Enzimlerin Klonlanması DNA Doğrudan Gözlem Tek bir molekülü DNA Testi Esneme

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Biz bireysel DNA molekülleri bakteriyofaj çoğaltma sistemi proteinleri aracılığı ile gerçek zamanlı çoğaltma gözlemlemek için bir yöntem açıklanmaktadır.

Cite this Article

Copy Citation | Download Citations

Kulczyk, A. W., Tanner, N. A., Loparo, J. J., Richardson, C. C., van Oijen, A. M. Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay. J. Vis. Exp. (37), e1689, doi:10.3791/1689 (2010).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Biz bireysel DNA molekülleri bakteriyofaj çoğaltma sistemi proteinleri aracılığı ile gerçek zamanlı çoğaltma gözlemlemek için bir yöntem açıklanmaktadır. Lineerleştirilmiş λ DNA bir iplikçik sonunda bir biotin, ve aynı iplikli diğer ucunu bir digoxigenin benzer parçaları değiştirilir. Biotinlenmiş sonuna Fonksiyonlu cam lamel ve küçük bir boncuk digoxigeninated sonuna eklenir. Bir akış hücre yüzeyinde bu DNA boncuk hayvan iplerini montaj, laminer akış, boncuk üzerinde sürükleyin kuvvet uygularlar uygulanmasına olanak veriyor. Sonuç olarak, DNA ve paralel akış hızı (Şekil 1) tarafından belirlenen bir kuvvet lamel yüzeye yakın gerilir. DNA uzunluğu boncuk pozisyonunun izlenmesi ile ölçülür. Tek ve çift iplikli DNA arasındaki uzunluk farklılıkları çatal çoğaltma proteinlerin aktivitesini gerçek zamanlı bilgi elde etmek için kullanılmaktadır. Boncuk pozisyon ölçme gevşemek DNA ve polimerizasyon (Şekil 2) oranları ve processivities hassas belirliyor.

Protocol

1. DNA replikasyonu Şablonu

Reaksiyon için DNA replikasyon çatal oluşturmak için oligonükleotidler tavlama tarafından değiştirilmiş Lineerleştirilmiş λ DNA. Ayrıca, biotin λ DNA iplikçik sonuna kadar bağlı olduğu ve bir digoxigenin benzer parçaları aynı iplikçik 1 diğer ucuna takılı.

Malzemeler: bakteriyofaj λ DNA Oligonükleotidler: biotinlenmiş çatal kol (A: 5'-biotin-AAAAAAAAAAAAAAAAGAGTACTGTACGATCTAGCATCAATCACAGGGTCAGGTTCGTTATTGTCCAACTTGCTGTCC-3 '), λ-tamamlayıcı çatal kol (B: 5'-GGGCGGCGACCTGGACAGCAAGTTG GACAATCTCGTTCTATCACTAATTCACTAATGCAGGGAGGATTTCAGATATGGCA-3'), çatal astar (C: 5 ' -TGCCATATCTGAAATCCTCCCTGC-3 '), λ-tamamlayıcı digoxigenin sonunda (D: 5'-AGGTCG CCGCCCAAAAAAAAAAAA digoxigenin-3'), T4 DNA ligaz, T4 polinükleotid kinaz, Isı bloğu.

  1. T4 Polinükleotid Kinaz kullanarak, B ve D oligonükleotidler 5 'uçları Phosphorylate.
  2. A ve B oligonükleotidler 10 kat daha fazla ve T4 DNA ligaz tamponu oligonükleotid C 100 kat daha fazla ekleyerek bir adım λ DNA oligonükleotidler A, B, ve C Tavlama.
  3. 65 ° C ısı bloğu karışımı ısıtın. Isıtmalı, ısı bloğu kapatın ve düzgün oligonükleotidler tavlama yavaş soğutma izin.
  4. T4 DNA ligaz karışıma ekleyin ve 2 saat oda sıcaklığında inkübe edin. T4 DNA ligaz oligonükleotidler A ve B, ve λ DNA doğru birleştirilmesi katalize.
  5. Son olarak, T4 DNA ligaz tamponu l DNA saygı oligonükleotid D 100 kat daha fazla ekleyerek DNA replikasyonu şablonu oligonükleotid D tavlama.
  6. 45 ° C 30 dakika, ısıtma bloğu ve oda sıcaklığına kadar soğumasını yavaş ısıtma bloğu kapatarak karışımı inkübe edin.
  7. Son DNA replikasyonu şablonu artık kullanıma hazır. Biz 4 1.4 nM konsantrasyonda şablonu depolamak ° C'de birkaç hafta boyunca.

2. Boncuk

Boncuk digoxigenin özgüllüğü ile Fab parçası Fonksiyonlu. Daha sonra DNA replikasyonu şablon 2 eklenebilir.

Malzemeler: Tosyl aktif boncuk, α-digoxigenin Fab parçası, A Buffer: 0,1 M H3BO3 pH 9.5, Tampon B: 0,1 M PBS pH 7.4,% 0.1 w / v BSA, Tampon C: 0.2 M Tris-HCl, pH 8.5 (25 ° C),% 0.1 w / v BSA, Manyetik Ayırıcı, Rotator.

  1. Boncuk stok solüsyonu süspanse edin ve Eppendorf tüp içine küçük bir kısım aktarmak. Tüp çözüm temizler kadar manyetik ayırıcı ve inkübe bir yuvaya yerleştirin, sonra pipetleme tarafından süpernatant kaldırmak.
  2. Tosyl antikor kaplin grupları etkinleştirmek hangi bir tampon ekleyin. Pipetleme tarafından yavaşça karıştırın ve manyetik ayırıcı ile tampon kaldırmak.
  3. Tampon A, tekrar Fab parçası ve tekrar süspansiyon boncuk ekleyin, iyice karıştırın ve 37 ° C kullanarak rotator 16-24 saat inkübe edin. Inkübasyondan sonra, ayrı boncuk manyetik ayırıcı ve tampon kaldırmak.
  4. 5 dakika boyunca tampon B ve 4 ° C'de inkübe ekleyerek boncuk yıkayın. Manyetik ayırıcı kullanarak tampon çıkarın. Yıkama iki kez tekrarlayın.
  5. Ücretsiz tosyl grupları engellemek için 4 saat süreyle inkübe ° C 37 ° tampon C ve ekleyin. Ayrı boncuk manyetik ayırıcı ve tampon çıkarın.
  6. Tampon B ve kullanmak için kısım iki kez yıkayın. Boncuk 4 saklanabilir ° C için önemli kalite kaybı (bizim stok solüsyonu içeren 1 - 2x10 9 boncuk / ml) olmadan en az 1 yıl veya daha uzun.

3. Fonksiyonlu lameller

DNA cam lamel ek izin vermek için, cam, daha sonra biotinlenmiş PEG moleküllere birleştiğinde bir aminosilane, ilk işlevselleştirildiyse. Bu kaplama yüzeyi 3,4 ile non-spesifik etkileşimler, DNA ve çoğaltma proteinler azaltmaya yardımcı olur .

Malzemeler: Cam lamelleri, Boyama kavanoz, 3-aminopropyltriethoxysilane, metoksi-PEG5k-NHS ester, Biotin-PEG5k-NHSester, Aseton, 1M KOH, Etanol, Fırın, Banyo sonikatör

  1. Cam kavanoz boyama ve etanol ile kavanoz dolum onları yerleştirerek lamelleri iyice temizleyin. Kavanoz yıkayın ve 1 M KOH ile doldurun, 30 dakika boyunca sonikasyon. Hem yıkar tekrarlayın.
  2. Ilk işlevsellik tepki için, tüm su izlerini kaldırılması gerekir. 10 dakika aseton ve sonikasyon kavanozları doldurun. Aseton ile boşaltın ve yeniden doldurun.
  3. 2% v / v aseton silan reaktif bir çözüm hazırlayın. Boyama kavanoz ekleyin ve 2 dakika boyunca ajitasyon. Bu reaksiyon çiftler cam aminosilane alkoksi grup, bir sonraki kaplin adım için bir reaktif amin bırakarak. Büyük bir su fazlalığı ile reaksiyon Quench.
  4. 110 pişirme lamelleri Kuru °; C fırında 30 dakika.
  5. 100 mM NaHCO 3 pH 8.2 50:1 metoksi: biotin PEG karışımı hazırlayın. Amaç yaklaşık% 0.2 w / v biotinlenmiş PEG.
  6. Pipet 100 mcL kuru Silanlanmış lamel ve yer üstünde başka bir lamel üzerine PEG karışımı. Bir cam lamel spacer dahil lamelleri ayrılması sağlayacaktır.
  7. 3 saat PEG çözüm lamelleri inkübe edin, sonra her çift lamelleri ayrı ve suyla iyice yıkayın. Sadece bir kez yan PEG ile kaplı olacak gibi lamelleri yan Fonksiyonlu tutmak için dikkatli olun.
  8. Lamelleri desikatöre vakum altında ve hava deposu ile kurulayın. Yüzeyler en az ayda bir sabit kalır, bu yüzden onlarca lamelleri bir toplu yapılan ve gerektiği gibi kullanılabilir.

4. Akış Odası Hazırlık

Deney Fonksiyonlu lamel, çift taraflı bant, kuvars slayt ve boru ile yapılan basit bir akış odası kullanılarak yapılır. Bir akış odasının her biri tek-molekül deney 2,4 için hazırlanmıştır .

Malzemeler: Çift taraflı bant, jilet, boru, çabuk kuruyan, epoksi delikli kuvars slayt, işlevselleştirildiyse lamel, streptavidin çözümü (1 mg / mL PBS içinde 25 mcL), boru, engelleme tampon (5X: 20 mM Tris, pH 7.5, 2 mM EDTA, 50 mM NaCl, 0.2 mg / ml BSA,% 0.005 Tween-20), çalışma tampon (1X: 20 mM Tris-HCl, pH 7.5, 2 mM EDTA, 50 mM NaCl).

  1. Karıştırma ve engelleme tampon ve sonraki adımlar için herhangi bir hava kabarcıklarını çıkarmak için bir desikatöre tampon çalışma 20 ml 5 ml koyarak başlayın.
  2. PEG-Fonksiyonlu lamel alın ve PBS-seyreltilmiş streptavidin çözüm yüzey üzerinde 125 yayıldı. Streptavidin yüzey biotins bağlamak için izin vererek, odanın diğer bölümlerine hazırlarken oda sıcaklığında 20 dakika inkübe bırakın.
  3. Kuvars slayt boyutuna uyacak şekilde çift taraflı bant bir parça kesin. Akış odasının bir taslak bant çizilebilir, böylece bant boru delik konumunu işaretleyin.
  4. 3 mm çapında bir merkez kanal ve iki delik içeren dikdörtgenler olun. Biz iki giriş ve iki çıkış Y-şekilli kanal akışı odaları kullanın.
  5. Kanal içine herhangi bir yapışkan çıkıntı emin olmak için düz ve temiz kesim, çizilen taslak boyunca kesin.
  6. Kuvars iyice kullanarak aseton veya etanol önceki akış hücresi inşaat yapıştırıcı çıkarmak için temizleyin.
  7. Kanal anahat iyi hizalama, bir tarafı yapışkanlı arka kaldırmak ve kuvars slayt üzerine bandı dikkatlice yerleştirin. Giriş ve çıkış delikleri unblocked kalmaya ihtiyacı gibi, bant düzgün hizalamak için dikkatli olun.
  8. Akış hücresi giriş ve çıkış boru uzunlukları kesin. Bu tüp odası dibine düz basın böylece ilgili bir 30 ° açı tüp sonuna kesmek için yardımcı olur. Sonraki adımlar akış hücresi kolay eki için askıya destek (örneğin tüp rafları) bir çeşit tüpler yerleştirin.
  9. Streptavidin kaplı lamel su ile iyice durulayın ve basınçlı hava kullanarak kurutun. Sadece bir tarafı Fonksiyonlu olduğunu unutmayın. Teyp yedekleme diğer tarafına çıkartın ve kuvars slayt lamel üzerine yerleştirin.
  10. Yapıştırıcı sıkışıp herhangi bir hava hafifçe dışarı itmek için lamel basın. Bu akış kanalı içine almak herhangi bir hava kabarcıkları önlemeye yardımcı olacaktır.
  11. Epoksi ile odasının yanında Seal. Kesilmiş boru epoksi ile kuvars ve mühür deliklere yerleştirin. Bu, birkaç dakika kurumasını gerekiyor.
  12. Kuruduktan sonra, bazı gazlar engelleme tampon tüplerinden biri aracılığıyla çekerek yüzey engelleme başlar. 21-gauge iğne, 0,76 mm boru içinde mükemmel uyum sağlar. Hava kabarcıklarını çıkarmak için birkaç kez yıkayın ve odasının en az yarım saat süreyle inkübe izin.

5. Tek molekül Çoğaltma Deney

DNA şablonu ve Fonksiyonlu boncuk hazırlanan ve akış odasının hazır var, tek bir molekülün deney yapılabilir.

Malzemeler: Hazır akış odası, Engelleme tamponu (5X: 20 mM Tris-HCl, pH 7.5, 2 mM EDTA, 50 mM NaCl, 1 mg / ml BSA,% 0.025 'Tween-20), Çalışma tamponu (1X: 20 mM Tris-HCl pH 7.5, 2 mM EDTA, 50 mM NaCl), T7 çoğaltma tamponlar veya 10mM MgCl 2 olmadan (1X: 40 mM Tris-HCl, pH 7.5, 50 mM K-glutamat, 2 mM EDTA, 100 mg / ml BSA, 10 mM DTT, 600 mcM dNTP), çoğaltma proteinleri, 10X amacı, CCD kamera, kalıcı nadir toprak mıknatısı, şırınga pompası, airspring, fiber aydınlatma, bilgisayar görüntü elde etme yazılımı ile ters optik mikroskop.

  1. Akış hücresi bloke edildikten sonra, denemeyi başlatmak için hazır.
  2. Akış hücresi ve mikroskop sahne üzerine yerleştirin. Sahne klipler ile oda tutunve akış kanal CCD kamera ile uyum içinde yerleştirilmiş olduğundan emin olun.
  3. Akış hücresi çıkış tüpleri, daha büyük çaplı bir konnektör boru veya bir iğne kullanarak airspring bağlayın. Airspring herhangi bir akım düzensizliklerini stabilize etmek için kullanılır. 50 ml plastik tüp 45ml su ile dolu. Epoksi ile tüp kapağı kapatılır. Üç delikler kapak delinmiş ve üç adet tüp tüp içine yerleştirilir. Epoksi kullanarak, tüpleri sonra girerek veya kaçan herhangi bir hava önlenmesi, kapağı mühürlenir. Airspring şırınga pompa ve akış hücresi çıkışına tüpler bağlıdır.
  4. Yerleştirin ve tampon engelleme akışını hücrenin giriş tüpleri, tüp içindeki herhangi bir havayı çıkarmak için şırınga geri çekin. Çıkış borusunun nazik bir fiske akış hücresi sıkışmış olan herhangi bir hava kabarcığı temizlenmesine yardımcı olacaktır.
  5. Tüm hava kabarcıkları kaldırıldı, bir iğne ile giriş tüpleri biri olan ve 1800 ile bükme ve tüp yapışkan bant ile güvence çıkış tüpleri bir blok.
  6. 10:00 gazlar engelleme tampon 1 ml stok DNA şablonu sulandırınız. DNA (20 dakika ,01-0,05 ml / dak iyi çalışır) iyi yüzey kapsama sağlamak için orta akış hızında odasına Akış. Bu lamelleri her parti için yüzeyde ya da deney için kaç istenilen kaç DNA molekülleri dayalı çeşitli olabilir.
  7. 2-4x10 6 boncuk / ml 1 ml gazlar engelleme tampon stok boncuk çözüm sulandırınız. 0,01-0,05 ml / dk 15 dakika odasına Akış.
  8. Boncuk eklendi akışı kapatın ve odasına dengeye ulaşması için izin. Sonra her iki çıkış tüpleri kapatın. Kabinsiz tüpler herhangi bir değişiklik, boncuk ve kesme gergin DNA molekülleri üzerinde güçlü bir kuvvet uygularlar basınç dalgalanmalara neden kapattı.
  9. Bir iğne ile boncuk yüklemek için kullanılan giriş tüp blok ve akış hücresi, çalışma tampon engelleme tampon gazlar 1X çözümü ile ikinci giriş kullanarak yıkama başlamak. 0,01-0,05 ml / dak hızında iyice yıkayın. Nonspecifically yüzey (yapışmış herhangi bir boncuk kaldırmak için dokunarak sahne elle dokunulduğunda çalkalayın ).
  10. Ücretsiz boncuk yeterince kaldırıldıktan sonra, akış kapatın ve odasına dengeye ulaşması için izin. Kapatın ve açık çıkış borusunun giriş haznesi protein solüsyonu geçiş, yavaş yavaş, hızlı basınç değişiklikleri önlemek için çıkış açılış
  11. Boncuklar, akış yönünü (değiştirerek DNA gergin olup olmadığını kontrol edebilirsiniz DNA ) .
  12. Şimdi, enzimatik reaksiyon yapılabilir. Önde gelen iplikçik sentez deneyleri GP4 helikaz ve MgCl 2 içermez gazlar T7 çoğaltma tampon GP5 polimeraz (processivity faktör tiyoredoksin ile bir kompleks olarak arıtılmış) 20nm çözüm, 20nm çözüm olun .
  13. DNA verimli bağlama izin orta akış hızında odasına protein çözüm Akış. 0.037 ml / dk 8 dakika sonra 0.012 ml / dk 7 dakika.
  14. MgCl 2 olmadan gazlar T7 çoğaltma tamponu ile serbest proteinler kaldırmak için odasına yıkayın. 0.037 ml / dk 3-10 dakika oranı gayet iyi çalışıyor.
  15. Yıkadıktan sonra, akış T7 çoğaltma MgCl 2 ile tampon ve veri toplama başlar. 0.012 ml / dak bu protokolde belirtilen koşullar altında DNA hayvan iplerini 3 pN sürtünme kuvveti uygun bir akış hızını kullanın.
  16. Görüntüleme nonspesifik boncuk ve yüzey arasındaki etkileşimleri önlemek için önce bir akış hücresi üzerinde nadir toprak kalıcı mıknatıs yerleştirin.
  17. 10X objektif ve CCD kamera ile saha. Gergin bir boncuk kullanarak odaklanın.
  18. Bir fiber ışığı 10 derece ve mikroskop yakın mikroskop aşamasına paralel arasındaki insidansı açıyla yerleştirin. Karanlık alan aydınlatma boncuk görüntülemede kontrast arttırmak için kullanılır.
  19. 20 30 dakika süreyle yavaş bir kare hızı (genellikle 2-4 Hz) veri almak.

6. Temsilcisi Sonuçlar

Başarılı bir deneyde (aynı anda 100'den fazla boncuklar gözlemlemek gerekir Lider iplikçik sentez) . Deney önde gelen iplikli DNA sentezini gösteren sayısız izlerini boyun eğmek zorundadır.

Veri Analizi:

DNA ve polimerizasyon gevşemek oranları ve processivities ölçmek için, boncuk kesin pozisyonları tespit edilmelidir. 2-boyutlu Gauss fonksiyonları ile bu pozisyonları takarak elde edebilirsiniz. Yörüngeler sonra izleme yazılımı (örneğin DiaTrack) kullanarak her bir karenin izleme boncuk pozisyonu ile elde edilebilir. Şimdi, böylece herhangi bir grafik kullanarak zamanın bir fonksiyonu olarak boncuk pozisyonu komplo ile yörüngeleri görselleştirmek için hazırızFtware (örneğin Kökeni). Oran veri elde etmek için, lineer regresyon ile araziler uyum ve eğimi hesaplamak. Processivity için, başından sonuna kadar bir kısalma olay (Şekil 3) DNA toplam uzunluğu belirler. Her ikisi de bu sayıların basepairs dönüştürülebilir gerekecektir. Basepairs için boncuk hareket dönüştürmek için, ilk reaksiyon debisi uzatılmış λ DNA molekülünün uzunluğunu ölçmek gerekir. Λ DNA uzunluğu (48.502 bp) bilindiğinden deneysel gücü az sayıda baz çifti / piksel kalibre edebilir. Artan doğruluğu için bir temel eser ilgi enzimatik değişmez bir boncuk sabrının izlerini çıkarmak. Tüm tek ölçüm ve çizim hızı ve processivity dağıtımları birleştirin. Gauss ve tek üstel fonksiyonlar, sırasıyla (Şekil 3) kullanarak veri sığdır.

Şekil 1
Şekil 1. Tek molekül deney düzeneği. (A) Dubleks λ DNA (48.5 kb) 5 üzerinden akışını hücrenin yüzeyine bağlı 'biotin streptavidin etkileşimi kullanarak bir iplikçik sonu ve 3' aynı iplikçik sonu kullanarak bir boncuk eklenir digoxigenin anti-digoxigenin etkileşim. Astarlanmalıdır çoğaltma çatal polimeraz yükleme izin boncuk karşısında sonunda oluşur. (B) Boncuk-DNA meclisleri laminer akış tampon kullanarak gergin ve geniş alan optik mikroskop kullanarak görüntülü. Sürekli bir germe kuvveti korurken, zamanla boncuk pozisyonları takip ederek, DNA yapıları uzunlukları izlenebilir. (C) düşük kuvvetler altında Uzantısı ssDNA profili (dolu daire) ve dsDNA (açık daire). Kesikli çizgi kristalografik tam ds-λ DNA uzunluğu, 16.3 mm gösterir. SsDNA ve dsDNA arasındaki uzunluğu 3 pN etrafında güçlerine büyük bir fark DNA uzunluğu izleme değişiklikleri ss ve dsDNA arasındaki dönüşümlerin doğrudan gözlem sağlar. DNA birleştiğinde boncuklar çok sayıda eş zamanlı görselleştirme, bir deney birçok bireysel replisomes çalışması için olanak sağlar.

Şekil 2
Şekil 2 bakteriyofaj T7 çoğaltma proteinler: DNA polimeraz (GP5 ve tiyoredoksin kompleks) ve DNA helikaz (GP4) deoxyribonucleotides ve magnezyum varlığında DNA lideri iplikçik sentez. Bu süreç, kıvrılma için DNA gecikmeli iplikçik kısaltılması ile eşlik ediyor. DsDNA boncuk ssDNA pozisyon değiştirir haline dönüştürülmesi. Boncuk pozisyon ölçme DNA replikasyon hızı ve processivity hassas tayini sağlar.

Şekil 3
Şekil 3 tipik bir veri tek bir molekül önde gelen iplikçik sentez deney örneği. DNA replikasyonu Processivity bir kısalma olayı başından sonuna kadar DNA toplam uzunluğu eşittir. DNA replikasyon oranı lineer regresyon arsa montaj ve eğimin hesaplanması ile elde edilir. Ölçümlerin bir dizi veri birleştirerek elde edildi içerlek gösterir oranı ve processivity dağılımları. Veriler sırasıyla, Gauss ve tek üstel fonksiyonlar kullanarak monte edildi.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Laminer akış boncuklar üzerinde uyguladığı sürtünme kuvveti çoğaltma proteinler enzimatik faaliyetlerin etkisi olmadığından emin olmak için çok önemlidir. Örneğin, 0.012 ml / dk akış oranına karşılık gelen 3 pN gücü önde gelen iplikçik DNA replikasyon etkilemez. Ancak enzimatik faaliyetleri koordine DNA sentezi sırasında yer alan etkilemez ve bu nedenle 1.5 pN azaltılmalıdır. Sürtünme kuvveti kolayca akış hızını veya akış kanalı 5 genişliği değiştirerek kontrol edilebilir.

DNA testinin germe, çift ve tek iplikli DNA arasındaki uzunluk farklılıkları kullanmaktadır. Deney ssDNA dsDNA dönüşüm için buraya açıklanan lider iplikçik sentez (Şekil 2) bir sonucu olarak ortaya çıkar. SsDNA 6 pN altında düşük esneme kuvvetleri (Şekil 1) sadece dsDNA daha kısa olduğunu hatırlamak gerekir.

3'-ucundaki ikinci bir boncuk takarak çoğaltma şablon gecikmeli iplikçik değiştirmek için bu yöntemin olası bir gelişme. Böyle bir arda iki DNA ipliklerini yer alan enzimatik faaliyetlerin doğrudan gözlem izin verecek.

Önde gelen iplikçik sentez ve koordineli çoğaltma çalışmaları dışında, DNA testinin uzanan başarılı bir çoğaltma 5,6 sırasında tek-molekül λ eksonükleaz kinetiği, polimeraz değişimi dinamiklerini incelemek için istihdam edilmiştir. Prensip olarak, bu yöntem, herhangi bir DNA işleme koyan enzimin incelemek için kullanılabilir.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Paul Blainey, Jong-Bong Lee ve Samir Hamdan uzanan DNA testinin geliştirilmesi yardımıyla oldu. Bu çalışma, Charles Richardson (GM54397) ve Antoine van Oijen (GM077248) Sağlık hibe Ulusal Sağlık Enstitüleri tarafından desteklenmektedir.

Materials

Name Company Catalog Number Comments
Bacteriophage λ DNA New England Biolabs N3011L
DNA Oligonucleotides Integrated DNA Technologies
T4 DNA Ligase New England Biolabs M0202L
T4 Polynucleotide Kinase New England Biolabs M0201L
α-digoxigenin Fab Roche Group 11214667001
Tosyl Activated Beads Invitrogen 142-03
Magnetic Separator Invitrogen Dynal MPC
3-aminopropyl-triethoxysilane Sigma-Aldrich A3648 Other aminosilanes can be used or mixed with non-amine reactive silanes for sparser surfaces
Succinimidyl propionate PEG Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Biotin-PEG-NHS Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Double-sided tape Grace Bio-Lab Inc. SA-S-1L 100 μm thickness
Quartz slide Technical Glass 20 mm (W)x 50 mm (L)x 1mm (H) Size to fit on coverslips. Drill holes with diamond-tip drill bits (DiamondBurs.net)
Polyethylene tubing BD Biosciences 427416 0.76 mm ID, 1.22 OD
Other size tubing can be substituted.
Streptavidin Sigma-Aldrich S4762 Make 1 mg/mL solution, 25 μL aliquots in PBS pH 7.3
Deoxyribonucleotide triphosphate solution mix New England Biolabs N0447
Inverted Optical Microscope with 10X Objective Olympus Corporation Olympus IX-51
Permament rare-earth magnet National Imports www.rare-earth-magnets.com
CCD Camera QImaging Rolera-XR Fast 139
Syringe Pump Harvard Apparatus 11 Plus Operate in refill mode to facilitate solution changes
Fiber Illuminator Thorlabs Inc. OSL1

DOWNLOAD MATERIALS LIST

References

  1. Lee, J. B. DNA primase acts as a molecular brake in DNA replication. Nature. 439, 621-624 (2006).
  2. Tanner, N. A., van Oijen, A. M. Single-molecule observation of prokaryotic DNA replication. Methods Mol Biol. 521, 397-410 (2009).
  3. Sofia, S. J., Premnath, V. V., Merrill, E. W. Poly(ethylene oxide) Grafted to Silicon Surfaces: Grafting Density and Protein Adsorption. Macromolecules. 31, 5059-5070 (1998).
  4. Tanner, N. A., Loparo, J. J., van Oijen, A. M. Visualizing single-molecule DNA replication with fluorescence microscopy. J Vis Exp. (2009).
  5. Hamdan, S. M., Loparo, J. J., Takahashi, M., Richardson, C. C., van Oijen, A. M. Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis. Nature. 457, 336-339 (2009).
  6. van Oijen, A. M. Single-molecule kinetics of lambda exonuclease reveal base dependence and dynamic disorder. Science. 301, 1235-1238 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics