Method Article

Investigating the Pathogenesis of MYH7 Mutation Gly823Glu in Familial Hypertrophic Cardiomyopathy using a Mouse Model

DOI:

10.3791/63949

August 8th, 2022

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Based on the familial hereditary cardiomyopathy family found in our clinical work, we created a C57BL/6N mouse model with a point mutation (G823E) at the mouse MYH7 locus through CRISPR/Cas9-mediated genome engineering to verify this mutation.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Familial hypertrophic cardiomyopathy (HCM, OMIM: 613690) is the most common cardiomyopathy in China. However, the underlying genetic etiology of HCM remains elusive.

We previously identified a myosin heavy chain 7 (MYH7) gene heterozygous variant, NM_000257.4: c.G2468A (p.G823E), in a large Chinese Han family with HCM. In this family, variant G823E cosegregates with an autosomal dominant disorder. This variant is located in the lever arm domain of the neck region of the MYH7 protein and is highly conserved among homologous myosins and species. To verify the pathogenicity of the G823E variant, we produced a C57BL/6N mouse model with a point mutation (G823E) at the mouse MYH7 locus with CRISPR/Cas9-mediated genome engineering. We designed gRNA targeting vectors and donor oligonucleotides (with targeting sequences flanked by 134 bp of homology). The p.G823E (GGG to GAG) site in the donor oligonucleotide was introduced into exon 23 of MYH7 by homology-directed repair. A silenced p.R819 (AGG to CGA) was also inserted to prevent gRNA binding and re-cleavage of the sequence after homology-directed repair. Echocardiography revealed left ventricular posterior wall (LVPW) hypertrophy with systole in MYH7 G823E/- mice at 2 months of age. These results were likewise validated by histological analysis (Figure 3).

These results demonstrate that the G823E variant plays an important role in the pathogenesis of HCM. Our findings enrich the spectrum of MYH7 variants linked to familial HCM and may provide guidance for genetic counseling and prenatal diagnosis in this Chinese family.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Hypertrophic cardiomyopathy (HCM, OMIM: 613690) is the most common cardiomyopathy in China, with an estimated incidence of 0.2%, affecting 150,000 people1,2.

The pathological anatomical feature that characterizes HCM is asymmetric ventricular hypertrophy, which often involves the ventricular outflow tract and/or interventricular septum3. The clinical manifestation is exertional dyspnea, fatigue, and chest pain. The individual phenotype of HCM has variability ranging from clinically insidious to severe heart failure. Patients with HCM require medical treatment, heart transplantation, life support equipment, and multidisciplinary follow-up4.

In the past century, PCR technology has changed the way we study DNA5. A DNA sequencing method for clinical diagnosis was discovered by Sanger and colleagues6. The Sanger technique was subsequently applied to the Human Genome Project, but this approach was costly and time-consuming7. The advent of whole-genome sequencing (WGS) brought insights into human genetic disease to new heights, but it remained prohibitive in terms of cost. Whole-exome sequencing (WES) technology has long been used to detect germline variants8 and has been successful in identifying somatic driver mutations in the exome of various cancers9. The detection of DNA exons or coding regions by WES can be used to reveal pathogenic variants in most Mendelian diseases. Today, with the decreasing cost of sequencing, WGS is expected to become an important tool in genomics research and can be widely used in the detection of pathogenic variants in the genome.

WES technology has also been used in inherited cardiomyopathy to identify pathogenic variants to further elucidate the etiology. Emerging evidence has implicated that genes coding sarcomere structural protein gene mutations, such as MYH710, MYH611, MYBPC312, MYL213, MYL314, TNNT215, TNNI316, TNNC117, and TPM118 are responsible for the genetic etiology of HCM. Awareness of pathogenic variants in rare disease-causing genes (e.g., obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN, OMIM: 608616)19, acting alpha 2 (ACTN2, OMIM: 102573)20, and cysteine and glycine rich protein 3 (CSRP3, OMIM: 600824)21) has also been associated with HCM. Current genetic studies have identified multiple distinct pathogenic variants in the sarcomeric protein gene in approximately 40%-60% of HCM patients, and genetic testing in HCM patients revealed that most pathogenic variants occur in the myosin heavy chain (MYH7) and myosin-binding protein C (MYBPC3). However,the genetic basis for HCM remains elusive. Exploring the pathogenicity of these variations that underlie the human HCM patients remains a major challenge22.

In this study, we report a pathogenic variant in MYH7 in a Chinese Han family with HCM by WES. In order to verify the pathogenicity of this variant, we established a C57BL/6N-Myh7em1(G823E) knockin mice using the CRISPR/Cas9 system. We also discuss plausible mechanisms of this variant.

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The histories of the families were obtained by interviewing the family members. The study was approved by the Ethics Committee of the Guangdong Provincial Hospital of Chinese Medicine (No. 2019074). Informed written consent was obtained from all the family members. All the animals are treated in accordance with the ethical guidelines of the Guangdong Provincial Hospital of Chinese Medicine (Guangzhou, China).

1. Study subjects

NOTE: The proband III-3 sought medical advice in the Department of Cardiovascular Surgery of the Guangdong Provincial Hospital of Chinese Medicine in July 2019.

  1. Obtain detailed family medical history of the proband. Notify and call all the family members of the proband. All the family members have undergone meticulous physical examinations.
    1. Perform a systematic review of all clinical data, including medical records, ECGs, echocardiograms, and cardiac catheterization reports.
    2. Reconfirm cardiac phenotypes in all the patients during intervention or surgery.
  2. Select a total of 174 population-based healthy controls from the local database. Collect approximately 4.0 mL of peripheral venous blood from each patient.

2. DNA extraction

NOTE: DNA is extracted with a commercial blood kit according to the manufacturer's instructions.

  1. Lyse blood cells with an anionic detergent in the presence of a DNA stabilizer following the manufacturer's protocol.
  2. Add 10 µL of RNase A solution to the cell lysate and mix by inverting the tube 25 times. Incubate at 37 °C for 15 min to 1 h.
  3. Remove proteins by salt precipitation. Use protein precipitation solution (0.25 mg of bovine serum albumin dissolved in 25 mL of distilled water) and 100% isopropanol to precipitate proteins. Then, use 200 µL of 70% ethanol and perform centrifugation at 12,000 x g/min at 4 °C for 15 min to wash the DNA pellet.
  4. Recover the genomic DNA by precipitation with 500 µL of 70% ethanol. Centrifuge at 12,000 x g for 30 s. Aspirate and then dissolve the pellet in hydration solution (1 mM EDTA, 10 mM Tris·Cl, pH 7.5).
  5. Use a spectrophotometer (e.g., NanoDrop 2000) to determine purity. Purified DNA typically has an A260/A280 ratio between 1.7 and 1.9 and is up to 200 kb in size.
  6. Store the DNA for a long term at 2-8, -20, or -80 °C.

3. Whole exome sequencing and variant analysis

NOTE: To systematically search for disease-causing gene mutations, exome sequencing in affected individuals (II-5, II-7, III-3, III-7, III-8, III-9, and IV-3) and unaffected individuals (III-2, III-5, IV-4) was performed.

  1. Use exome probe according to the manufacturer's instructions to perform the exome capture.
  2. Apply the qualified libraries to 2 × 150 bp paired-end sequencing on the HiSeq X-ten platform. Please see Supplemental File 1.
  3. Align FASTQ files to the human reference genome (hg19/GRCh37) with BWA v0.7.1318,19. Sort the aligned files (sam/bam format files) with samtools, and then flag duplicates using Picard. Please see Supplemental File 1.
  4. Use GATK, realign reads locally and recalibrate base qualities. Please see Supplemental File 1.
  5. Generate mapping statistics that include coverage and depth from recalibrated files by BEDTools and in-house perl/python scripts.
  6. Genotype variants (SNVs and indels) from recalibrated BAM files using the multi-sample processing mode of the HaplotypeCaller tool from GATK.
  7. Use VQSR (variant quality score recalibration) to reduce false positives of variant calling.
  8. Annotate SNVs and indels using ANNOVAR software21 against multiple databases, including the Exome Aggregation Consortium (ExAC) (http://exac.broadinstitute.org), the Exome Sequencing Project (ESP) (https://esp.gs.washington.edu), and 1,000 G (http://www.1000genomes.org). Interpret the pathogenicity of the sequence variants according to the ACMG guidelines.

4. Sanger sequencing

  1. Perform Sanger sequencing to confirm potential causative variants and determine variant segregation in the family using an ABI 3500 sequencer23.
  2. Design primer sequences for the variant in the MYH7 gene (NM_000257) as follows: 5'-TTCAAACACAGAGACCTGCAGG-3' and 5'- CGGACTTCTCTAGCGCCTCTT -3'.
  3. Confirm a variant, screen all the available family members to determine variant segregation within the family23.

5. Generation of C57BL/6N-MYH7em1(G823E) knockin mice

  1. Use the CRISPR/Cas9 system to generate C57BL/6N-Myh7em1(G823E) knockin mice. The mouse Myh7 gene (GenBank accession number: NM_001361607.1; Ensembl: ENSMUSG00000053093) is located on mouse chromosome 14 and has 41 exons. The ATG start codon in exon 4 and TAG stop codon in exon 41, and the G823E is located on exon 23. Select exon 23 as the target site.
  2. Design the sequence of gRNA targeting vector and donor oligo (with targeting sequence, flanked by 134 bp homologous sequences combined on both sides).
    1. Log in to the NCBI website and click on the BLAST online primer design function on the right.
    2. Click on the Primer-BLAST function at the bottom of the page to design primers.
    3. Paste the MYH7 NCBI reference sequence number NM_000257.4 into the PCR template box.
    4. Amplify the target fragment (MYH7 cDNA exon 23 and its adjacent exons) so design the upstream primer on exon 21 (2392-2528) and the downstream primer on exon 25 (3205-3350). Enter the exon number of the upstream and downstream primers into the right range box.
    5. Click on the Get Primers button at the bottom to automatically generate multiple pairs of primers.
  3. Input the MYH7 gene into ZFIN database, introduce the p.g823e (GGG to GAG) mutation site in the donor oligonucleotide and the silent mutation p.r819 (AGG to CGA) into exon 23. The silent mutation prevents the binding and re-cutting of the sequence by gRNA after homology-directed repair.
    1. Design gRNA according to the general sequence, the sequences at both ends are TAATACGACTCACTATA- and -GTTTTAGAGCTA. The middle of the sequence is the target site mentioned above.
  4. Co-inject Cas9 mRNA, gRNA generated by in vitro transcription and donor oligo into fertilized eggs for KI mouse production.
    1. Use the Cas9/gRNA target efficiency detection kit to transcribe the designed gRNA target into gRNA in vitro and detect the activity of the transcript (see the VK007 kit instructions for specific detection methods) according to manufacturer's protocol.
    2. Thaw the T7 ARCA mRNA kit components, mix, and pulse-spin in a microfuge to collect solutions to the bottoms of the tubes. Assemble the reaction at room temperature in the following order: 2x ARCA/NTP mix to 10 µL, 1 µg of template DNA, 2 µL of T7 RNA polymerase mix, and nuclease-free water to 20 µL.
    3. Mix thoroughly and pulse-spin in a microfuge. Incubate at 37 °C for 30 min.
    4. Remove the template DNA by adding 2 µL of DNase I, mix well, and incubate at 37 °C for 15 min to obtain mRNA.
    5. Perform intraperitoneal injection of serum gonadotropin and human chorionic gonadotropin into pre-prepared C57BL/6 female mice at about 4 weeks old with a 0.5 mL syringe at a dose of approximately 5 U per mouse with an interval between the two injections of 48 h.
    6. Eighteen hours after dosing, sacrifice C57BL/6 female mice and one 8-12-week-old C57BL/6 male mouse by cervical dislocation after hormone injection. Collect the eggs and sperm separately.
    7. The sperm is capacitated in the capacitation fluid. Take and drop the sperm at the edge of the fluid into the short-lived egg cells for in vitro fertilization for 3-4 h.
    8. Dilute the successfully transcribed gRNA and Cas9 mRNA in vitro with RNase-free water to 25 ng/µL and 50 ng/µL. Introduce into the cytoplasm of mouse fertilized eggs by microinjection. Transplant fertilized eggs in good condition into the enlarged oviduct of the female mice. Co-cage with ligated male mice.
  5. Genotype the pups by PCR. Use the following PCR conditions: 94 °C for 3 min, 35 cycles of 94 °C for 30 s, 60 °C for 35 s, and 72 °C for 35 s; 72 °C for 5 min. Follow with sequence analysis.
    1. Cut the tails of 4-month-old mice with scissors and place them into 1.5 mL EP tube. Add 180 µL of Buffer GL, 20 µL of Proteinase K, and 10 µL of RNase A per tail piece (2-5 mm) in a microcentrifuge tube. Be careful not to cut too much tail.
    2. Incubate the tube at 56 °C overnight.
    3. Spin in a microcentrifuge tube at 1,000 x g for 2 min to remove impurities.
    4. Add 200 µL of Buffer GB and 200 µL of absolute ethyl alcohol with sufficient mixing.
    5. Place the spin column in a collection tube. Apply the sample to the spin and centrifuge at 1,000 x g for 2 min. Discard the flow-through.
    6. Add 500 µL of Buffer WA to the spin column and centrifuge at 1,000 x g for 1 min. Discard the flow-through.
    7. Add 700 µL of Buffer WB to the spin column and centrifuge at 1,000 x g for 1 min. Discard the flow-through.
      NOTE: Make sure the Buffer WB has been premixed with 100% ethanol. When adding Buffer WB, add to the tube wall to wash off the residual salt.
    8. Repeat step 5.5.7.
    9. Place the spin column in a collection tube and centrifuge at 1,000 x g for 2 min.
    10. Place the spin column in a new 1.5 mL tube. Add 50-200 µL of sterilized water or elution buffer to the center of the column membrane and let the column stand for 5 min.
      NOTE: Heating sterilized water or elution buffer up to 65 °C can increase the yield of elution.
    11. To elute DNA, centrifuge the column at 1,000 x g for 2 min. To increase the yield of DNA, add the flow-through and/or 50-200 µL of sterilized water or elution buffer to the center of the spin column membrane and let the column stand for 5 min. Centrifuge at 1,000 x g for 2 min.
    12. Quantify the eluted genomic DNA by electrophoresis.

6. Evaluation of the cardiac morphology and function

NOTE: Apply M-mode echocardiography to assess heart morphology and function of C57BL/6N-Myh7em1(G823E) knockin mice.

  1. Put the knockin mice into a closed acrylic box connected to the anesthesia machine and adjust the three-way interface to allow isoflurane (concentration: 3%) to flow into the acrylic box. After the knockin mice cease to move autonomously, remove the knockin mice.
  2. Place the knockin mice flat on the life monitoring platform of the small animal anesthesia machine, and continuous inhalation anesthesia mixed with oxygen (flow: 0.8 L/min) and isoflurane (concentration: 3%). Apply eye lubricant to the anesthetized mice to prevent drying of the cornea.
  3. Fix the knockin mice horizontally on the platform. Tilt the platform 30° caudal to the knockin mouse. Remove hair on the anterior chest wall of the knocking mouse using a depilatory cream.
  4. Position the probe vertically with the bump facing the animal's head. Then, rotate the probe counterclockwise, approximately 45°.
  5. In the parasternal long-axis view, rotate the probe 90° clockwise to observe the parasternal short-axis view. After rotating the probe 90°, adjust the y-axis displacement to get the correct slice.
  6. Observe the long-axis image of the heart (Figure 1C), and then select M-mode measurement data.
  7. Acquire ultrasound data from parasternal long-axis views of mice (Figure 1). Heart rate (HR), left ventricular ejection fraction (LVEF), cardiac output (CO), Left ventricular end-diastolic dimension (LVDd), LVDs left ventricular end-systolic dimension (LVSd), interventricular septum (IVS), and left ventricular posterior wall (LVPW) are measured.
  8. After the measurement, provide the mice with oxygen, and place them back into their respective cages when they regain autonomous activity.

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Clinical profile of the families
The family pedigrees of HCM were obtained and are shown in Figure 2. All the documented family members were diagnosed with HCM at enrollment.

In the family (Figure 2A), the proband was patient III-7, who was diagnosed with HCM and left ventricular outflow tract obstruction (LVOTO) at 46 years old and underwent cardiac surgery. Patient III-3 had minor HCM that did not require surgical treatment. Pat...

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

In this study, we describe one Chinese Han families with HCM. Genetics analysis revealed that a heterozygous MYH6 mutation p.G823E co-segregates with the disease in family members with autosomal dominant inheritance. To validate the pathogenicity of G823E mutation and discuss the underlying mechanisms, we created a C57BL/6N mouse model with G823E at mouse Myh7 locus by CRISPR/Cas9-mediated genome engineering.

Phenotypic characteristics of C57BL/6N-Myh7em1(G823E) knockin mice were ev...

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors have no financial conflicts of interest to declare.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This work was supported by the Medical Research Fund project of Guangdong Province (A2022363) and the major project of the Guangdong Committee of Science and Technology, China (grant no.2022).

We would like to thank Qingjian Chen of the University of Maryland, College Park for the help during the preparation of this manuscript.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
0.5×TBEShanghai Sangon
2× Taq Master Mix (Dye Plus)Nanjing Novizan Biotechnology Co., Ltd.
AgaroseRegu
Anesthesia machine for small animalsReward Life Technology Co., Ltd.R500
BEDTools2.16.1
Cas9 in vitro digestion method to detect gRNA target efficiency kitViewsolid Biotechnology Co., Ltd.VK007
DNA MarkerThermo Fisher Scientific
DNA stabilizerShanghai Seebio Biotechnology Co., Ltd.DNAstable LDprevent DNA degradation
Electric paraffin microtomeShenyang Hengsong Technology Co., Ltd.HS-S7220-B
GATKv3.5
Gentra Puregene blood kitSanta Clara
Glass slide, coverslipJiangsu Invotech Biotechnology Co., Ltd.
Hematoxylin staining solution, Eosin staining solutionShanghai Biyuntian Biotechnology Co., Ltd.C0107-500ml, C0109
HiSeq X-ten platformIlluminaperform sequencing on the captured libraries
Injection of chorionic gonadotropinLivzon Pharmaceutical Group Inc.
Injection of pregnant mare serum gonadotropinLivzon Pharmaceutical Group Inc.
IsofluraneLocal suppliersinhalation anesthesia
Microinjection microscopeNikonECLIPSE Ts2
NanoDropThermo Fisher Scientific2000
Paraffin Embedding MachineShenyang Hengsong Technology Co., Ltd.HS-B7126-B
Picard(2.2.4) 20
Proteinase KMerck KGaA
samtools1.3
SequencerApplied BiosystemsABI 3500
StereomicroscopeNikonSMZ745T
SureSelect Human All Exon V6Agilent Technology Co., Ltd.exome probe
T7 ARCA mRNA KitNew England BioLabs, Inc.NEB-E2065S
Temperature boxBINDER GmbHKBF-S Solid.Line
Trizma Hydrochloride SolutionSigma, Merck KGaANo. T2663
Veterinary ultrasound systemRoyal PhilipsCX50

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Toepfer, C. N., et al. Myosin sequestration regulates sarcomere function, cardiomyocyte energetics, and metabolism, informing the pathogenesis of hypertrophic cardiomyopathy. Circulation. 141 (10), 828-842 (2020).
  2. Writing Committee Members et al. 2020 AHA/ACC guideline for the diagnosis and treatment of patients with hypertrophic cardiomyopathy: A report of the American College of Cardiology/American Heart Association Joint Committee on Clinical Practice Guidelines. The Journal of Thoracic and Cardiovascular Surgery. 162 (1), 23-106 (2021).
  3. Elliott, P., McKenna, W. J. Hypertrophic cardiomyopathy. Lancet. 363 (9424), 1881-1891 (2004).
  4. Maron, B. J., Maron, M. S. Hypertrophic cardiomyopathy. Lancet. 381 (9862), 242-255 (2013).
  5. Inoue, T., Orgel, L. E. A nonenzymatic RNA polymerase model. Science. 219 (4586), 859-862 (1983).
  6. Sanger, F., Nicklen, S., Coulson, A. R. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America. 74 (12), 5463-5467 (1977).
  7. Sachidanandam, R., et al. A map of human genome sequence variation containing 1.42 million single nucleotide polymorphisms. Nature. 409 (6822), 928-933 (2001).
  8. Ng, S. B., et al. Targeted capture and massively parallel sequencing of 12 human exomes. Nature. 461 (7261), 272-276 (2009).
  9. Wong, K. M., Hudson, T. J., McPherson, J. D. Unraveling the genetics of cancer: genome sequencing and beyond. Annual Review of Genomics and Human Genetics. 12, 407-430 (2011).
  10. Mattivi, C. L., et al. Clinical utility of a phenotype-enhanced MYH7-specific variant classification framework in hypertrophic cardiomyopathy genetic testing. Circulation. Genomic and Precision Medicine. 13 (5), 453-459 (2020).
  11. Jiang, J., Wakimoto, H., Seidman, J. G., Seidman, C. E. Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy. Science. 342 (6154), New York, N.Y. 111-114 (2013).
  12. Hayashi, T., et al. Genetic background of Japanese patients with pediatric hypertrophic and restrictive cardiomyopathy. Journal of Human Genetics. 63 (9), 989-996 (2018).
  13. Gil, W. S., Ávila Vidal, L. A., Vásquez Salguero, M. A., Cajiao, M. B., Peña, C. V. Genetic variant affecting the myosin light chain 2 related to familial hypertrophic cardiomyopathy. Intractable & Rare Diseases Research. 9 (4), 229-232 (2020).
  14. Berge, K. E., Leren, T. P. Genetics of hypertrophic cardiomyopathy in Norway. Clinical Genetics. 86 (4), 355-360 (2014).
  15. McNamara, J. W., Schuckman, M., Becker, R. C., Sadayappan, S. A novel homozygous intronic variant in TNNT2 associates with feline cardiomyopathy. Frontiers in Physiology. 11, 608473(2020).
  16. Wang, W., et al. Comparative transcriptome analysis of atrial septal defect identifies dysregulated genes during heart septum morphogenesis. Gene. 575, 303-312 (2016).
  17. Andersen, P. S., et al. Diagnostic yield, interpretation, and clinical utility of mutation screening of sarcomere encoding genes in Danish hypertrophic cardiomyopathy patients and relatives. Human Mutations. 30 (3), 363-370 (2009).
  18. Nakashima, Y., et al. Lifelong clinical impact of the presence of sarcomere gene mutation in Japanese patients with hypertrophic cardiomyopathy. Circulation Journal. 84 (10), 1846-1853 (2020).
  19. Hu, L. R., Kontrogianni-Konstantopoulos, A. Proteomic analysis of myocardia containing the Obscurin R4344Q mutation linked to hypertrophic cardiomyopathy. Frontiers in Physiology. 11, 478(2020).
  20. Girolami, F., et al. Novel alpha-actinin 2 variant associated with familial hypertrophic cardiomyopathy and juvenile atrial arrhythmias: a massively parallel sequencing study. Circulation. Cardiovascular Genetics. 7 (6), 741-750 (2014).
  21. Salazar-Mendiguchia, J., et al. The p.(Cys150Tyr) variant in CSRP3 is associated with late-onset hypertrophic cardiomyopathy in heterozygous individuals. European Journal of Medical Genetics. 63 (12), 104079(2020).
  22. Teekakirikul, P., Zhu, W., Huang, H. C., Fung, E. Hypertrophic cardiomyopathy: An overview of genetics and management. Biomolecules. 9 (12), 878(2019).
  23. Crossley, B. M., et al. Guidelines for Sanger sequencing and molecular assay monitoring. Journal of Veterinary Diagnostic Investigation. 32 (6), 767-775 (2020).
  24. Song, L., et al. Mutations profile in Chinese patients with hypertrophic cardiomyopathy. Clinica Chimica Acta. 351 (1-2), 209-216 (2005).
  25. Marian, A. J., Braunwald, E. Hypertrophic cardiomyopathy: Genetics, pathogenesis, clinical manifestations, diagnosis, and therapy. Circulation Research. 121 (7), 749-770 (2017).
  26. Cann, F., et al. Phenotype-driven molecular autopsy for sudden cardiac death. Clinical Genetics. 91 (1), 22-29 (2017).
  27. Lafreniere-Roula, M., et al. Family screening for hypertrophic cardiomyopathy: Is it time to change practice guidelines. European Heart Journal. 40 (45), 3672-3681 (2019).
  28. Winkelmann, D. A., Forgacs, E., Miller, M. T., Stock, A. M. Structural basis for drug-induced allosteric changes to human beta-cardiac myosin motor activity. Nature Communications. 6, 7974(2015).
  29. García-Giustiniani, D., et al. Phenotype and prognostic correlations of the converter region mutations affecting the β myosin heavy chain. Heart (British Cardiac Society). 101 (13), 1047-1053 (2015).
  30. Moore, J. R., Leinwand, L., Warshaw, D. M. Understanding cardiomyopathy phenotypes based on the functional impact of mutations in the myosin motor. Circulation Research. 111 (3), 375-385 (2012).
  31. Majewski, J., Schwartzentruber, J., Lalonde, E., Montpetit, A., Jabado, N. What can exome sequencing do for you. Journal of Medical Genetics. 48 (9), 580-589 (2011).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

MYH7 MutationFamilial Hypertrophic CardiomyopathyMouse ModelCRISPR Genome EditingEchocardiographyCardiac HypertrophySanger SequencingLeft Ventricular HypertrophyPathogenic VariantHistological Analysis

Related Articles