Here, a protocol to perform and analyze the binding, mobility, and assembly of single molecules on artificial crowded lipid membranes using single-molecule total internal reflection fluorescence (smTIRF) microscopy is presented.
Method Article
Here, a protocol to perform and analyze the binding, mobility, and assembly of single molecules on artificial crowded lipid membranes using single-molecule total internal reflection fluorescence (smTIRF) microscopy is presented.
Cellular membranes are highly crowded environments for biomolecular reactions and signaling. Yet, most in vitro experiments probing protein interaction with lipids employ naked bilayer membranes. Such systems lack the complexities of crowding by membrane-embedded proteins and glycans and exclude the associated volume effects encountered on cellular membrane surfaces. Also, the negatively charged glass surface onto which the lipid bilayers are formed prevents the free diffusion of transmembrane biomolecules. Here, we present a well-characterized polymer-lipid membrane as a mimic for crowded lipid membranes. This protocol utilizes polyethylene glycol (PEG)-conjugated lipids as a generalized approach for incorporating crowders into the supported lipid bilayer (SLB). First, a cleaning procedure of the microscopic slides and coverslips for performing single-molecule experiments is presented. Next, methods for characterizing the PEG-SLBs and performing single-molecule experiments of the binding, diffusion, and assembly of biomolecules using single-molecule tracking and photobleaching are discussed. Finally, this protocol demonstrates how to monitor the nanopore assembly of bacterial pore-forming toxin Cytolysin A (ClyA) on crowded lipid membranes with single-molecule photobleaching analysis. MATLAB codes with example datasets are also included to perform some of the common analyses such as particle tracking, extracting diffusive behavior, and subunit counting.
Cellular membranes are highly crowded and complex systems1. Molecular crowding can have a considerable impact on the diffusion of membrane-bound entities like protein and lipids2,3,4. Similarly, bimolecular reactions on lipid membranes like receptor dimerization or the oligomerization of membrane complexes are influenced by crowding5,6,7. The nature, configuration, and concentration of crowders can govern the membrane binding, diffusivity, and protein-protein interaction in several ways8,9. Since controlling membrane crowding on cellular membranes and interpreting its influence on embedded biomolecules is challenging, researchers have tried to establish alternate in vitro systems10.
A popular approach for artificial crowded membranes is doping the bilayer membranes with polymer (such as polyethylene glycol, PEG)-grafted lipids11,12. During the visualization of protein and lipid dynamics on supported lipid bilayers (SLBs), these polymers additionally shield the membrane-embedded components from the underlying negatively charged substrate (such as glass) by effectively lifting the bilayer away from the underlying support. By varying the size and concentration of the polymer, one can control the extent of molecular crowding, as well as its separation from the underlying solid support13,14. This is clearly an advantage over lipid bilayers supported on solid substrates without polymer cushions15,16, where transmembrane biomolecules can lose their activity17,18,19. More importantly, it allows us to recapitulate the crowded environment of the cell membrane in vitro, which is critical for many membrane processes.
Surface-grafted polymers on membranes also undergo changes in their configuration depending on their grafting density12. At low concentrations, they remain in an entropically coiled configuration, known as a mushroom, above the membrane surface. With increasing concentration, they start to interact and tend to uncoil and extend, finally yielding a dense brush-like formation on the membrane21. Since the transition from the mushroom to the brush regime is highly heterogeneous and manifests in poorly characterized conditions of the polymer, it is important to use well-characterized conditions for crowding on polymer-grafted membranes. Compared to a recent study20, we identify and report crowded membrane compositions that maintain the diffusive transport and activity of transmembrane biomolecules.
In this protocol, we discuss how to generate PEGylated lipid membranes and provide recommendations for PEG densities that mimic crowding in two different regimes of polymer configuration (namely, mushroom and brush). The protocol also describes single-molecule binding, particle tracking, and photobleaching data acquisition and analysis for molecules embedded in these crowded membranes. First, we describe the thorough cleaning steps, the assembly of the imaging chamber, and the generation of PEG-SLBs. Second, we provide details for the single-molecule binding, particle tracking, and photobleaching experiments. Third, we discuss i) extracting the relative binding affinities, ii) characterizing molecular diffusion, and iii) counting subunits in a protein assembly from movies of single molecules on the membrane.
While we characterized this system with single-molecule imaging, the protocol is useful for all membrane biophysicists interested in understanding the effect of crowding on biomolecular reactions on lipid membranes. Overall, we present a robust pipeline for making crowded and supported lipid bilayers, along with various single-molecule assays conducted on them and the corresponding analysis routines.
Access restricted. Please log in or start a trial to view this content.
1. Cleaning of the slide and coverslip for single-molecule experiments
2. Assembly of the microfluidic chamber
NOTE: The imaging chamber is created by sandwiching double-sided tape between a pre-cleaned coverslip and slide from the previous step as described below.
3. Making supported bilayers on glass substrate by vesicle fusion
NOTE: Crowded supported lipid bilayers are generated on the walls of the imaging chamber by the fusion of lipid vesicles prepared with doped PEG-lipids.
4. Microscope setup and single-particle imaging measurements
NOTE: Single-molecule experiments are carried out on an objective-based total internal reflection fluorescence24,25,26 (TIRF) microscope setup (Figure 2). TIRF imaging provides a better signal-to-noise ratio for single-molecule imaging, though epi-fluorescence microscopes can also be used under certain conditions (especially when the fluorescent biomolecules can be removed from the bulk solution by washing). The prism-type TIRF can be used but the objective-type is preferable for the ease of setting up microfluidics27. For objective-type TIRF, a high numerical aperture objective (100x magnification, usually commercially available as a TIRF objective) is recommended.
5. Image acquisition for counting subunits in a protein assembly
NOTE: Image acquisition for estimating stoichiometry requires continuous bleaching of fluorophores and detecting the number of steps until no more fluorophores are emitting fluorescence.
6. Image and data analysis

= labeling efficiency, n = number of photobleaching steps, and s = actual counts. Use the MATLAB routine Stepcount_immobile to recover the corrected oligomeric species. Convert the frequency of oligomers (si) to mass fractions (Figure 7C; Supplementary Coding File 2).Access restricted. Please log in or start a trial to view this content.
Monitoring the binding of ClyA protein on PEGylated membranes
After step 4.5, the binding kinetics are estimated by plotting the number of particles binding to the membrane surface over time (Video 1). As ClyA protein binds to a membrane with 5 mol% PEG2000 lipids,the particle density increases and reaches saturation (Figure 5). An exponential decay fit to the bound particles (cyan circles) gives the time constant (τb) for the membrane binding...
Access restricted. Please log in or start a trial to view this content.
Here, we demonstrate single-molecule experiments on supported lipid bilayers (SLBs) that manifest a crowded environment for membrane-embedded biomolecules. The crowded environment generates an excluded volume effect, leading to the enhancement of biomolecular reactions1,2,39,40. For the PEG-lipid system, where the polymer primarily occupies the volume outside the bilayer, this effect is especia...
Access restricted. Please log in or start a trial to view this content.
The authors have nothing to disclose.
The authors acknowledge Prof. Benjamin Schuler for sharing the expression plasmid for ClyA protein. This work was supported by Human Frontier Science Program (RGP0047-2020).
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 2.5 ml Syringes | HMD Healthcare | Dispo Van, 2.5 ml Tuberculin | Plastic syringe |
| Acetone | Finar Chemicals | 10020LL025 | |
| Acrylic Sheet | 2 mm thick | ||
| Acrylic Sheet | BigiMall | 2 mm, Clear | |
| Bath Sonicator | Branson | CPX-1800 | |
| Calcium Chloride | |||
| Chloroform | Sigma | 528730 | HPLC grade |
| Cholesterol | Avanti | 700100 | |
| Coplin Jar | Duran Wheaton Kimble | S6016 | 8 Slide Jar with Glass Cover |
| Coverslips | VWR | 631-1574 | 24 mm X 50 mm |
| Cy3-DNA Strand | IDT | GCTGCTATTGCGTCCGTTTGGTT GGTGTGGTTGG-Cy3 | |
| Cyanine Dye (Cy3) | Cytiva Life Sciences | PA23001 | |
| DiI | Invitrogen | D3911 | Dil Stain (1,1'-Dioctadecyl-3,3,3',3'-Tetramethylindocarbocyanine Perchlorate ('DiI'; DiIC18(3))) |
| DNA Connector Strand 1 | Sigma Aldrich | GCTGCTATTGCGTCCGTTTAGCT GGGGGAGTATTGCGGAGGAAGC T | |
| DNA Connector Strand 2 | Sigma Aldrich | CGGACGCAATAGCAGCTCACAG TCGGTCACAT | |
| DNA Tocopherol Strand | Biomers | Toco-CCCAATGTGACCGACTGTGA | |
| DOPE-PEG2000 | Avanti | 880130 | 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (ammonium salt) |
| Double Sided Tape | 3M | LF93010LE | |
| Drill Bits (Diamond Coated) | 0.5 - 1 mm | ||
| Drilling Machine | Dremel | 220 | Workstation |
| EMCCD | Andor | DU-897U-CS0-#BV | |
| Fluorescence Beads | Invitrogen | F10720 | |
| Glass Slides | Blue Star | Micro Slides, PIC-1 | |
| Glass Vials | Sigma | 854190 | |
| Hydrogen Peroxide | Lobachemie | 00182 | 30% Solution, AR Grade |
| Labolene | Thermo-Fischer Scientific | Detergent | |
| Laser 532 nm | Coherent | Sapphire | |
| Laser Cutter | Universal Laser Systems | ILS12.75 | |
| Lissamine Rhodamine DOPE | Avanti | 810150 | 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(lissamine rhodamine B sulfonyl) (ammonium salt) |
| Methanol | Finar Chemicals | 30932LL025 | |
| Microscope | Olympus | IX81 | |
| Phosphate Buffer Saline (PBS) | 1X | ||
| Plasma Cleaner | Harrick Plasma Inc | PDC-002 | |
| POPC | Avanti | 850457 | 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine |
| Programmable Syringe Pump | New Era Pump Systems | NE1010 | High Pressure Syringe Pump |
| PTFE Caps | Sigma | 27141 | |
| PTFE Tubing | Cole-Parmer | WW-06417-21 | Masterflex, 0.022" ID x 0.042" OD |
| Sulphuric Acid | SD Fine Chemicals | 98%, AR Grade | |
| TIRF Objective | Olympus | UPLAPO100XOHR | |
| Vacuum Desiccator | Tarsons | ||
| Vortex Mixer | Tarsons |
Access restricted. Please log in or start a trial to view this content.
Request permission to reuse the text or figures of this JoVE article
Request Permission