synthesized using varying template amounts (100 ng, 50 ng, 25 ng, and 10 ng of pJFH1) were separated using 0.8% TAE agarose gel electrophoresis. The expected size of the ep-PCR product is 9.7 kb. The separated products were visualized by ethidium bromide staining. Lane 1 is a 1 kb DNA ladder; Lane 6 is no-template control (labeled as H₂O). Please click here to view a larger version of this figure.

Figure 3: MOPS formaldehyde agarose gel electrophoresis of viral transcripts. Linearized pJFH1 (Lane 2) and the mutant library obtained with 50 ng (ML50) of pJFH1 containing ep-PCR (Lane 3) were used as templates for the in vitro transcription reaction. The integrity of the transcripts was analyzed using a MOPS formaldehyde 0.8% agarose gel stained with ethidium bromide. Lane 1 is a 1 kb RNA ladder. Please click here to view a larger version of this figure.

Figure 4: Proportion of substitutions in mutant libraries. NS5A genes from RNAs of clonal-pJFH1, ML50, and ML25 were amplified in high-fidelity PCRs, followed by the addition of 3' A overhang, ligation of the product with T-vector, and transformation of E. coli DH5α with the ligated product. Around 40,000 nucleotides/library or clonal-pJFH1 were Sanger sequenced. An average proportion of mutations per 10,000 bp copied is shown. Please click here to view a larger version of this figure.

Figure 5: Estimation of EC₅₀ of pibrentasvir against ML50 variants. Huh7.5 cells were infected with clonal-JFH1 virus or ML50 variants and treated with serial two-fold dilutions starting at 100 pM of pibrentasvir, followed by FFA after 3 days. Sigmoidal dose-response curves using FFU-reduction assay values were plotted in statistical analysis software to estimate the 50% effective concentration. Please click here to view a larger version of this figure.

Components for 50 µL	Required stock value	Final concentration/reaction
10x PCR buffer	5.0 µL	1x
MgCl2 (50 mM)	1.5 µL	1.5 mM
KB Extender	2.0 µL	-
dNTPs (10 mM)	1.0 µL	0.2 mM
Forward primer (10 µM)	1.0 µL	0.2 µM
Reverse primer (10 µM)	1.0 µL	0.2 µM
Taq DNA Polymerase (10 U/µL)	0.5 µL (1:4 diluted)	1 U
Template (pJFH1, 20 ng/µL)	0.5 to 5.0 µL	10 to 100 ng
Water	32.5 to 37.5 µL	Adjust for final volume of 50 µL

Table 1. Ep-PCR components for the amplification of HCV full genome.

Temperature	Time	Cycle(s)
95 °C	3 min	1
95 °C	30 Sec	30
60 °C	25 Sec
72 °C	8 min
72 °C	10 min	1
4 °C	Hold

Table 2. Cycling conditions for the ep-PCR of HCV full genome.

Assay	Primer	Sequence (5’-3’)
Amplification of partial NS4B-NS5A-partial NS5B	5272F	TGGCCCAAAGTGGAACAATTTTGG
	7848R	GGCCATTTTCTCGCAGACCCGGAC
cDNA synthesis	9464R	GTGTACCTAGTGTGTGCCGCTCTA
qRT-PCR	R9-148-S21FT (TaqMan probe)	CTGCGGAACCGGTGAGTACAC
	R6-130-S17	CGGGAGAGCCATAGTGG
	R6-290-R19	AGTACCACAAGGCCTTTCG
Sequencing primers to determine proportions of mutations in ep-PCR products	6208-SPF	CCCAACTACTTGGCTCTCTTAC
	6748-SPF	GACGGTGTGCAGATCCATAG
NS5A gene sequencing (and to determine proportions of mutations in ep-PCR products)	6186F	CAACGCAGAACGAGACCTCATCCC
	6862F	GACCTTTCCTATCAATTGCTACAC
	6460R	TGGGCACGGCCTGACTACAA

Table 3. Primers and sequences used in assays.

Temperature	Time	Cycle(s)
95 °C	4 min	1
95 °C	30 Sec	5
68 °C	30 Sec
72 °C	2 min
95 °C	30 Sec	5
66 °C	30 Sec
72 °C	2 min
95 °C	30 Sec	5
64 °C	30 Sec
72 °C	2 min
95 °C	30 Sec	5
62 °C	30 Sec
72 °C	2 min
95 °C	30 Sec	10
60 °C	30 Sec
72 °C	2 min
72 °C	10 min	1
4 °C	Hold

Table 4. Cycling conditions for NS5A amplification.

Substitution(s)	No. of clones (n=6)
D7V+F28C	4
V8A+F28C	1
F36L	1

Table 5. Pibrentasvir-resistance substitutions of NS5A.

Discussion

In this study, we have detailed a simple and rapid FL-MRS procedure that integrates ep-PCR¹⁸ and reverse genetics for synthesizing HCV full-genome libraries, which can then be used in a cell culture system to generate replication-competent variants for the screening of drug-resistant phenotypes. The use of low-fidelity Taq DNA polymerase is a prerequisite of ep-PCR that allows the incorporation of substitutions during PCR amplification of a full-length viral genome. We tested several low-fidelity Taq DNA polymerases and found that Platinum Taq DNA polymerase yielded a ~10 kb sized ep-PCR product with a high yield (data not shown). We recommend using a fixed number of thermal cycles and varying the input template amount to control the proportion of mutations in the full-genome libraries. Since FL-MRS utilizes erroneous full genomes as templates for full-length viral RNAs, a careful design of the primer set is critical to ensure that the RNA synthesis reaction produces virus transcripts of defined length: (i) the forward primer must be located upstream (~50 nucleotides) of the T7 promoter of the cDNA clone to facilitate T7 polymerase binding to the ep-PCR product; and (ii) the reverse primer sequence must end at the 3' end of the virus genome to facilitate transcription runoff during in vitro RNA synthesis.

However, the method is relatively crude, and there is no control over incorporating the required number and type of substitutions at regions of interest in the genome. A major advantage of FL-MRS is that the synthesized full-length transcripts can be directly used to transfect cells, which renders the approach simple and efficient for generating a large pool of viral variants. In contrast, circular polymerase extension and Mu-transposon insertion mutagenesis methods require cloning of the PCR product and screening of transformants prior to selection of the desired phenotype, which severely limits the diversity of the pool of mutants. Although our method greatly increases the chance of yielding several desired phenotypes, the evaluation of individual viral variants is normally required in screening.

Integration of ep-PCR with virus reverse genetics allowed us to quickly generate HCV mutants. This method has the potential to generate hundreds of genetically modified viruses, a feat seemingly not possible with the currently available in vitro mutagenesis techniques. The method detailed here is readily adaptable to cDNA clones carrying any (+)ssRNA viruses containing genomes up to ~10 kb in length.

Materials

Name	Company	Catalog Number	Comments
1 kb plus DNA ladder	Thermo Fisher	10787018
1.5 ml centrifuge tube	Tarsons	500010
15 ml centrifuge tube	Tarsons	546021
35 mm cell culture dish	Tarsons	960010
50 ml centrifuge tube	Tarsons	546041
Acetic acid	Merck	A6283
Agarose	HiMedia	MB080
Agrose gel electrophoresis unit	BioRad	1704406
Biosafety Cabinet, ClassII	ESCO	AC2 4S
Bovine serum albumin	HiMedia	MB083
Centrifuge	Eppendorf	5424-R
CFX Connect Real-Time PCR Detection System	BioRad	1855201
Cloning plates 90 mm	Tarson	460091
CO2 Incubator	New Brunswick	Galaxy 170R
Colibri Microvolume Spectrometer	Titertek-Berthold	11050140
DAB Substrate Kit	Abcam	ab94665
dATP Solution	NEB	N0440S
Deoxynucleotide (dNTP) Solution Set	NEB	N0446
Diethyl Pyrocarbonate (DEPC)	SRL chemical	46791
Dimethyl sulphoxide (DMSO)	HiMedia	MB058
DMEM high glucose	Lonza	BE12-604F
EcoR1-HF	NEB	R3101
EDTA tetrasodium salt dihydrate	HiMedia	GRM4918
Ethidium Bromide	Amresco	X328
Fetal bovine serum	Gibco	26140079
Formaldehyde	Fishser Scientific	12755
Gel Documentation System	ALPHA IMAGER
Goat anti-Mouse IgG (H+L) Secondary Antibody, HRP	Thermo Fisher	A16066
Hydrogen peroxide 30%	Merck	107209
Inverted microscope	Nickon	ECLIPSE Ts2
LB broth	HiMedia	M1245
Lipofectamine 2000	Thermo Fisher	116680270	transfection reagent
Mechanical Pipette Set	Eppendorf	3120000909
Methanol	Merck	106009
Micro Tips 0.2-10 µl	Tarsons	521000
Micro Tips 10 - 100 µl	Tarsons	521010
Micro Tips 200-1000 µl	Tarsons	521020
MOPS buffer	GeNei	3601805001730
Nonessential aminoacids (NEAA)	Gibco	11140050
One Shot TOP10 Chemically Competent E. coli	Invitrogen	C404010	E.coli DH5α
Opti-MEM	Gibco	1105-021	minimal essential medium
PCR tubes 0.2 ml	Tarsons	510051
Pencillin/streptomycin	Gibco	15070063
pGEM-T Easy Vector System	Promega	A1360	T-vector DNA
Phosphate buffer saline (PBS)	HiMedia	TI1099
Phusion High-Fidelity DNA Polymerase	NEB	M0530S
Pibrentasvir	Cayman Chemical	27546
Pipette controller	Gilson	F110120
Platinum Taq DNA Polymerase	Thermo	10966034
Prism	GraphPad		statistical analysis software
QIAamp Viral RNA Mini kit	Qiagen	52904	viral isolation kit
QIAprep Spin Miniprep Kit	Qiagen	27106
QIAquick PCR Purification Kit	QIAGEN	28104	cokum purification kit
RNeasy Mini Kit	QIAGEN	74104	RNA cleanup kit
Serological Pipettes 25 ml	Thermo Fisher	170357N
Serological Pipettes 5 ml	Thermo Fisher	170355N
Serological Pipettes10 ml	Thermo Fisher	170356N
Single strand RNA Marker 0.2-10 kb	Merck	R7020
Skim milk	HiMedia	M530
Sodium azide 0.1 M solution	Merck	8591
SuperScript III Reverse Transcriptase	Invitrogen	18080044	reverse transcriptase
T100 Thermal Cycler	BioRad	1861096
T175 cell culture flask	Tarsons	159910
T25 cell culture flask	Tarsons	950040
T7 RiboMax Express Large Scale RNA Production System	Promega	P1320	Large Scale RNA Production System
T75 cell culture flask	Tarsons	950050
Taq DNA Polymerase	Genetix Biotech (Puregene)	PGM040
TaqMan RNA-to-CT 1-Step Kit	Applied Biosystems	4392653
TaqMan RNA-to-CT 1-Step Kit	Thermo Fisher	4392653	commercial qRT-PCR kit
TOPO-XL--2 Complete PCR Cloning Kit	Thermo Fisher	K8050-10	kit for cloning of long-PCR product
Tris base	HiMedia	TC072
Trypsin-EDTA solution	HiMedia	TCL007
Tween 20	HiMedia	MB067
Vacuum Concentrator	Eppendorf, Concentrator Plus	100248
Water bath	GRANT	JBN-18
Xba1	NEB	R0145S