Name: In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice (Video) | JoVE Journal
Uploaded: 2014-03-22T14:00:00.000+00:00
Duration: 5 min 24 s
Description: Learn rapid intrathecal siRNA transfection for gene knockdown in mouse lumbar spinal cord using noninvasive needle puncture. This technique enables efficient localized gene silencing with minimal tissue damage.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

All animal usage procedures were in accordance with ethical guidelines laid down by the local governing body (Regierungspr&#228;sidium Karlsruhe, Karlsruhe, Germany).
1. Preparation of siRNA/PEI Complex
 
The siRNA/PEI complex solution is prepared using manufacturer&#39;s directions as follows:
<ol>
	<li>Solution A: Dilute the desired amount of siRNA with sterile water (if necessary) up to a quarter of the end volume and dilute this further with 10% glucose solution up to half of end volume. Vortex gently or mix by pipetting up and down. The optimal amount of siRNA needs to be determined empirically but 1 &#181;g siRNA in 10 &#181;l complex solution per animal is a good starting point for optimization.</li>
	<li>Solution B: Dilute the needed volume of PEI reagent with sterile water up to a quarter of the end volume and dilute this further with 10% glucose solution up to half of the end volume. Vortex gently or mix by pipetting up and down. 
	Note: the amount of PEI reagent determines the ionic balance in the complex which influences the efficiency of the transfection. Likewise the optimal amount of PEI solution has to be determined empirically. In our hands, the optimal amount is 0.12 &#956;l of PEI solution per 1 &#956;g siRNA.</li>
	<li>Mix solution A with solution B all at once, vortex gently.</li>
	<li>Incubate the mixed solution for 15 min at RT before use. This complex is stable for 2 hr at RT and for 24 hr at 4 &#176;C.</li>
</ol>
2. Intrathecal Injection
<ol>
	<li>Anesthetize the mouse with 3% isoflurane, until it shows no signs of righting reflex.&#160;In addition, check for tail and/or paw pinch reflex to further ensure the state of anesthesia. &#160;</li>
	<li>Shave around 2 cm2 of fur at the posterior end of the animal near the base of the tail to facilitate a better visualization during needle insertion.</li>
	<li>Place mouse in a nose cone for a continued isoflurane administration during the procedure, reduce the isoflurane to 1.5%, and cover the eyes of the mouse with eye lubricant.</li>
	<li>Prepare the ready to use siRNA mixed solution using a 25 &#181;l Hamilton syringe attached to a 30 G 0.5 in needle.</li>
	<li>Locate the spinous process of the L6, which should be the most prominent one and fix the vertebrate column around this area by pressing it gently.</li>
	<li>Carefully insert the needle between the groove of L5 and L6 vertebrae and observe for a tail flick as this sign indicates a successful entry of the needle in the intradural space. 
	Tip: Using fingernail, one should be able to locate the groove as well.</li>
	<li>Once tail flick is observed, immediately, but carefully, secure the needle position with one hand and inject the desired volume of substance with the other hand slowly. 
	Tip: a volume between 5-10 &#181;l is optimal as volume less than 5 &#181;l is unreliable and a volume bigger than 10 &#181;l leads to too much pressure.</li>
	<li>Once injection is performed, move the mouse back to the cage to recover from anesthesia.</li>
	<li>Repeat this injection at least 2 more times every 24 hr to achieve optimal downregulation of the targeted gene.</li>
</ol>

<ol><li>Hylden, J. L., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Intrathecal+morphine+in+mice%3A+a+new+technique%5BTitle%5D)+AND+%22Eur.+J.+Pharmacol%22%5BJournal%5D)">Intrathecal morphine in mice: a new technique.</a> Eur. J. Pharmacol. 67, 313-316 (1980).</li>
<li>Stokes, J. A., Corr, M., Yaksh, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Transient+tactile+allodynia+following+intrathecal+puncture+in+mouse%3A+contributions+of+Toll-like+receptor+signaling%5BTitle%5D)+AND+%22Neurosci.+Lett%22%5BJournal%5D)">Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling.</a> Neurosci. Lett. 504, 215-218 (2011).</li>
<li>Goula, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Polyethylenimine-based+intravenous+delivery+of+transgenes+to+mouse+lung%5BTitle%5D)+AND+%22Gene+Ther%22%5BJournal%5D)">Polyethylenimine-based intravenous delivery of transgenes to mouse lung.</a> Gene Ther. , 1291-1295 (1998).</li>
<li>Fairbanks, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Spinal+delivery+of+analgesics+in+experimental+models+of+pain+and+analgesia%5BTitle%5D)+AND+%22Adv.+Drug.+Deliv.+Rev%22%5BJournal%5D)">Spinal delivery of analgesics in experimental models of pain and analgesia.</a> Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).</li>
<li>Hohmann, A. G., Tsou, K., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cannabinoid+modulation+of+wide+dynamic+range+neurons+in+the+lumbar+dorsal+horn+of+the+rat+by+spinally+administered+WIN55%2C212-2%5BTitle%5D)+AND+%22Neurosci.+Lett%22%5BJournal%5D)">Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2.</a> Neurosci. Lett. 257, 119-122 (1998).</li>
<li>Song, Z. H., Takemori, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Involvement+of+spinal+kappa+opioid+receptors+in+the+antinociception+produced+by+intrathecally+administered+corticotropin-releasing+factor+in+mice%5BTitle%5D)+AND+%22J.+Pharmacol.+Exp.+Ther%22%5BJournal%5D)">Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice.</a> J. Pharmacol. Exp. Ther. 254, 363-368 (1990).</li>
<li>Trang, T., Sutak, M., Jhamandas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Involvement+of+cannabinoid+%28CB1%29-receptors+in+the+development+and+maintenance+of+opioid+tolerance%5BTitle%5D)+AND+%22Neuroscience%22%5BJournal%5D)">Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance.</a> Neuroscience. , 1275-1288 (2007).</li>
<li>Yaksh, T. L., Rudy, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Chronic+catheterization+of+the+spinal+subarachnoid+space%5BTitle%5D)+AND+%22Physiol.+Behav%22%5BJournal%5D)">Chronic catheterization of the spinal subarachnoid space.</a> Physiol. Behav. 17, 1031-1036 (1976).</li>
<li>Tappe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Synaptic+scaffolding+protein+Homer1a+protects+against+chronic+inflammatory+pain%5BTitle%5D)+AND+%22Nat.+Med%22%5BJournal%5D)">Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain.</a> Nat. Med. , 677-681 (2006).</li>
<li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Silencing+of+the+Cav3.2+T-type+calcium+channel+gene+in+sensory+neurons+demonstrates+its+major+role+in+nociception%5BTitle%5D)+AND+%22EMBO+J%22%5BJournal%5D)">Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception.</a> EMBO J. 24, 315-324 (2005).</li>
<li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Gene+transfer+to+dorsal+root+ganglia+by+intrathecal+injection%3A+effects+on+regeneration+of+peripheral+nerves%5BTitle%5D)+AND+%22Mol.+Ther%22%5BJournal%5D)">Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves.</a> Mol. Ther. 12, 314-320 (2005).</li>
<li>Wigdor, S., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Central+and+systemic+morphine-induced+antinociception+in+mice%3A+contribution+of+descending+serotonergic+and+noradrenergic+pathways%5BTitle%5D)+AND+%22J.+Pharmacol.+Exp.+Ther%22%5BJournal%5D)">Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways.</a> J. Pharmacol. Exp. Ther. 242, 90-95 (1987).</li>
</ol>

The authors declare no competing financial interests.

Thus, the above-described technique of intrathecal needle injections is efficacious, fast, specifically-localized, and nondestructive. Technically, the most critical aspect of this procedure is the point of needle insertion into the groove. It is crucial that this procedure is done with very calm hands and patience. Like many surgical procedures, training improves the rate of successful injection. This is also important because during an actual experiment, this technique does not provide an obvious indicator to directly ...

The spinal cord is a very important center in a variety of key biological processes and physiological functions, including processing and transmission of painful (nociceptive) inputs4-7. Various experimental techniques have been developed to facilitate pharmacological modulation of the spinal cord, such as chronic implantation of intrathecal catheters8, spinal cord microinjection, and intrathecal needle injection9. Each technique has its own advantages and drawbacks, and depending on the experiment paradigm one technique might be more suitable than the others. Whereas chronic implantation of intrathecal catheters is readily feasible in rat, this method is very difficult in the mouse, given size restrictions. Success rate is very low and motor deficits often occur due to the bulky presence of a catheter in the severely confined subdural space in the mouse. Moreover, long term delivery of drugs is rendered due to frequent clotting of chronically implanted catheters. Finally, immune reactions are common.
These problems can be circumvented using the method of acute intrathecal injection via a needle in the absence of a preimplanted catheter, which enables a fast and anatomically limited application of drugs and reagents to the spinal cords in mice. This method fully retains the benefits of intrathecal delivery over other systemic delivery routes (e.g. oral, intravenous, intraperitoneal, etc.) such as specificity of spinal modulation, which permits reduced dosages and limit side effects, as well as ability to deliver substances do not&#160;normally do not cross the blood brain barrier since during intrathecal injection, the needle is inserted between the dura mater and the spinal cord. Importantly however, in comparison to other methods of intrathecal delivery, the intrathecal needle injection method is the least invasive, allowing numerous applications in the same animal without causing any considerable tissue damage or evoking immune reaction due to implantation of foreign material. However, it requires technical skills for a very precise targeting of the needle to permit efficacy.
Here, we visually demonstrate the method for achieving an optimal rate of success for specifically targeting the lumbar spinal cord. The site of injection that is chosen in this experiment is the groove between L5 and L6 vertebrate column, near to where the spinal cord ends, to minimize the possibility of damaging the spine. Moreover, we demonstrate the use of this technique to knock down genes in the spinal cord using siRNAs.

<table><tbody><tr><td>&lt;em&gt;In Vivo&lt;/em&gt;-jetPEI</td><td>Polyplus</td><td>201-10G</td><td>&amp;nbsp;</td></tr><tr><td>WAVE1 siRNA</td><td>Santa Cruz</td><td>sc-36832</td><td>&amp;nbsp;</td></tr><tr><td>Control siRNA-A</td><td>Santa Cruz</td><td>sc-37007</td><td>&amp;nbsp;</td></tr><tr><td>Anti-&amp;szlig;-Tubulin III antibody</td><td>Sigma</td><td>T2200</td><td>&amp;nbsp;</td></tr><tr><td>Anti-WAVE1 antibody</td><td>R&amp;amp;D Systems</td><td>AF5514</td><td>&amp;nbsp;</td></tr><tr><td>Fast green dye</td><td>Sigma</td><td>F-7252</td><td>&amp;nbsp;</td></tr><tr><td>Isoflurane</td><td>Baxter</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Isoflurane setup</td><td>Dr&amp;auml;ger L&amp;uuml;beck</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Shaver</td><td>Wella</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Hamilton syringe Gastight 1702</td><td>Hamilton</td><td></td><td>&amp;nbsp;</td></tr><tr><td>30 G 1/2 in 13 mm Needle</td><td>BD Microlance</td><td>304000</td><td>&amp;nbsp;</td></tr><tr><td>Microscope Leica MS5</td><td>Leica</td><td></td><td>&amp;nbsp;</td></tr><tr><td>WAVE1 forward primer for qRT-PCR</td><td>Sigma</td><td></td><td>cacagagcctcaggacagg</td></tr><tr><td>WAVE1 reversed primer for qRT-PCR</td><td>Sigma</td><td></td><td>cttttcaccaacggcatctt</td></tr><tr><td>FastStart Essential DNA Green Master</td><td>Roche</td><td>6402712001</td><td>&amp;nbsp;</td></tr></tbody></table>

in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter implantation. The technical limitation of this surgical technique lies in the finesse of the hands. The injection is rapid, especially for a trained experimenter, and since tissue disruption with this technique is minimal, repeated injections are possible; moreover immune reaction to foreign tools (e.g. catheter) does not occur, thereby giving a better and more specific read out of spinal cord modulation. Since the application of the substance is largely limited to the target region of the spinal cord, drugs do not need to be applied in large dosages, and more importantly unwanted effects on other tissue, as observed with a systemic delivery, could be circumvented1,2. Moreover, we combine this technique with in vivo transfection of nucleic acid with the help of polyethylenimine (PEI) reagent3, which provides tremendous versatility for studying spinal functions via delivery of pharmacological agents as well as gene, RNA, and protein modulators.

In order to illustrate a successful injection, we performed this technique using Fast Green FCF dye in adult C57Bl6 mice (8-10 weeks of age). The animal was allowed to recover for a few minutes after the injection to provide enough time for the dye to spread and then killed with an overdose of CO2. Subsequently, the vertebrate column was dissected and the spinal cord was exposed. The blue puncta corresponding to the diffused dye, marked the injection site. No sign of injury to the spinal cord could be seen, co...

This report describes a simple and rapid technique of intrathecal needle puncture for a localized transfection of siRNA in the lumbar spinal cord in mouse under short lasting light anesthesia.

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter ...

The overall goal of this procedure is to locally apply IRNA via intrathecal delivery into the spinal cord. This is accomplished by first preparing the optimal I-R-N-A-P-E-I complex reagent. The second step is to prepare the mouse for intrathecal injection.After at least 15 minutes of incubation time, the SI RNA mixed solution is drawn into a Hamilton syringe. The final step is to carefully perform the intrathecal injection, repeating the injections once every 24 hours to ensure optimal downregulation. Ultimately immuno blotting and quantitative real-time.PCR are used to show the successful downregulation in protein and mRNA levels from the INA transfection. The main advantage of this technique is that it is less invasive than an intra catheter or a spinal cord injection. Generally, individuals new to this method must work to acquire the finest needed to inject through a small groove between the federal column without damaging the spinal cord.To prepare the SIR a solution begin by diluting the desired amount of SIR A with sterile water. Then dilute this further with 10%glucose solution mixed by pipetting up and down. To make the PEI solution dilute the required amount of PEI reagent with sterile water and dilute this further with 10%glucose solution mixed by pipetting up and down.Next, add the Irna solution to the PEI solution all at once and vortex gently then incubate the mixed solution for 15 minutes at room temperature while the mixture is incubating, prepare the mouse for intrathecal injection. After anesthetizing the mouse with 3%ice of fluorine, shave around two square centimeters of fur near the base of the tail and clean the injection site with alcohol. Then place the mouse in a nose cone for continued isof fluorine administration during the procedure and reduce the isof fluorine to 1.5%Using a 25 microliter Hamilton syringe attached to a 30 gauge half inch needle, draw up enough of the irna PEI solution to inject between five and 10 microliters.Next, locate the most prominent spinous process, which is the L six. Fix the vertebral column around this area by gently pressing just above the L six, applying enough pressure to feel the spinous process without depressing the entire body. Then using a fingernail, locate the groove of the L five and L six vertebrae.Now carefully insert the needle between the groove of the L five and L six vertebrae and look for a tail flick, which indicates a successful entry of the needle into the intradural space. Once the tail flick is observed, immediately but carefully secure the needle position with one hand and slowly inject between five and 10 microliters of substance with the other hand. Once the injection is finished, move the mouse back to the cage to recover from anesthesia.Repeat this injection at least two more times every 24 hours to achieve optimal downregulation of the targeted gene. Following acute intrathecal injection with fast green dye, there is no visible sign of tissue injury at the site of the injection, which is marked by the die Punta excision of the spinal cord. A few minutes after injection shows a diffusion of dye in the rostral direction.The star marks the injection site and the white box marks the lumbar region. A transverse view of the spinal cord at the L three to L five segment shows specific staining on the surface, but not the interior of the spinal cord. Following intrathecal injection of fast green intrathecal injections on three consecutive days of irna targeted against wave one mixed with PEI reagent resulted in a downregulation of the wave one protein in the dorsal lumbar spinal cord as compared to scramble siRNA control injections as shown by Western blotting and by QR TPCR.Western blotting quantification from the lysate of ventral L three to L five spinal cord and cervical spinal cord showed similar downregulation of the wave one protein while lysates from the brain and DRGs did not. After watching this video, you should have a good understanding of how to do an intra injection efficiently and moreover to specifically downregulate proteins in the spinal cord.

in-vivo-sirna-transfection-gene-knockdown-spinal-cord-via-rapid

Research

JoVE Journal

Biology

A minimally invasive protocol to stabilize the mouse spinal column and perform repetitive in vivo spinal cord imaging using two-photon microscopy is described. This method combines a spinal stabilization device and an anesthetic regimen to minimize respiratory-induced movements and produce raw imaging data that require no alignment or other post-processing.

In vivo Imaging of the Mouse Spinal Cord Using Two-photon Microscopy

Source: Tadokoro, T., et al. Subpial Adeno-associated Virus 9 (AAV9) Vector Delivery in Adult Mice. J. Vis. Exp. (2017)This video demonstrates a subpial injection technique for gene delivery to the spinal cord in mice. The procedure involves exposing the dura mater, puncturing the pia mater, and injecting a recombinant adeno-associated virus (rAAV) carrying a fluorescent protein-expressing gene into the subpial space. Following injection and recovery, the virus facilitates gene expression in...

Subpial Gene Delivery in the Mouse Spinal Cord to Evaluate Gene Expression

Viral vectors allow for targeted gene manipulation. We demonstrate a method for conditional gene expression or ablation in the mouse spinal cord, using stereotaxic injection of a viral vector into the dorsal horn, a prominent site of synaptic contact between primary somatosensory afferents and neurons of the central nervous system.

Stereotaxic Injection of a Viral Vector for Conditional Gene Manipulation in the Mouse Spinal Cord

Here, we present an in vivo technique for gene transfer to Schwann cells (SCs) in the rodent sciatic nerve. This simple technique is useful for investigating signaling mechanisms involved in the development and maintenance of myelinating SCs.

In Vivo Gene Transfer to Schwann Cells in the Rodent Sciatic Nerve by Electroporation

Intraspinal injection of recombinase dependent recombinant adeno-associated virus (rAAV) can be used to manipulate any genetically labelled cell type in the spinal cord. Here we describe how to transduce neurons in the dorsal horn of the lumbar spinal cord. This technique enables functional interrogation of the manipulated neuron subtype.

Adeno-associated Virus-mediated Transgene Expression in Genetically Defined Neurons of the Spinal Cord

Here we present a direct intrathecal injection technique using 1% lidocaine hydrochloride in a viral solution to ensure efficient adeno-associated virus delivery to small animals and establish a scoring system to predict transduction efficiency in the central nervous system according to the degree of transient weakness induced by lidocaine.

Direct Intrathecal Injection of Recombinant Adeno-associated Viruses in Adult Mice

This protocol demonstrates injection of a retrogradely transportable viral vector into rat spinal cord tissue. The vector is taken up at the synapse and transported to the cell body of target neurons. This model is suitable for retrograde tracing of important spinal pathways or targeting cells for gene therapy applications.

Direct Injection of a Lentiviral Vector Highlights Multiple Motor Pathways in the Rat Spinal Cord

Here, we describe a method for delivering drugs to the rat central nervous system by implanting a catheter into the lumbar intrathecal space of the spine. We focus on the delivery of antisense oligonucleotides, though this method is suitable for delivery of other therapeutic modalities as well.

Intrathecal Delivery of Antisense Oligonucleotides in the Rat Central Nervous System

A surgical procedure is described to perform injections into the lumbar cistern of the juvenile rat. This approach has been used for the intrathecal delivery of gene therapy vectors, but it is anticipated that this approach can be used for a variety of therapeutics, including cells and drugs.

Intrathecal Vector Delivery in Juvenile Rats via Lumbar Cistern Injection

A lumbar intrathecal injection represents a translationally relevant route of administration for delivering gene therapy to the central nervous system. This comprehensive standardized protocol for lumbar intrathecal injections in neonatal, juvenile, and adult mice and rats aims to guide researchers in adopting this technique for preclinical gene therapy studies.

Lumbar Intrathecal Injection of Gene Therapy Vectors for Central Nervous System Targeting in Mice and Rats

This article details intrathecal delivery methods for CNS-targeted therapeutics in adult mice, focusing on protocol precision and enabling repeated injection. It includes findings from a validation study where antisense oligonucleotides reduced mutant SOD1 expression in SOD1-ALS model mice, supporting the utility of the approach in preclinical research on neurodegenerative diseases.

Lumbar Intrathecal Injection of SOD1-ASOs for Precise CNS Targeting and Predictive Efficacy in Human SOD1-G93A ALS Mice

Learn rapid intrathecal siRNA transfection for gene knockdown in mouse lumbar spinal cord using noninvasive needle puncture. This technique enables efficient localized gene silencing with minimal tissue damage.

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

Explore More Videos