Single-Molecule Diffusion and Assembly on Polymer-Crowded Lipid Membranes

Summary

Here, a protocol to perform and analyze the binding, mobility, and assembly of single molecules on artificial crowded lipid membranes using single-molecule total internal reflection fluorescence (smTIRF) microscopy is presented.

Abstract

Cellular membranes are highly crowded environments for biomolecular reactions and signaling. Yet, most in vitro experiments probing protein interaction with lipids employ naked bilayer membranes. Such systems lack the complexities of crowding by membrane-embedded proteins and glycans and exclude the associated volume effects encountered on cellular membrane surfaces. Also, the negatively charged glass surface onto which the lipid bilayers are formed prevents the free diffusion of transmembrane biomolecules. Here, we present a well-characterized polymer-lipid membrane as a mimic for crowded lipid membranes. This protocol utilizes polyethylene glycol (PEG)-conjugated lipids as a generalized approach for incorporating crowders into the supported lipid bilayer (SLB). First, a cleaning procedure of the microscopic slides and coverslips for performing single-molecule experiments is presented. Next, methods for characterizing the PEG-SLBs and performing single-molecule experiments of the binding, diffusion, and assembly of biomolecules using single-molecule tracking and photobleaching are discussed. Finally, this protocol demonstrates how to monitor the nanopore assembly of bacterial pore-forming toxin Cytolysin A (ClyA) on crowded lipid membranes with single-molecule photobleaching analysis. MATLAB codes with example datasets are also included to perform some of the common analyses such as particle tracking, extracting diffusive behavior, and subunit counting.

Introduction

Cellular membranes are highly crowded and complex systems¹. Molecular crowding can have a considerable impact on the diffusion of membrane-bound entities like protein and lipids^2,3,4. Similarly, bimolecular reactions on lipid membranes like receptor dimerization or the oligomerization of membrane complexes are influenced by crowding^5,6,7. The nature, configuration, and concentration of crowders can govern the membrane binding, diffusivity, and protein-protein ....

Protocol

1. Cleaning of the slide and coverslip for single-molecule experiments

1. Before the assembly of the imaging chamber, clean and prepare both the coverslips and slides. Drill multiple pairs of holes on the glass slides using a drilling machine with diamond-coated drill bits (0.5-1 mm in diameter). If acrylic sheets are used, use a laser cutter to make precise holes (0.5 mm), as shown in Figure 1.
   NOTE: Each pair of holes will act as an inlet and outlet for flow exchange for an individual microfluidic chamber. A representative CAD file for holes in an acrylic slide is available in Supplementary Coding ....

Results

Monitoring the binding of ClyA protein on PEGylated membranes
After step 4.5, the binding kinetics are estimated by plotting the number of particles binding to the membrane surface over time (Video 1). As ClyA protein binds to a membrane with 5 mol% PEG2000 lipids,the particle density increases and reaches saturation (Figure 5). An exponential decay fit to the bound particles (cyan circles) gives the time constant (τ_b) for the membrane binding.......

Discussion

Here, we demonstrate single-molecule experiments on supported lipid bilayers (SLBs) that manifest a crowded environment for membrane-embedded biomolecules. The crowded environment generates an excluded volume effect, leading to the enhancement of biomolecular reactions^1,2,39,40. For the PEG-lipid system, where the polymer primarily occupies the volume outside the bilayer, this effect is especia.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
2.5 ml Syringes	HMD Healthcare	Dispo Van, 2.5 ml Tuberculin	Plastic syringe
Acetone	Finar Chemicals	10020LL025
Acrylic Sheet			2 mm thick
Acrylic Sheet	BigiMall		2 mm, Clear
Bath Sonicator	Branson	CPX-1800
Calcium Chloride
Chloroform	Sigma	528730	HPLC grade
Cholesterol	Avanti	700100
Coplin Jar	Duran Wheaton Kimble	S6016	8 Slide Jar with Glass Cover
Coverslips	VWR	631-1574	24 mm X 50 mm
Cy3-DNA Strand	IDT		GCTGCTATTGCGTCCGTTTGGTT GGTGTGGTTGG-Cy3
Cyanine Dye (Cy3)	Cytiva Life Sciences	PA23001
DiI	Invitrogen	D3911	Dil Stain (1,1'-Dioctadecyl-3,3,3',3'-Tetramethylindocarbocyanine Perchlorate ('DiI'; DiIC18(3)))
DNA Connector Strand 1	Sigma Aldrich		GCTGCTATTGCGTCCGTTTAGCT GGGGGAGTATTGCGGAGGAAGC T
DNA Connector Strand 2	Sigma Aldrich		CGGACGCAATAGCAGCTCACAG TCGGTCACAT
DNA Tocopherol Strand	Biomers		Toco-CCCAATGTGACCGACTGTGA
DOPE-PEG2000	Avanti	880130	1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (ammonium salt)
Double Sided Tape	3M	LF93010LE
Drill Bits (Diamond Coated)			0.5 - 1 mm
Drilling Machine	Dremel	220	Workstation
EMCCD	Andor	DU-897U-CS0-#BV
Fluorescence Beads	Invitrogen	F10720
Glass Slides	Blue Star		Micro Slides, PIC-1
Glass Vials	Sigma	854190
Hydrogen Peroxide	Lobachemie	00182	30% Solution, AR Grade
Labolene	Thermo-Fischer Scientific		Detergent
Laser 532 nm	Coherent	Sapphire
Laser Cutter	Universal Laser Systems	ILS12.75
Lissamine Rhodamine DOPE	Avanti	810150	1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(lissamine rhodamine B sulfonyl) (ammonium salt)
Methanol	Finar Chemicals	30932LL025
Microscope	Olympus	IX81
Phosphate Buffer Saline (PBS)			1X
Plasma Cleaner	Harrick Plasma Inc	PDC-002
POPC	Avanti	850457	1-palmitoyl-2-oleoyl-glycero-3-phosphocholine
Programmable Syringe Pump	New Era Pump Systems	NE1010	High Pressure Syringe Pump
PTFE Caps	Sigma	27141
PTFE Tubing	Cole-Parmer	WW-06417-21	Masterflex, 0.022" ID x 0.042" OD
Sulphuric Acid	SD Fine Chemicals		98%, AR Grade
TIRF Objective	Olympus	UPLAPO100XOHR
Vacuum Desiccator	Tarsons
Vortex Mixer	Tarsons